T --- The most commonly used Key in OLX.
T --- The most commonly used key in SLMR
T Arrington wears sunglasses at night!
T H E F W O R D
T H E T R U T H I S O U T T H E R E
T H I S I S N O T A D A T I N G S E R V I C E ! !
T Tagline thievery ... On the next Geraldo!
T is for Ten Forward, the hostess is Guinan
T or F : Semen is a term for sailors.
T<wo Cents> for your thoughts...$20 to act it out....
T' be * AND * not t' be = Zen Shakespeare
T'Pau, sister of T'Boom and T'Bang.
T'Pring, T'Pow, T'Pooh: The sound a Vulcan makes while shooting.
T'dit, t'dit, t'dit, t'dats all folks!
T'greatest griefs are those we cause ourselves. Sophocles
T'ing ta'ting ting ting t't't'ta'ting t'ing t'ing -Rush, _YYZ_
T'ing ta'ting ting ting t't't'ta'ting t'ing t'ing -YYZ, Rush
T**R*IBBL*ES***E***VE*R*YWHE*RE!!!**
T*ts is such a friendly word. Kind of a new snack food... - G. Carlin
T-Recall BBS: Harder disks, bigger bits, tighter ASCII!
T-Shirt sported by Saddam Hussein: I would have voted Clinton!
T-Shirts - taglines for the Computer Illiterate.
T-Shirts. Heh! Sequels. Heh! A Jedi Knight craves not these things.
T-Shirts: Clothes captioned for the thinking-impaired.
T-Shirts: Recipes for the Computer Illiterate
T-Shirts: Taglines for the Computer Illiterate....
T-T Yep, you said it right.
T-shirtless in Amsterdam
T-shirtless in Amsterdam.
T-shirts in the year 2025 will read "Disco STILL sucks!"
T. G. I. DIE-Day - Mike
T. POWER - Ty Died in '58
T. R. C. Club member since 1989 - "Total Random Caos"
T. Rex: 10 ton roadrunner from hell!
T.A. ... Taglaholics Anonymous (800) 824-5463.
T.A.G. you're it!
T.E.A.M. T ogether E veryone A chieves M ore.
T.Rex: 20 ton roadrunner from hell!.
T@ *must* not have been gone long, his modem's still warm.
TABLOID(n): newspaper with a permanent (crime) wave
TABTRB: #10 A Tagline never asks, was it was good for you?
TABTRB: #11 You never have to break up with your Taglines.
TABTRB: #12 Taglines never make you sleep on the wet spot.
TABTRB: #13 Taglines don't snore.
TABTRB: #14 Stealing Taglines will never get you pregnant.
TABTRB: #9 You can steal Taglines all by yourself.
TACO BELL is NOT a Mexican telephone company!
TACO BELL isnt a Mexican telephone Co.???
TACT : a mutual agreement to be full of s**t!
TACT = The skill to tell me to go the Hell, and makes me want to go.
TACT(n):2tell a man he has open mind when he really has a hole in head
TACT,def: a mutual agreement to be full of s**t!
TACT--The ability to make a guest feel at home when you wish they were
TACT: a mutual agreement to be full of s**t!
TACT: Making guests feel at home when you wish they really were.
TACTICS: Candy for dyslexics.
TACTICS: Breath freshener for dyslexics.
TAFN That's All For Now
TAG YOU'RE IT !!!
TAG YOUR IT
TAG! YOU'RE IT!
TAG! You are it!
TAG! YOU'RE IT!
TAGLINE %JH3 TAGFILE
TAGLINE %JH3 TAGLINES
TAGLINE DEPARTMENT CLOSED
TAGLINE ERROR! Report to tech support, please.
TAGLINE FOR SALE.
TAGLINE FURNISHED UPON REQUEST
TAGLINE INSPECTION PATROL
TAGLINE Moderator does it with Taglines.
TAGLINE NOT FOUND - SYSTEM HALTED.
TAGLINE OMITTED DUE TO LACK OF FUNDING
TAGLINE POLICE: Please pull over to the side of the message.
TAGLINE POLICE: Please pull over to the side of the msg.
TAGLINE POLICE: Please pull over to the side of the message.
TAGLINE SECTION CLOSED FOR MAJOR REDEVELOPMENT
TAGLINE SERVICE DISCONTINUED UNTIL PAYMENT IS RECIEVED
TAGLINE assimilated, resistance is futile.
TAGLINE for rent, inquire within....
TAGLINE paranoia: The feeling that the moderator is watching you.
TAGLINE so large, it was necessary to compress.
TAGLINE.CTL corrupt deleting"Only just got the full set, Bother"
TAGLINE: A line that does the work of many (lines) !
TAGLINE: Scripture for computer nerds.
TAGLINE: Your chance to piss someone off.
TAGLINE: Your last chance to piss someone off.
TAGLINES (tag'linz) - bumper stickers for EMail.
TAGLINES : Poetry for short people...
TAGLINES ECHO: Saying it with taglines is the law.
TAGLINES ECHO: Where changing a thread saves you from the moderator!
TAGLINES ECHO: Where changing a thread saves you from the needle!
TAGLINES echo needs four moderators. Just in case one is on vacation.
TAGLINES needs four moderators. Just in case one is on vacation.
TAGLINES! We don't need no stinking taglines!
TAGLINES---one question, WHY?
TAGLINES.ANI Anime & Manga Quotes
TAGLINES.ANS ANSI Taglines
TAGLINES.BBS Taglines About BBSing
TAGLINES.CAR 'Toons & Comix
TAGLINES.CAT Taglines About Cats
TAGLINES.COM Taglines About Computers
TAGLINES.DEF Unusual Definitions
TAGLINES.DUM Dumb Questions
TAGLINES.FLI Outrageous Flirting
TAGLINES.FRE Taglines About Friends & Friendship
TAGLINES.GEN General Purpose Taglines
TAGLINES.HIN Humourous Insults
TAGLINES.IMP Important Messages Using Humour
TAGLINES.INJ In-Jokes (Don't Even BOTHER To Get These)
TAGLINES.LOV Love And Other Mysteries Of Life
TAGLINES.PHI Philosophic Taglines
TAGLINES.PUT Put-Downs
TAGLINES.QHE Quote Headers (non-taglines)
TAGLINES.QUO Famous Quotes
TAGLINES.REP Answering Taglines--Special Replies & Snappy Answers
TAGLINES.RPG RPG Taglines
TAGLINES.SER Serious Philosophic Taglines
TAGLINES.SEX Sexual Innuendoes & Other Rude Subjects
TAGLINES.SIN Serious Insults
TAGLINES.SSQ Quotes With A Serious Message
TAGLINES.STU Stupid Comments
TAGLINES.TAG Taglines About Taglines (!)
TAGLINES.WAR Taglines About War, History, Diplomacy and Politics
TAGLINES: Share and steal alike. (GW)
TAGLINES: Things that make you go 'Hmmm ...'
TAGLINES: Bumper stickers for electronic mail.
TAGLINES: FACT OR FICTION? On Geraldo!
TAGLINES: FACT OR FICTION? On the next GERALDO !
TAGLINES: Share and steal alike. (GW)
TAGLINES: Things that make you go 'Hmmm..'.
TAGLINES: who cares where they come from...?
TAGLINES? We don't need no steeeking TAGLINES!
TAGLINES?! We don't need no steenkin' tagline
TAGTEAM... A bunch of people thinking up taglines!
TAG_TALK is one FidoNet conference that does not allow cross posting of
TAH: Take A Hike
TAI: Trap Absurd Inputs
TAILORS come with no strings attached
TAILORS make it fit
TAILORS make it fit.
TAIWAN activates the 8th of any month
TAKE A KID CAMPING THIS SUMMER....AND LEAVE'M!
TAKE A KID CAMPING and leave it there...
TAKE A MINUTE TO THANK YOUR SYSOP
TAKE, v.t. To acquire, frequently by force but preferably by stealth.
TAMPAX..A small woodland tool
TANDY is dandy, but IBM don't rot your brain!
TANJ There Ain't No Justice
TANKERS do it but leave tracks.
TANKERS do it with protection.
TANSTAAFL
TANSTAAFL There Ain't No Such Thing As A Free Lunch
TANSTAAFL - Grok?
TANSTAAFL. Bummer! What about dinner?
TANSTAAFL: There Ain't No Such Thing As A Free Lunch
TAP DANCERS do it with their feet
TARC: Take Arithmetic Review Course
TARDIS Express - When it absolutely must be there BEFORE you send it!
TARDIS Express: When it absolutely must be there BEFORE you send it!
TARDIS Express: When it absolutely, positively has to be there yesterday.
TARDIS Express: When it absolutely must be there BEFORE you send it!
TARDIS Express:When it absolutely, positively, must be there yesterday
TARDIS Mail: When it has to be there before you send it
TARDISDOS 1.0 : Delete CONSOLE.ROOM? (Y/n/Maybe) =->
TARDISDOS 2.0 : (M)alfunction (G)ive Doctor a good tossing (A)bort
TARDISDOS 3.0 : Bang fist on any part of the console to continue
TARDISDOS 3.0 : Bang fist on any part of the console to continue ...
TARDISDOS 4.0 : BIG.BANG found. (P)anic (S)elf-destruct (F)ake it?
TARDISDOS 5.0 : Delete BIG.LUXURIOUS.POOL.ROOM.WITH.SAUNA? (Y/n) =->
TARDISDOS 6.0 : Delete DOCTOR.WHO? (Y/n/Partially) =->
TARDISDOS 7.0 : Delete ONLY.NEEDED.ROOM.IN.WHOLE.EPISODE? (Y/n) =->
TARDISDOS 8.0 : (N)ew Console (M)ove column up/down (S)nap&pop
TARDISDOS 9.0 : (D)isplay something illegible (M)ake weird sounds
TARFU -- Things are Really Fouled Up
TARFU: Things are Really Fouled Up
TAS The Animated Series
TATTOO: One of the few things you CAN take with you.
TAX FORMS SHOULD READ INCOME OWED US AND IN COMMODE YOU.
TAX THIS CLINTON!
TAXES,n.-The more you make, the more THEY take.
TAXES: your money spent for things you wouldn't buy.
TAXES: your money spent for things you wouldn't buy
TAXI CAB DRIVERS come faster
TAXI DRIVERS do it all over town
TAXI DRIVERS do it all over town.
TAXIDERMISTS mount anything
TAXIDERMISTS will mount anything.
TAXULA: Algore, I need more blood! Let's go to Congress!
TB or not TB, that is the infection.
TBFTG: Two Burgers and Fries To Go
TBPH; To be perfectly honest.
TBSL Turning Blue Stifling Laughter
TBakerDos 4.0: (A)bort, (R)etry, (J)elly Baby?
TBakerDos 4.0: (A)bort (R)etry (J)elly Baby?
TC: Transmit Colors
TCB Taking care of business
TCBY Taking care of business, Ya'll
TCCIC Take Care Cuz I Care
TCI: The Borg of the telecommunications industry.
TCP: Terminate Control Program
TCS The Cartoon Series/The Comics Series
TDB a strong opinion and a weak one, is strength of charactor.
TDB: Transfer and Drop Bits
TDM Too D*mn Many
TDRB: Test and Destroy Random Bits
TDS: Trash Data Segment
TEACHERS do it 50 times after class
TEACHERS do it 50 times after class.
TEACHERS do it in front of everyone.
TEACHERS do it repeatedly
TEACHERS do it with class
TEACHERS make _you_ do it till you get it right
TEACHERS make _you_ do it till you get it right.
TEAEARLGREY.HOT *not* found. NCC-1701.D execution failure
TEAMWORK is the ability to work together toward a common vision.
TEASING---The trait boys have an extra gene for.
TEC: }(;-) <- The Evil Crown
TECH SUPPORT: Demo of manufacturer's local FM station.
TECHNICALITY: A liberal's view of the 2nd Amendment..
TECHNICALITY: Someone *ELSE'S* Constitutional rights..
TECHNICALITY: Someone *ELSES* Constitutional rights..
TECHNICALITY: Someone *ELSE'S* Constitutional rights.
TECHNICIANS do it with frequency
TECHNICIANS do it with greater frequency
TECHNICIANS do it with high voltage probes
TECHNICIANS do it with high voltage probes.
TECHNICIANS do it with mechanical assistance
TECHNICIANS test it first.
TECHNICOLOR: YAWN...the ONLY movie Ted Turner left alone!
TECO: The Tyrannosaurus Rex of editors.
TEDDY BEARS do it at picknicks.
TEDDY BEARS do it with small children
TEDDY ROOSEVELT did it softly, but with a big stick
TEDDY ROOSEVELT did it softly, but with a big stick.
TEENAGE MUTANT NINJA TURTLES do it in the sewer.
TEENAGERS.... Gods punishment for enjoying sex.
TEENAGERS: People so smart only other teenagers understand them.
TEENAGERS: Those who tell adults the benefit of their inexperience.
TELEMARKETERS never stop doing it.
TELEPHONE CO EMPLOYEES let their fingers do the walking
TELEPHONE CO EMPLOYEES let their fingers do the walking.
TELEPHONE CO. EMPLOYEES let their fingers do the walking.
TELESCOPE, SCHMIDT-CASSEGRAIN: An elaborate dew-collecting device.
TELLERS can handle all deposits and withdrawals
TELLERS can handle all deposits and withdrawals.
TELLERS can handle all deposits and withdrawals.
TENCTONESE SPOKEN HERE!
TENNIS PLAYERS (or jugglers) do it with colored balls.
TENNIS PLAYERS cannot play with balls all day long
TENNIS PLAYERS cannot play with balls all day long {n}
TENNIS PLAYERS cannot play with balls all day long.
TENNIS PLAYERS do it in sets
TENNIS PLAYERS do it in sets.
TENNIS PLAYERS do it in their shorts
TENNIS PLAYERS do it with balls.
TENNIS PLAYERS have fuzzy balls
TENNIS PLAYERS have fuzzy balls.
TENNIS PLAYERS have fuzzy balls.
TENTACLES(n): Linebacker's dream every game.
TERMINAL INTELLIGENCE - To be so smart it kills you!
TERMINAL PAYMENT: Golden handshake
TERMinator III...the term program that kicks ASCII.
TEST MAKERS do it sometimes/always/never
TEST MAKERS do it sometimes/always/never.
TESTATORS do it willingly
TESTERS do it over and over.
TESTICLES..The 8 arms of an octopus
TESTICLES: Book of the Bible.
TESTING...ABCDEFGHIJKLMNOPQRSTUVWXYZ...1234567890...
TET: Triple Execution Time [SUN]
TEXANS do it with oil
TEXANS do it with oil.
TEXAS Driving Rule #10: Before changing lanes, pull out your 9 mm ....
TEXAS Driving Rule #239: To Change lanes, first pull out your 9mm..
TEXAS VIRUS: Makes sure that it's bigger than any other file.
TEXAS VIRUS: Makes sure it's bigger than any other file on your system
TEXAS VIRUS: Makes sure that it's bigger than any other
TEXAS: If you don't like our weather, wait 5 minutes!
TEX_FLA/TREK_STORY/TREKTECH/STDSN Echosia: The Next Generation!
TFC - Texas Fried Christian
TFF The Final Frontier
TFG Task Force Games (company that puts out SFB)
TFS The Film Series
TFTHAOT Thanx for the help ahead of time...used for a favor
TFTHAOT -Thanx For The Help Ahead Of Time..
TFTHAOT, BTW 8-)
TFTHAOT; Thanks For The Help Ahead Of Time.
TFW is turning me into a Windows GEEK!
TFW...It ain't done 'til GENERAL.SLT runs !
TGIF Thank God It's Friday
TGIF...Toes Go In First.
TGLNE.ZIP Use PKUNZIP to view.
TH Kai Wars: Opaka Strikes Back...
THANK (insert Deity here--Atheists leave blank)!
THANK YOU FOR NOT SMOKING! Hahahaha! -- Opus
THANK YOU for the opportunity to enhance my TWIT list.
THANKS FOR CARRYING THE "FL SINGLES & FRIENDS" ECHO!!!!!
THANKS FOR CARRYING THE "FL SINGLES" ECHO!!!!!!!
THANXDAD: well, what can I say?
THAT DOES IT!!! I say we toast this toad. - DarkWing Duck
THAT'S an odd taste - Dr. F after reviving Resusci Annie
THE 1996 NBA CHAMPIONS: THE CHICAGO BULLS
THE 2ND AMENDMENT -- GUARANTOR OF THE OTHER NINE
THE A-BOMB DIDN'T WIN WORLD WAR II----SPAM DID
THE AIR FORCE does it ...after coffee.
THE AIR FORCE does it and aims high
THE AIR FORCE does it and aims high.
THE AIR FORCE does it... ...after coffee.
THE AIR FORCE, aims high, shoots low
THE AIR FORCE, aims high, shoots low.
THE AIRBORNE 'chute their loads.
THE AIRBORNE does it from above.
THE ANSWER'S NO! Now what's the question?
THE APRIL 15th PRINCIPLE: A fool and your money are soon partners.
THE APRIL 15th PRINCIPLE: A fool and your money are soon partying.
THE ARMY does it 24 hours a day, 365 days a year...
THE ARMY does it being all that they can be
THE ARMY does it being all that they can be.
THE ARMY does it with brute force.
THE ARTILLERY does it with 155mm guns.
THE ARTILLERY shoots bigger loads.
THE BABY...an instrument of destruction
THE BABY...an instrument of destruction.
THE BLACK NUN: All black, none of the white bits - Crow
THE BLIND do it with feeling.
THE BORG: Calm, Cool and Collective...
THE BOSS IS COMING! QUICK, PRESS ESC!
THE BOY SCOUTS: Like the army with adult supervision.
THE BUTTER CATS - Tom's super heroes
THE CAVALRY does it with charge.
THE CHAIR! THE CHAIR! THE CHAIR! GIVE'EM THE CHAIR! --Beavis.
THE CHURCH POLICE!
THE CLAM - Joel's super hero
THE CORPS IS YOUR FRIEND -- TRUST THE CORPS <B5>
THE DEAF do it with a sign.
THE DISABLED -- The best minority around!
THE DISABLED === The only minority you can join
THE DONNER PARTY - Eat, drink and be merry!
THE EASIEST computers to use are those YOU don't have to use.
THE ENERGIZER BUNNY - Gone
THE ENERGIZER BUNNY does it and keeps going and going, and going, and going
THE FBI does it under cover
THE FBI does it under cover.
THE FIRST BBS : A big tin with 50 strings radiating from it....
THE ForcAst For toNIGht: DARK
THE GANGSTERS by Robin Steele.
THE GIRL WHO SMELLS LIKE SODA CRACKERS -Crow's super hero
THE GOLDEN RULE OF ARTS AND SCIENCES: The one who has the gold makes the rules.
THE GOLDEN RULE: He who has the gold makes the rules
THE HELL AM I! C:\PROGRAM, C:\PROGRAM\RUN, C:\PROGRAM\BOMB,
THE HUMAN DOG - Tom's super hero
THE INFANTRY does it cam'ed.
THE INFANTRY does it on the attack.
THE INTERNET IS FULL! GO AWAY!
THE LARGE PRINT GIVETH, the small print taketh away.
THE LEAST EXPERIENCED FISHERMAN ALWAYS CATCHES THE BIGGEST FISH
THE LOST PARATROOPER - RIPcord
THE MEEK SHALL INHERIT THE EARTH! Aaa..er..if it's okay with you...
THE NAVY does it in waves.
THE NET, winner of the 1995 Szarka Award for Ignorance in Hollywood
THE NEW WORLD ORDER - The last step for Mankind!
THE ONLY WAY YOU CAN PROTECT YOUR RIGHTS IS TO PROTECT THOSE OF OTHERS!
THE PHEASANT PLUCKER - Tom's super hero
THE PHEASANT PLUCKER'S SON - Tom's super hero
THE PM THEME SONG: We wreck your work, We wreck your life, ...
THE PS/2! IT'S! hummm, uhhhh IBM COMPATIBLE!
THE RAPTURE!....THE ULTIMATE UPLOAD!!!
THE RAZOR'S EDGE - Just another BBS success story !
THE REEDER"S D1GE5T HAS PAGES 4 PE0PEL LIKE U!!
THE REV. WILLIAM A. SPOONER - I Pray the Lord my Toll to Sake
THE ROBOT (Hurrrray!) VS THE AZTEC MUMMY (Boooooooo!)
THE SALMON MOUSSE!!!
THE SECOND AMENDMENT is my gun permit!
THE SHADOW: Defender of downtrodden co-moderators!
THE SPIRITUAL LIFE: NED ITATION(l)
THE TIN CAN COOKBOOK by Billie Gote.
THE fIRST sTEP iS tO tAKE oFF tHE cAPS lOCK.
THEATER MAJORS do it with an audience
THEATER MAJORS do it with an audience.
THEATER TECHIES do it in the dark, on cue
THEBRAIN.EXE loaded...Will try to take over world tonight.
THEBRAIN.EXE loaded: Computer will try to take over world tonight.
THEDRAW: A form of color Etch-A-Sketch.
THEFT AMONG ARTHROPODS: THE LIEUTENANTS(l)
THEFT RESISTANT TAGLINE** (didn't work...I stole it!)
THEFTXRESISTANTXTaglineXSTEALXTHISXIFXYOUXCAN
THEFTXRESISTANTXrecipeXsnagXTHISXIFXYOUXCAN
THEORETICAL ASTRONOMERS only *think* about it
THEORETICAL ASTRONOMERS only *think* about it.
THEORETICIANS do it conceptually
THEORETICIANS do it conceptually.
THEORETICIANS do it with a proof
THEORETICIANS do it with a proof {o}
THERE ARE FOUR. LIGHTS!!!!!! -- Picard
THERE ARE NO RULES IN CALVINBALL!
THERE ARE NO SUCH THINGS AS ORBITAL MIND CONTROL LASERS.
THERE CAN ONLY BE ONE! <Swish, thud> It ain't you pal!
THERE IS ALWAYS ONE WITNESS TO EVERY MURDER
THERE IS MADNESS ALL ABOUT!!! Shall we fight? or join in?\
THERE IS NO JUSTICE, THERE IS ONLY ME.
THERE you are Eric. NO, WES, NO! ZZZAAAPP
THERE! I've run rings around you logically.
THERE!! ARE!! FOUR!!! LIGHTS!!!! - Picard
THERE'S NO GNU Like a new gnu.
THERE'S NO GOVERNMENT LIKE NO GOVERNMENT!
THERE'S NO SUCH THING AS WALRUS WAFERS! Well, there should be!
THERE... ARE... FOUR.... LIGHTS!!!!!! -- Picard
THESAURUS -ancient reptile with a great vocabula
THESAURUS: A verbose member of the dinosaur family.
THESAURUS: a dinosaur with a good vocabulary.
THEY ARE HERE!!! AND THEY'RE...WEARING MY PANTS!!!!
THEY CAN ALWAYS HURT YOU MORE
THEY told me you were paranoid but I didn't believe THEM until Now!
THIEF! THIEF! THIEF! BAGGINS! WE HATES IT...FOR EVER! - Gollum
THIEVES do it in leather
THIEVES do it in leather.
THIEVES do it when you're not looking
THIEVES do it with tools
THIEVES do it with tools.
THINGS TO DO TODAY: Breathe in, breathe out, breathe in, breathe out.
THINK ABOUT ITWINDOWS 3.1 FROM THE EDLIN PEOPLE!!!
THINK! Your brain's only evolutionary advantage over sponge cake!
THINK! or THWIM!
THINKING HURTS, it may lead to unpleasant truths!
THIS BOOK IS SO PROFOUND it bores me to death.
THIS IS 911...To report fire press 1,burglary press 2,rape press 3,
THIS IS A 100% MATTER PRODUCT.
THIS IS A TEST OF THE USELESS TAGLINE SYSTEM. THIS IS ONLY A TEST...
THIS IS AN ENTIRELY NEW KIND OF CHAIN LETTER!!!-Fertilizer Society
THIS IS AN EX-PARROT!!!
THIS IS CETI ALPHA FIVE!! -- Khan
THIS IS MY WORLD, AND WELCOME TO IT.
THIS IS WHAT WAS FOUND IN MY MASTER TAG FILE:
THIS LOOKS LIKE A JOB FOR, somebody else.
THIS MESSAGE (c) 1995 BY JIM WELLER. QUOTE AT YOUR OWN RISK!
THIS PARKING SPACE IS FOR HANDICAPPED ONLY--unless you are blind.
THIS SOFTWARE HAS BEEN ILLEGALLY COPIED - NOTIFY THE POLICE
THIS TAGLINE INTENTIONALLY BLANK
THIS TAGLINE IS OFF TOPIC! (yeah...as if the rest of the reply wasn't)
THIS TAGLINE NOT TO BE READ OUT LOUD.
THIS TAGLINE NOT TO BE REMOVED UNDER PENALTY OF LAW.
THIS definitely takes, eats and shits the cake.
THIS is a close-up?!? A CLOSE-UP, YA JERK! A CLOSE-UP!!!
THIS is my theory <ahem>, that is to say, the theory that is MINE.
THIS is not a clear & present danger? I must read the rule book again
THIS is not a clear & present danger? I must read the rule book again.
THIS one goes there THAT one goes there
THIS ought to catch the moderator's attention...
THIS recipe NOT TO BE READ OUT LOUD.
THIS time for sure!
THIS would never happen nowadays! - Crow
THOMAS EDISON - Here lies a light sleeper.
THOMAS EDISON - Who turned out the lights?
THOUGHT FOR TODAY: Try not to think about it!
THREE CLASSES OF PEOPLE: The Haves, The Have-Nots, and the Charge-Its.
THREE GERMAN SOLDIERS CROSSED THE LINE! TABOO! TABOO!
THREESOME..Short for "Thirty-something"
THRONE(v):regal verb,as in "your crown was throne away"
THUGS EAT THEN ROB PROPRIETOR
THX 1138 is charged with Criminal Drug Evasion.
THYME'S LAW - Everything goes wrong at once.
THe eVil bUnnY liT all tHe othEr aNimaLs oN fiRe.
THere's a bee the size of a moose over there! - Crow
THws taKlyne wos typwd un a mIkraSOfd Nadural KyebOrad~
THws taKlyne wos typwd un a mIkraSOfd Nadurtal KyebOrad~
TIA Thanks In Advance
TIA-Thanks In Advance
TIC Tongue in cheek
TICKET AGENCY: Another name for SCALPER SCUM!
TICKETS ! TICKETS ! See Sleepwalker climb steps ! TICKETS ! TICKETS !
TIDMADT : These Initials Don't Mean A Damn Thing
TIGER IN THE BATHROOM by Claude Bawls
TIGER'S REVENGE by Claude Balls
TIH5 HO: OH SHIT (when viewed from a rear view mirror).
TILT! All data lost!...TILT! All data lost!
TIM BBS Your Window into Japan!
TIMBERSHEIK: A guy who kisses his girl between the limbs.
TIME STANDS STILL, Film at 11...or whenever...
TIME TO EAT! by Dean R. Bell.
TIME TO PLAY!
TIME TRAXX -- Bringing you tomorrow's technology TODAY!
TIME's 1994 Moron of the Year.
TIME: Natures way of preventing that everything happens simultanously
TIMEOUT; NO CARRIER
TIN CAN: on a Toyota.
TINALO This is not a legal opinion
TINAR This is not a recommendation
TINY TIM - Please Do Not Step on the Tulips
TINY TIM - Tiptoe Through the Tulips, on Me.
TIO: Take It Over
TIP - Empty Tic-Tac packs are great for small parts!
TITO IST TOT!
TITO-PARTIJA! TITO-PARTIJA!!! (scena iz fliperane)
TITS: Too Inviting To Stop
TJ's Druid Circle cookies are to die(t) for.
TJ's Druid Circle cookies are to die(t) for...
TLA: [T]hree [L]etter [A]cronym; why pilots can't spell.
TLC is a wonderful gift.
TLF is home to a LOT of strange things, isn't it???
TLNF: Teach me a Lesson i'll Never Forget
TLO: Turn indicator Lights Off
TLW: Transfer and Lose Way
TLX of Borg - "Your tagline will be assimilated."
TLX steals Taglines.. not me!
TLX v3.40 steals taglines..... not me!
TLX v4.2 sometimes I lie.
TLX: An essential component for the *joy* of Modeming!!
TMNM, Teenage Mutant Ninja Moderator; The (ab)user's worst nightmare.
TMP The Motion Picture
TN: Take a Nap
TNG The Next Generation
TNG contradicts TOS (if you're sober enough to tell) - drink!
TNG* Computer: Run TROI in I AM DEATH INCARNATE mode. --Barclay.
TNG* Computer: Run TROI-3D in I AM DEATH INCARNATE mode. --Barclay.
TNG* Sensors identify the device as a "Thigh Master", Captain.
TO BE CONTINUED IN OUR NEXT THRILLING INSTALLMENT!!!!!
TO BE CONTINUED IN OUR NEXT THRILLING TAGLINE!!!!!
TO BE CONTINUED IN OUR NEXT THRILLING recipe!!!!!
TO BOWLING ALLEY: " DO you have 12 pound balls?...."
TO BUTCHER: "Do you have pig's feet? Where the h**l do you get shoes!"
TO BUTCHER: Do you have pig's feet? Where the hell do you get shoes?
TO EXIT PROGRAM, TURN OFF COMPUTER. - Sharedata
TO GET AWAY FROM HAIRY APES, LADIES JUMP FROM FIRE ESCAPES.
TO: John Hinkley. "Bill Clinton is dating Jody Foster" -- Reagan
TO: John Hinkley. Bill Clinton is dating Jody Foster --R. Reagan
TOAC: Turn Off Air Conditioner
TOASTER.COM - Insert bread in drive A: Press any key.
TOBAL There Oughta Be A Law
TOBG This Oughta Be Good
TODAY'S THE DAY BEFORE THE DAY! HAVE YOU GOT ALL PRESENTS YET?
TOE : A parent's sensor for finding childrens' toys in dark rooms.
TOE: A device for finding furniture in the dark!
TOFLY: on a late model Olds 442.
TOG: Take Out Garbage
TOG: Time Out, Graduate
TOGETH Musicians do it with feeling.
TOH: Take Operator Hostage
TOM 1.1 - Tagline-O-Matic (c) 1993 Mike Zier
TOM Cat virus found.....Mouse.com deleted !!!
TOM SERVO! ART CROW! SHEILA MCGYPSY! - Joel
TOM: HEY! It's a 21 TERD salute!
TOMB, n. The House of Indifference.
TOMCAT WARNING - Liberties Taken With Quotes!
TONIC.H20 found. BOTTLE.GIN found. SysOp found...LOADED!
TONIGHT at 20:00 hours, Happy Hour at Quarks!
TONYA HARDING does it with a baton.
TOO +++uC++ $ex A((ecT$ YOUr eye$ig++T ...
TOO MUCH CPU-POWER DETECTED! RUN WINDOWS TO SLOW DOWN!
TOO: Turn On/off Operator
TOP SECRET MESSAGE! BURN BEFORE READING!
TOP SECRET This message will self destruct in 5 seconds!!!
TOP: Trap OPerator
TOPOLOGISTS do in on rubber sheets.
TOR between two lovers - Tom sings about Tor Johnson
TORY: Those Other Reform Yuks!
TOS The Original Series
TOS + 6 Movies + TNG = 8, so DS9 is #9.
TOS = Red Shirt; TNG = Ensign; DSN = Runabout; VOY = Harry Kim
TOS, TAS, TMP, TWOK, TSFS, TVH, TFF, TUC, TNG, DS9 ??
TOS,TAS,TMP,TWOK,TSFS,TNG,TVH,TFF,TUC,DSN,???,VOY
TOS,TAS,TMP,TWOK,TSFS,TVH,TNG,TFF,????
TOS: Trash Operating System
TOUCAN SAM SNUFFS IT! - Cereal Killing Spree Continues!
TOUGH LOVE(n): choke chains
TOURIST SEASON! DOES that mean we can shoot them?
TOURIST(n):what you call a pretty girl in Vancouver.
TOW: Take Over World
TOWEL -- Don't leave home without it!
TOYOTA: By the same great guys who attacked Pearl Harbor!
TP> "Do you recall what P.T. Barnum said about suckers?" -- Scully
TPD: Terminal Printer Destruct
TPD: Total Program Diagnostic
TPD: Triple Pack Decimal
TPDH: Tell Programmer to Do it Himself
TPF: Turn Power oFf
TPN: Turn Power oN
TPO: Turn Power Off
TPR: Tear PapeR
TPS * Yes, my son, a 10 meg hard drive was once really big ....
TPTB The Powers That Be
TPTB - The sound the roadrunner makes with his tongue
TPTB: The Powers That Be
TR: Turn into Rubbish
TRA: Te Rdls Arvs [type ridiculous abbreviations]
TRACKBALL: A heavier, harder type of tetherball.
TRACKS IN THE SAND by PETER DRAGGIN.
TRADEWARS 2002: Some people's only reason to own a modem or to live.
TRAFFIC DEAD RISE SLOWLY
TRAINEES do it as practice
TRAINEES do it as practice.
TRAITOR (n.): A person winning an argument with a Liberal.
TRAITOR (n.): A person winning an argument with a liberal.
TRAMPOLINE ACROBATS do it in the air
TRAMPOLINE ACROBATS do it in the air.
TRAMPOLINE ACROBATS do it over a net
TRAMPOLINE ACROBATS do it swinging from bars
TRAMPOLINE ACROBATS do it swinging from bars.
TRAMPOLINE ACROBATS do it under the big top
TRANSECT(n): when a Baptist marries a Methodist
TRANSISTOR: A nun after a sex change.
TRANSPORT supports it.
TRANSSEXUALS do it right eventually.
TRANSVESTITE: A man who wants to eat, drink and be Mary.
TRANSVESTITE: Someone who wants to eat, drink and be Mary
TRANSVESTITES do it dressed.
TRAPEZOID - A device for catching zoids.
TRAPEZOID: A device for catching zoids.
TRAPPED IN CHAT BY THE KITTYCAT FROM HELL!! Story at 11!...
TRD: TRansfer and Drop bit
TRDMC Tears Running Down My Cheeks
TREE MEN do it in more crotches than anyone else
TREE MEN do it in more crotches than anyone else.
TREE: Something shaken to see what files will fall out
TREK is a crossdresser. TREK is a crossdresser. TREK is a crossdresser.
TREKIE %JH3 TAGFILES
TREKKERS do it with warp drive!
TREWLY Narly peepul are cunsistantly wierd and HORABLE spelers!
TRE_MEN_DOUS COS_MIC PO_WER itty bitty tagline.
TRIBBLE movie: Friday the 1,238,890,166,001,523,939th
TRIBBLE, cuddly ball of lint
TRIBBLE.DAT = * TRIBBLE.ZIP = / TRIBBLE.ARJ = .
TRIBBLE.DAT = * TRIBBLE.ZIP = / TRIBBLE.ARJ = .
TRIBBLE: cuddly ball of lint
TRIBBLE: TOS creature, small fuzzy, hates Klingons.
TRIBBLES: TOS creature, small fuzzy, hates Klingons.
TRIBBLES??... OH NO!!! I thought they were new toilet brushheads!!
TRIBBlE math is sexpoential.
TRIBIOLOGICAL ENGINEERS do it by using lubricants
TRIBIOLOGICAL ENGINEERS do it by using lubricants.
TRICHINOSIS(n):pig's reply to proponents of porcophagy.
TRICHINOSIS, n. The pig's reply to proponents of porcophagy.
TRICK QUESTION: What a man asks a street walker.
TRINITY: An odd way to promote unity.
TRIVIA: IN "COURT MARTIAL" WHO WAS THE "PROSECUTER"?
TRIVIA: IN "ST II" KHAN WAS FOND OF QUOTING FROM...
TRIVIA: In "Measure Of A Man", _____ is the prosecutor against Data?
TRIVIA: In which episode is Picard seen as a god ?
TRIVIA: Joan Collins portrayed this character.
TRIVIA: MAXIMUM GROSS WEIGHT OF THE ENTERPRISE IS? (TONS)
TRIVIA: WHAT WAS THE MAXIMUM SAFE CRUISING SPEED ...WARP?
TRIVIA: What alias did Harry Mudd use?
TRIVIA: What does O'Briens's wife do on DS9?
TRIVIA: What is Major Kira's proper Bajorian Name?
TRIVIA: What type of brain does Data have?
TRIVIA: Who introduced Jack and Beverly Crusher?
TROI senses it first. STAR TREK: THE NEXT GENERATION.
TROI: I feel pain, GREAT pain! RIKER: Glad you liked it!
TROI: I feel pain, GREAT pain! ... RIKER: Glad you liked it!
TROI: I feel pain, GREAT pain! RIKER: Glad you liked
TROMBONE PLAYERS are constantly sliding it in and out
TROMBONE PLAYERS are constantly sliding it in and out.
TROMBONE PLAYERS do it faster
TROMBONE PLAYERS do it faster.
TROMBONE PLAYERS do it in 7 positions
TROMBONE PLAYERS do it with slide action finger control
TROMBONE PLAYERS do it with slide action finger control.
TROMBONE PLAYERS do it with slide oil
TROMBONE PLAYERS do it with their "F" attachment.
TROMBONE PLAYERS have something that's always long and hard
TROMBONE PLAYERS have something that's always long and hard.
TROMBONE PLAYERS slide it in and out
TROMBONE PLAYERS slide it in and out.
TROMBONE PLAYERS use more positions
TROMBONE PLAYERS use more positions.
TRQ: To Read Queue. Also VTRQ "Virtual To Read Queue".
TRS-80 * The Best 8-bit Computer Ever Built!
TRUCE, n. Friendship.
TRUCK DRIVERS carry bigger loads
TRUCK DRIVERS carry bigger loads.
TRUCK DRIVERS do it on the road
TRUCK DRIVERS do it on the road.
TRUCK DRIVERS have bigger dipsticks
TRUCK DRIVERS have bigger dipsticks.
TRUCK DRIVERS have bigger dipsticks.
TRUCK and TESTICLE - Now there's a men's magazine!
TRUCKERS carry bigger loads
TRUCKERS carry bigger loads.
TRUCKERS have bigger loads.
TRUCKERS have bigger loads.
TRUCKERS have moving experiences
TRUCKERS have moving experiences.
TRUE CE alignments put Heads of Force in kids' marble bags.
TRUE multitasking-playing Doom while cooking breakfast on the Pentium.
TRUE multitasking-reading mail while cooking breakfast on the Pentium.
TRUE! Heavy metal group MEGADEATH just won the Doris Day award!
TRUMP does it with cash
TRUMP does it with cash.
TRUMPET PLAYERS blow hard.
TRUMPET PLAYERS blow the best
TRUMPET PLAYERS can't do it!
TRUMPETERS blow hard
TRUST ME!--I work for the government!
TRUST NO ONE. --Deep Throat. Trust me. -zf- Doh! --Homer Simpson.
TRUST me, @FN@. Would *I* lie to you?
TRUST me, YOU. Would *I* lie to you?
TRUTH, n. An ingenious compound of desirability and appearance.
TRUTH.VER cross-linked w/CLINTON.LIE: LIMBAUGH.EXE to fix
TRUTH.VER cross-linked w/CLINTON.LIE: LIMBAUGH.EXE to fix.
TRUTH: Backup files are never complete.
TRUTH: Stranger than fiction, but not as popular.
TRUTH: Things go right just so they can go wrong.
TRUTHFUL, adj. Dumb and illiterate.
TSE (The SemWare Editor) -- So FAST, it leaves RUBBER on your desk!
TSE, the do it your way editor.
TSFTIORCA: The Society For The Invention Of Really Complicated Acronyms
TSH: Trap Secretary and Halt
TSM: Trap Secretary and Mount
TSR = (T)rashes (S)ystem (R)andomly
TSR = Terminate, Stall, Reboot!
TSR's last book: Player's Guide to kill bad DMs!
TSR's!!!!! Bah! Humbug!
TSR: Trashes System Randomly.
TSR: Terminate and Scramble Ram
TSR: Terminate, Stall, Reboot!
TSR: Trash System Randomly
TSR: Trashes System Randomly
TSR= [T]rashes [S]ystem [R]andomly
TSRS are the instruments of Cthulhu.
TSRs are the instruments of Cthulhu.
TST: Trash System Tracks
TSUNAMI: (n) A REAL big Blue Wave.
TSZ: Thus Spake Zarathustra
TT%CN: TeleType \(em Clunk Noise
TT%EKB: TeleType \(em Electrify KeyBoard
TT> I am looking for Tags related to money or paying bills......any
TT> suggestions ??
TTA - Tagline Thieves of America (member since 1990)
TTA: Try, Try Again
TTBOMK To The Best Of My Knowledge
TTFN Ta Ta For Now
TTFN: Thank Thor Friday Nears!
TTFN; Ta Ta For Now
TTIHLIC: Try To Imagine How Little I Care
TTITT: Turn 2400 foot Tape Into Two 1200 foot Tapes
TTL4N That's The Lot For Now
TTL: Tap Trunk Line
TTL: Time To Logoff
TTMFITT method: (T)hrow (T)he (M)(F) (I)n (T)he (T)rash
TTMS Talk (TYPE) To Me Soon
TTTT; To tell the truth.
TTTTTTTTTTT: My T key is stuck.
TTUL Talk To You Later
TTYL Talk To You Later
TTYL Talk (or Type) To You Later
TTYL, Will in Sunny Tucson, Arizona
TTYL-Talk (or Type) To You Later
TTYL.... FIRST
TTYL: Talk To Your Lover.
TTYL: Tender-Tush, Your Lover.
TTYL; Talk to you later.
TTYRS Talk To You Real Soon?
TThheerree''ss aann EEcchhoo iinn hheerree.
TThis Tagline iz sslighhtly ouut of focus.
TThis recipe iz sslighhtly ouut of focus.
TThis taglin iz sslighhtly ouut of cofus.
TUBA PLAYERS do it deeper.
TUBA PLAYERS do it with big horns
TUBA PLAYERS have the biggest instruments.
TUBA PLAYERS usually do it on one and three.
TUBAS do it deeper
TUC The Undiscovered Country
TUMOR: An extra pair.
TUMOR: Number of beers yew can drink after last call.
TUPHLEM GRDLPHUMP.. to quote Opus' first words.
TUPHLEM GRDLPHUMP.. to quote Opuss first words....
TUPHLEM GRDLPHUMPto quote Opus's first words...
TURING == Totally Useless, Really Ignorant, No Good
TURKISH MINERALS: ASA MINER(l)
TURN OFF YOUR CAT & SPEAK DIRECTLY INTO YOUR POWER SAW
TURN OFF YOUR CAT AND SPEAK DIRECTLY INTO YOUR POWER SAW
TURN OUT THOSE LIGHTS!!! - Dot
TV "Truth" - If a woman is running, she will trip and fall.
TV - Radio without the imagination.
TV - we call it a medium because nothing's well done.
TV Agent -- customization, details, timeliness -- 130+ TVRO channels
TV BATMAN - West in Peace
TV DINNER: Food that tastes like it was prepared by the TV repairman.
TV EVANGALISTS do more than lay people
TV EVANGELISTS do more than lay people.
TV FREE MARS - PPG and Terrorist Appreciation Kit sold separately.
TV High School students look thirty years old.
TV How am I DOOM ][-ing? Dial 1-900-BFG-9000.
TV How do you spell excellent 3D action game? D-O-O-M
TV I blame DOOM ][ for these rings under my eyes...
TV I have seen the future of gaming and its name is DOOM ][.
TV I used to have a life. Now I have DOOM ][.
TV I'd rather be playing DOOM ][!
TV In 1994, I was sure that the world was DOOM-ed.
TV Is DOOM ][ better than Sex? On the next Geraldo...
TV MegaArmor/SuperCharge/BFG9000 * What more could a person ask for?
TV Mercenaries Wanted * Apply at: Union Aerospace Corporation, Phobos
TV No Sir, I didn't get it done. I was in DEATHMATCH mode..
TV Play DOOM ][ by Modem? E-mail me and let's rock n' roll!
TV Problem with DOOM ][? End of the line is WAAAY back there.
TV REPAIRMEN do it in SYNC
TV REPAIRMEN do it in SYNC.
TV REPAIRMEN do it with a vertical hold
TV REPAIRMEN do it with their tubes.
TV Radio without the imagination.
TV Remember: if at first you don't succeed, IDCLEVem!
TV Remember: if at first you don't succeed, IDDQD!
TV Remember: if at first you don't succeed, IDDT!
TV Remember: if at first you don't succeed, IDKFA!
TV Space aliens are always immune to bullets.
TV TRUTH: Kid's rooms are always spotless.
TV TRUTH: "Real men" can punch a hole in a car window.
TV TRUTH: Kid's rooms are always spotless.
TV TRUTH: Nobody ever needs to use the bathroom.
TV TRUTH: People sit only on one side of the dinner table.
TV TRUTH: The murderer always hides in the back seat.
TV Too much DOOM ][: You fire a Rocket into Dark rooms.
TV Too much DOOM ][: You've started to side step into rooms.
TV Too much DOOM ][: Your clock seems to be fast.
TV Too much DOOM ][: Your coffee has frozen.
TV Too much DOOM ][: Your fingers start to shake.
TV Truth # 1: "Real Men" can punch a hole in a car window.
TV Truth # 2: A 9mm pistol is a more powerful weapon than an AK-47.
TV Truth # 3: Aliens are always immune to bullets.
TV Truth # 4: All alien races look like deformed humans.
TV Truth # 5: All Asians know karate.
TV Truth # 6: All Brits are classy and all Frenchmen are jerks.
TV Truth # 7: All cars will explode when wrecked.
TV Truth # 8: All problems can be solved in 30-60 minutes.
TV Truth # 9: Anyone can jump through a plate glass window.
TV Truth #01: "Real Men" can punch a hole in a car window.
TV Truth #02: A 9mm pistol is a more powerful weapon than an AK-47.
TV Truth #03: Aliens are always immune to bullets.
TV Truth #04: All alien races look like deformed humans.
TV Truth #05: All Asians know karate.
TV Truth #06: All Brits are classy and all Frenchmen are jerks.
TV Truth #07: All cars will explode when wrecked.
TV Truth #08: All problems can be solved in 30-60 minutes.
TV Truth #09: Anyone can jump through a plate glass window.
TV Truth #1 - If ya can't dooda time, don't dooda crime - Tony Beretta
TV Truth #1 -"If ya can't dooda time, don't dooda crime" - Tony Berett
TV Truth #105: Car tires squeal on dirt roads.
TV Truth #10: Babies age five times as fast as their parents.
TV Truth #11: Butt, Crap, and Boob are cuss words.
TV Truth #12: Car tires squeal on dirt roads.
TV Truth #13: Cartoon characters don't die.
TV Truth #14: Court cases are all solved with a suprise witness.
TV Truth #15: Crime pays; sell your story to the movie-of-the-week.
TV Truth #16: Drinking beer attracts beautiful females.
TV Truth #17: Explosions in space make noise.
TV Truth #18: Getting shot is a minor annoyance if you're a good guy.
TV Truth #19: Global corporations set up their HQ in small towns.
TV Truth #1: Explosions in space make noise.
TV Truth #2 - Nobody said life was fair - Jimmy Carter
TV Truth #20: Good guys always live forever.
TV Truth #21: Good guys always shoot better than bad guys.
TV Truth #22: Good guys are always good looking.
TV Truth #23: Good guys can get 200 shots out of a six-shooter.
TV Truth #24: Good guys live forever.
TV Truth #25: Happiness is boring.
TV Truth #26: Haunted houses are never locked.
TV Truth #27: High School students look thirty years old.
TV Truth #28: Housewives always wear dresses, heels, and aprons.
TV Truth #29: If a car flips over, it always bursts into flames.
TV Truth #2: All problems can be solved in 30-60 minutes.
TV Truth #3 - "And that's the way it is" - Walter Cronkite
TV Truth #30: If a woman is running, she will trip and fall.
TV Truth #31: If there's a thunderstorm, someone will be murdered.
TV Truth #32: If women have breasts, they're hookers.
TV Truth #33: In a soap, everything happens to the same 20 people.
TV Truth #34: Kids always have something clever and witty to say.
TV Truth #35: Kids' rooms are always spotless.
TV Truth #36: Life is a measure of popularity.
TV Truth #37: Love conquers all obstacles.
TV Truth #38: Martial artists never get killed by bullets.
TV Truth #39: Mothers actually worry about brands of peanut butter.
TV Truth #3: If a woman is running, she will trip and fall.
TV Truth #40: No matter how much trouble you're in, you can get out.
TV Truth #41: No one does housework, but all homes are clean.
TV Truth #42: No one has trouble finding parking spots in a hurry.
TV Truth #43: No soap opera perfect relationship will ever last.
TV Truth #44: Only Archie Bunker and Fred Sanford use the restroom.
TV Truth #45: Only thin beautiful woman ever need to be rescued.
TV Truth #46: People being stalked always retreat upstairs.
TV Truth #47: People have friendly neighbors even in big cities.
TV Truth #48: People sit on only one side of the dinner table.
TV Truth #49: Psychos never kill teens who are virgins.
TV Truth #4: All cars will explode when wrecked.
TV Truth #50: Scary music always precedes tragedy.
TV Truth #51: Small towns always have hospitals and colleges.
TV Truth #52: Teenagers can access any computer using their PC's.
TV Truth #53: The murderer always hides in the backseat.
TV Truth #54: Women always have to be rescued.
TV Truth #55: Women always vacuum the house wearing pearls.
TV Truth #56: Yeast infections are a topic of casual conversation.
TV Truth #57: Bad guys make elaborate inventions to kill the good guys.
TV Truth #58: Explosions in empty space *HAPPEN*.
TV Truth #59: Good guys always win and get the girl.
TV Truth #5: Drinking beer attracts beautiful females.
TV Truth #5: Drinking beer attracts beautiful females.
TV Truth #60: Good guys are always outnumbered.
TV Truth #61: Good guys are the only ones with a sense of humor.
TV Truth #62: Good guys don't take drugs.
TV Truth #63: Good guys live forever, no matter how badly they're hurt.
TV Truth #64: Good guys will only get shot in the arm or leg.
TV Truth #65: If it isn't hand-hammered, it's not the real thing.
TV Truth #66: SF shows all intelligent beings are humanoid.
TV Truth #67: Something violent must happen in the first 15 seconds.
TV Truth #68: Spinning tires on sand always creates a screech.
TV Truth #69: Undercover cops are too good to be spotted.
TV Truth #6: In a soap, everything happens to the same 20 people.
TV Truth #7: Anyone can jump through a plate glass window.
TV Truth #7: Car tires squeal on dirt roads.
TV Truth: "Real Men" can punch a hole in a car window.
TV Truth: A 9mm pistol is a more powerful weapon than an AK-47.
TV Truth: A running woman will trip and fall.
TV Truth: Aliens are always immune to bullets.
TV Truth: All Asian people know some type of Martial Art.
TV Truth: All Asians know karate.
TV Truth: All Britishers are classy, all Frenchmen jerks.
TV Truth: All Brits are classy and all Frenchmen jerks.
TV Truth: All Brits are classy, all Frenchmen jerks.
TV Truth: All alien intelligent beings are humanoid.
TV Truth: All alien races look like deformed humans.
TV Truth: All cars will explode when wrecked.
TV Truth: All husbands are less intelligent than their wives.
TV Truth: All husbands are wife-beaters.
TV Truth: All men are evil.
TV Truth: All problems can be solved in 30-60 minutes.
TV Truth: Anyone can jump through a plate glass window
TV Truth: Babies age five times as fast as their parents
TV Truth: Butt, Crap and Boob are cuss words.
TV Truth: Car tires squeal on dirt roads.
TV Truth: Cartoon characters don't die.
TV Truth: Computers know EVERYTHING, and they NEVER crash.
TV Truth: Court cases are all solved with a suprise witness.
TV Truth: Court cases are all solved with a surprise witness.
TV Truth: Drinking beer attracts beautiful females ...
TV Truth: Every small town has a college and a hospital.
TV Truth: Everyone Wins in Las Vegas.
TV Truth: Everyone knows how to pick a lock with only one tool.
TV Truth: Explosions in empty space *HAPPEN*.
TV Truth: Explosions in space make noise.
TV Truth: Getting shot is a minor annoyance if you're a good guy.
TV Truth: Good guys always shoot better than bad guys.
TV Truth: Good guys are always good looking.
TV Truth: Good guys are always outnumbered.
TV Truth: Good guys live forever, no matter how badly their hurt.
TV Truth: Good guys live forever.
TV Truth: Good guys will only get shot in the arm or leg.
TV Truth: Happiness is boring.
TV Truth: Haunted houses are never locked.
TV Truth: High School students look thirty years old.
TV Truth: Housewives always wear dresses, heels, and aprons.
TV Truth: If a car flips over, it always bursts into flames.
TV Truth: If a woman is running, she will trip and fall.
TV Truth: If being stalked in your house, one should run upstairs.
TV Truth: If it isn't hand-hammered, it's not the real thing.
TV Truth: If women have breasts, they're hookers.
TV Truth: If you are being stalked in your house, run upstairs.
TV Truth: In a soap opera, everything happens to the same 20 people.
TV Truth: In a soap, everything happens to the same 20 people.
TV Truth: International companies set up their HQ in small towns.
TV Truth: International corporations set up their HQ in small towns.
TV Truth: Kids always have something clever and witty to say.
TV Truth: Kids rooms are always spotless.
TV Truth: Life is a measure of popularity.
TV Truth: Love conquers all obstacles.
TV Truth: Martial artists never get killed by bullets.
TV Truth: Massive Overkill saves the day - Darkwood
TV Truth: Mothers actually worry about brands of peanut butter.
TV Truth: Movies BASED on true stores are MADE UP.
TV Truth: Murders will always be accompanied by sinister music.
TV Truth: No matter how much trouble you're in, you can get out.
TV Truth: No one EVER locks a car when they get out of it.
TV Truth: No one does housework, but all homes are clean.
TV Truth: No one has trouble finding parking spots in a hurry.
TV Truth: No soap opera "perfect relationship" will ever last.
TV Truth: Nobody ever needs to use the restroom.
TV Truth: One sentence from a beautiful woman can de-roof a bar.
TV Truth: Only thin beautiful woman ever need to be rescued.
TV Truth: People being stalked always retreat upstairs.
TV Truth: People have friendly neighbors even in big cities.
TV Truth: People on the news blink a lot.
TV Truth: People sit on one side of the dinner table.
TV Truth: People sit on only one side of the dinner table.
TV Truth: Psychos never kill teens who are virgins.
TV Truth: Real Men can punch a hole in a car window.
TV Truth: Rich people are unhappy.
TV Truth: SF shows all intelligent beings are humanoid.
TV Truth: Scary music always precedes tragedy.
TV Truth: Soap Opera small towns always have hospitals and colleges.
TV Truth: Something violent must happen in the first 15 seconds.
TV Truth: Space aliens are always immune to bullets.
TV Truth: Spinning tires on sand always creates a screech.
TV Truth: Spinning tires on sand always screech.
TV Truth: Teenagers can access any computer by using their PC's.
TV Truth: Teenagers can access any computer using their PC's.
TV Truth: Teenagers who have sex are destined to die in a grotesque way
TV Truth: The "Good Guys" are the only ones with a sense of humor.
TV Truth: The group ALWAYS splits up to look for the alien.
TV Truth: The last 5 min. of any show will be 20 min. with commercials.
TV Truth: The murderer always hides in the back seat.
TV Truth: The police are smart.
TV Truth: Ugly people are ALWAYS the bad guys.
TV Truth: Whenever there's a thunderstorm, someone will be murdered.
TV Truth: Women NEVER do housework but the houses are ALWAYS clean.
TV Truth: Women always have to be rescued.
TV Truth: Women always vacuum the house wearing pearls.
TV Truth: Yeast infections are a topic of casual conversation.
TV Truth: You can build a new house yourself.
TV Truth: You can get 200 shots out of a six-shooter.
TV Truth: You only speak to the camera when spoken to first
TV Truth: "Real Men" can punch a hole in a car window.
TV Truth: A 9mm pistol is a more powerful weapon than an AK-47.
TV Truth: A chop to the neck with the.
TV Truth: A running woman will trip and fall.
TV Truth: Aliens are always immune to bullets.
TV Truth: All Asian people know some type of Martial Art.
TV Truth: All Asians know karate.
TV Truth: All Britishers are classy, all Frenchmen jerks.
TV Truth: All Brits are classy and all Frenchmen are jerks.
TV Truth: All Brits are classy and all Frenchmen jerks.
TV Truth: All Brits are classy, all Frenchmen jerks.
TV Truth: All alien intelligent beings are humanoid.
TV Truth: All alien races look like deformed humans.
TV Truth: All cars will explode when wrecked.
TV Truth: All husbands are less intelligent than their wives.
TV Truth: All husbands are wife-beaters.
TV Truth: All men are evil.
TV Truth: All problems can be solved in 30-60 minutes.
TV Truth: Anyone can jump through a plate glass window
TV Truth: Anyone can jump through a plate glass window.
TV Truth: Babies age five times as fast as their parents.
TV Truth: Bad guys will make elaborate inventions to kill the good guys
TV Truth: Butt, Crap, and Boob are cuss words.
TV Truth: Car tires squeal on dirt roads.
TV Truth: Cartoon characters don't die.
TV Truth: Computers know EVERYTHING, and they NEVER crash.
TV Truth: Court cases are all solved with a suprise witness.
TV Truth: Court cases are all solved with a surprise witness.
TV Truth: Crime does pay, just sell your story to the movie-of-the-week.
TV Truth: Crime pays, just sell your story to the movie-of-the-week.
TV Truth: Drinking beer attracts beautiful females.
TV Truth: Every small town has a college and a hospital.
TV Truth: Everyone Wins in Las Vegas.
TV Truth: Everyone knows how to pick a lock with only one tool.
TV Truth: Explosions in empty space *HAPPEN*.
TV Truth: Explosions in space always make noise.
TV Truth: Explosions in space make noise.
TV Truth: Getting shot is a minor annoyance if you're a good guy.
TV Truth: Good guys always shoot better than bad guys.
TV Truth: Good guys always win and get the girl.
TV Truth: Good guys are always good looking.
TV Truth: Good guys are always outnumbered.
TV Truth: Good guys are the only ones with a sense of humor.
TV Truth: Good guys can get 200 shots out of a six-shooter.
TV Truth: Good guys don't take drugs.
TV Truth: Good guys live forever, no matter how badly their hurt.
TV Truth: Good guys live forever.
TV Truth: Good guys will only get shot in the arm or leg.
TV Truth: Happiness is boring.
TV Truth: Haunted houses are never locked.
TV Truth: High School students look thirty years old.
TV Truth: Housewives always wear dresses, heels, and aprons.
TV Truth: If a car flips over, it always bursts into flames.
TV Truth: If a woman is running, she will trip and fall.
TV Truth: If being stalked in your house, one should run upstairs.
TV Truth: If it isn't hand-hammered, it's not the real thing.
TV Truth: If there's a thunderstorm, someone will be murdered.
TV Truth: If women have breasts, they're hookers.
TV Truth: If you are being stalked in your house, run upstairs.
TV Truth: In a soap opera, everything happens to the same 20 people.
TV Truth: In a soap, everything happens to the same 20 people.
TV Truth: International companies set up their HQ in small towns.
TV Truth: International corporations set up their HQ in small towns.
TV Truth: Kids always have something clever and witty to say.
TV Truth: Kids rooms are always spotless.
TV Truth: Kids' rooms are always spotless.
TV Truth: Life is a measure of popularity.
TV Truth: Love conquers all obstacles.
TV Truth: Martial artists never get killed by bullets.
TV Truth: Mothers actually worry about brands of peanut butter.
TV Truth: Movies BASED on true stores are MADE UP.
TV Truth: Murders will always be accompanied by sinister music.
TV Truth: No matter how much trouble you're in, you can get out.
TV Truth: No one EVER locks a car when they get out of it.
TV Truth: No one does housework, but all homes are clean.
TV Truth: No one has trouble finding parking spots in a hurry.
TV Truth: No soap opera perfect relationship will ever last.
TV Truth: Nobody ever needs to use the restroom.
TV Truth: One sentence from a beautiful woman can de-roof a bar.
TV Truth: Only thin beautiful woman ever need to be rescued.
TV Truth: People being stalked always retreat upstairs.
TV Truth: People have friendly neighbors even in big cities.
TV Truth: People on the news blink a lot.
TV Truth: People sit on one side of the dinner table.
TV Truth: People sit on only one side of the dinner table.
TV Truth: Real Men can punch a hole in a car window.
TV Truth: Rich people are unhappy.
TV Truth: SF shows all intelligent beings are humanoid.
TV Truth: Scary music always precedes tragedy.
TV Truth: Soap Opera small towns always have hospitals and colleges.
TV Truth: Something violent must happen in the first 15 seconds.
TV Truth: Space aliens are always immune to bullets.
TV Truth: Spinning tires on sand always creates a screech.
TV Truth: Spinning tires on sand always screech.
TV Truth: Teenagers can access any computer by using their PC's.
TV Truth: Teenagers can access any computer using their PC's.
TV Truth: Teenagers who have sex are destined to die in a grotesque way
TV Truth: The "Good Guys" are the only ones with a sense of humor.
TV Truth: The group ALWAYS splits up to look for the alien.
TV Truth: The last 5 min. of any show will be 20 min. with commercials.
TV Truth: The murderer always hides in the backseat.
TV Truth: The police are smart.
TV Truth: There is a higher intelligence at work to solve your problems.
TV Truth: Ugly people are ALWAYS the bad guys.
TV Truth: Undercover cops are too good to be spotted.
TV Truth: Whenever there's a thunderstorm, someone will be murdered.
TV Truth: Women NEVER do housework but the houses are ALWAYS clean.
TV Truth: Women always have to be rescued.
TV Truth: Women always vacuum the house wearing pearls.
TV Truth: Yeast infections are a popular topic.
TV Truth: Yeast infections are a topic of casual conversation.
TV Truth: You *CAN* get 200 shots out of a six-shooter.
TV Truth: You can build a new house yourself.
TV Truth: You can get 200 shots out of a six-shooter.
TV Truth: You only speak to the camera when spoken to first
TV Try the *latest* in PhobosWear. Open midriff optional!
TV Why sleep when you can DOOM ][!
TV You're an INFORMANT? Nice try, but this is DOOM ][! >BLAM!<
TV addict who grumbles when disturbed: grouch potato.
TV advertising is the rattling inside a swill bucket.
TV be some medium; anythin' well done be rare. Cheeeiit.
TV court cases are all solved with a suprise witness.
TV doesn't make $ence. They are out to make dollar$.
TV is a crutch for people who can't afford drugs.
TV is a crutch for those who can't afford drugs.
TV is a crutch for those who cannot afford drugs.
TV is a crutch for those who lack imagination.
TV is a medium because it is seldom well done.
TV is a medium; anything well done is rare.
TV is called a medium because it is neither rare nor well done.
TV is chewing gum for the eyes.
TV is chewing gum for the eyes. -- Frank Lloyd Wright
TV is chewing gum for the eyes. -- Frank Lloyd Wright
TV is like a steak - a medium rarely well done.
TV is like a steak -- a medium rarely well-done
TV is like steak: a medium rarely well done.
TV made me do it.
TV news anchors do it every night.
TV repairmen do it with a vertical hold.
TV set has gone to the test pattern
TV truth--good guys always live forever.
TV truth: Explosions in space always make noise.
TV truth: Good guys always live forever.
TV"I wouldn't leave if I were you. DOS is much worse." - DOOM ][
TV's Famous Last Words: "Be careful out there."
TV's Famous Last Words: "Book him Dano."
TV's Famous Last Words: "Is anyone down there...?"
TV's Famous Last Words: "Book him Dano."
TV's Famous Last Words: Be careful out there.
TV's Famous Last Words: Book him Dano.
TV's Famous Last Words: Is anyone down there...?
TV's Frank - This one's for you! - Crow
TV's Frank is an agent?! - Crow
TV's biggest problem is killing time between commercials.
TV, a medium rarely well done.
TV, or not TV: That is the question.
TV. Just got a new big screen TV for my boyfriend...GREAT TRADE!
TV: Radio without the imagination.
TV? That's the thing that looks like a computer monitor?
TVA mind is a terrible thing toTVOOOOH, DOOM ][ is here!
TVCASTLE WOLFENSTEIN: Kiddie Trainer for DOOM ][!
TVCastle Wolfenstein 3D - training course for DOOM ][!
TVComing Soon - DOOM ]I[: What The Hell?
TVDOOM ][ - Destroy Opponents Over Modem
TVDOOM ][ - Forget Disney WorldTVI'm going to Hell!
TVDOOM ][ - the ultimate encounter with virtual death!
TVDOOM ][ D We Must get together for a Death matcTV@#$^!:"{..SPLAT!
TVDOOM ][ DEATHMATCH MODE: Reach out and KILL someone!
TVDOOM ][ Tip: Look out! There's a demon behind you!
TVDOOM ][ is NOT an Apogee Game (It's from id)
TVDOOM ][ unto others as they DOOM ][ unto you.
TVDOOM ][: "It's a chain saw. I always carry one for emergencies."
TVDOOM ][: "NIGHTMARE" MODE - Where NOTHING stays dead for long.
TVDOOM ][: 2368 Enemies in 27 Levels * Nothing to Sneeze at!
TVDOOM ][: Ammo! Ammo! I NEED more ammo here now damn it!
TVDOOM ][: Don't trust anything that moves - kill it instead.
TVDOOM ][: He who laughs last probably has the most ammo.
TVDOOM ][: If you hit every time, the target's too near.
TVDOOM ][: If your enemy is in range, so are you.
TVDOOM ][: Killing Alien Monsters was never so much fun.
TVDOOM ][: Map of Hell included. It's good to know where you're going.
TVDOOM ][: May your shotgun never be empty.
TVDOOM ][: Not just a spectators sport.
TVDOOM ][: Not recommended for children of any age.
TVDOOM ][: See you in hell.
TVDOOM ][: When in doubt, Use the BFG-9000!
TVDOOM ][: Where going to HELL is actually fun.
TVDOOM ][: Where the Safest place is behind a Plasma Rifle.
TVDOOM ][: Where the sanest placeTVis behind a trigger.
TVDamn - I picked up more shotgun shells and can't use my CHAIN GUN!
TVF TALENT - TV's Frank, Talent Agent
TVH The Voyage Home
TVO: Type Various Obscenities
TWA The Wrong Airline.
TWA - Teeny Weeny Airline
TWA - Third World Airlines
TWA - Two Wing Airplane
TWEETIE BIRD - I *Knew* I Taw a Puddy Tat
TWEETY: on a yello 57 Thunderbird.
TWELVE STEP MAN - Tom's super hero
TWICE, adv. Once too often.
TWINS---Womb mates.
TWIT.DAT = 16 Megs? No wonder I never get any mail!
TWIT: Person who knows everything & gets straight F's.
TWIT: Thoughtful, Witty, Intelligent & Truthful!
TWMM: Motives are rarely unselfish.
TWO 50-yard lines, double your fun!
TWO METER OPERATORS do it with very high frequency
TWO METER OPERATORS do it with very high frequency.
TX Driving: To change lanes, first pull out your .357..
TXT2MSG 2.42u (unregistered)
TYF: Trust Your Feelings
TYLENOL.COM not found, Operator temporarily haulted!!
TYPE Story.txt YOURSELF, I'M BUSY FORMATING A HARD DRIVE!
TYPE: DOS function to read docs. Used only in emergencies.
TYPESETTERS do it between periods
TYPING IN ALL CAPS MEANS SHOUTING!!! (Cool it.)
TYPISTS do it in triplicate
TYPISTS do it in triplicate.
TYPISTS do it in triplicate.
TYPOGRAPHERS do it to the letter
TYPOGRAPHERS do it to the letter {p}
TYPOGRAPHERS do it to the letter.
TYPOGRAPHERS do it with tight kerning
TYPOS: correct all you want. I'll make more!Tax the churches! --Zappa.
TYRES: Flatfahrts
TYS Told Ya So
TYVM Thank You Very Much
Ta Da! Bat dog!
Ta Ta till next time #(:)o - Crow's column
Ta'hell with it, lets just shoot - Tom
Ta-Sardar-Gor
Ta-da! The Pink-Wonder is ready for action! - Pinky
Tab Hunter hunting down people that don't pay their tabs
Tab Hunter was Troy Donahue at one time - Tom
Tab is just a spectre in this film - Crow
Tab to your Indenets.
Tablet - a small table
Tablet -- small tablet
Tablet............ A small table.
Tablet: A small table...
Tabloid: A newspaper with a permanent crime wave.
Tac-Tics: Breath mints for dyslexics.
TacTics = candy for dyslexics.
TacTics= candy for dyslexics.
Tachyon Modem -- comes in apricot, mauve, and chartreuse.
Tachyons do it after afterplay.
Tachyons do it before foreplay.
Tack that up in triplicate. - Col. Potter to Radar
Taco Bell Grandee: Taco's owner.
Taco Bell did NOT write "Canon in D".
Taco Bell is *Not* a Mexican phone company!
Taco Bell is NOT a phone company.
Taco Bell is NOT the Mexican telephone company...
Taco Bell is _not_ a Mexican phone company!
Taco Bell is not a Mexican phone company.
Taco Bell is not the Mexican phone company!
Taco Bell is not the Mexican telephone company.
Taco Bell isn't the Mexican phone company ???
Taco Bell: The Mexican phone company.
Tact (n): The unsaid part of what you're thinking.
Tact - changing the subject without changing the mind.
Tact is a kind of mind-reading. S.O. Jewett
Tact is for WEENIES!
Tact is for weenies.
Tact is getting your point across without stabbing someone with it.
Tact is knowing how far to go in going too far.
Tact is remembering a lady's name and forgetting her age.
Tact is rubbing out another's mistake instead or rubbing
Tact is rubbing out another's mistake instead or rubbing it in.
Tact is the art of making a point without making an enemy
Tact is the intelligence of the Heart
Tact is the intelligence of the heart.
Tact is the unsaid part of what you're thinking.
Tact, (n): The unsaid part of what you are thinking.
Tact, n.: The unsaid part of what you're thinking.
Tact: Knowing how far to go in going too far.
Tact: Recalling a lady's birthday but forgetting her age.
Tact: The art of recognizing when to be big and when not to belittle.
Tact: Describing others as they see themselves.
Tact: Knowing how far to go in going too far.
Tact: Recalling a birthday but forgetting the age.
Tact: Recalling a lady's birthday but forgetting her age
Tact: Recalling a lady's birthday but forgetting her age.
Tact: Recalling a women's birthday but forgetting her age.
Tact: Remembering a lady's birthday; forgetting her age.
Tact: knowing how far to go too far.
Tact: making a point without making an enemy.
Tactics and wine, eh? That sounds like Aahz. - Rupert
Tactics are real: move right or you die.
Tactics: Candy for dyslexics.
Tactics: breath freshener for dyslexics.
Tactless - yet rude. - Slappy
Taem, no Devil lived on meat.
Tag - @FN@'s it!
Tag - YOU's it!
Tag - Your it! How childish...
Tag Line Writer Required. Apply within.
Tag Line Xpress support at your doorstep!
Tag Line Xpress, don't EMail without it!
Tag Line Xpress, don't leave home without it!
Tag Lines are irrelevent.
Tag Rule #1 One tagline per message (unless you can get away with more)
Tag Rule #4 Always make sure your taglnes are spelt corectly!
Tag Rule #5 There are no rules when it comes to using taglines.
Tag Rule #6 There are no rules to using taglines except for rule #5.
Tag Rule #7 !senilgat esrever esu reveN
Tag Rule #9 Never write a whole message when just a tagline will do.
Tag Theives Inc. Now accepting applications!
Tag it!!
Tag less messages just look naked somehow...
Tag line continued from previous message
Tag line #27, See Apendix C, pg 245
Tag line absent-please try another B.B.S.
Tag line dievery On de next Geraldo. Yo' Man!!
Tag line thievery ... On the next Geraldo!
Tag line thievery ... On to the next Gerd!
Tag line thievery On the next Geraldo!
Tag line thievery..Comin' up next on Geraldo.
Tag line thievery..Coming up next on Geraldo.
Tag line thieves and the women who love them ... On the next Geraldo!
Tag line under construction.
Tag lines are irrelevant if you don't understand them.
Tag lines, Recipes, everywhere. but not a Recipe to snag.
Tag lines, taglines, everywhere. but not a tagline to steal.
Tag team: A group of people thinking up taglines.
Tag under demolition. BLASTING AREA - NO CB'S
Tag your it - Darkwood
Tag! You're it!
Tag! You're it!
Tag's gone to heaven, so I gotta be good. So I can see my babeee...
Tag, tag, tag ... all you ever do is tag!
Tag, you're it!
Tag, you're it, Tag, you're it, Tag you're it again, Tag, you're it no
Tag-X Tag-X Tag-X Tag-X Tag-X Tag-X Tag-X Tag-X Tag-X
Tag-X can Guess the quoter and tagline formats for each message.
Tag-X steals Taglines.. not me!
Tag-X: An essential component for the *joy* of Modeming!!
Tag-line ! You're `it' !!!
Tag. You're it! (c) 1993, All Rights Reserved.
Tag. You're it! (c) 1994, All Rights Reserved.
Tag... Yer it.
Tag..... You're it!
Tag: "pro-choice"-- see "lie."
Tag: Wait for further instructions....
TagDude 0.87 [Unregistered] with 14957345738972872864372052 taglines.
TagDude! Now suggests taglines based on message content!
TagDude! The BEST tagline program to have. ;-)
TagFind 1.4: Free and available upon request.
TagGod no longer. Merely the Tagline King. - Jack Butler
TagLine Serial No.10397 - (C) 1990, All rights reserved
TagLine Serial No.10397 - (C) 1994, All rights reversed
TagLine Serial No.23459 - (C) 1992, All rights reserved
TagLines are a figment of your imagination.
TagLines are for the perpetually Bored.
TagLines have no calories no cholesterol no nutrition
TagLines have no calories, no cholesterol, and no nutrition!
TagMan v1.0 [NR] PICK ANY NOSTRIL TO CONTINUE
TagRule #1 One Tagline per message (unless you can get away with more).
TagRule #5 There are no rules when it comes to using Taglines.
TagRule #6 There are no rules to using Taglines except for rule #5.
TagRule #9 Never write a whole message when just a Tagline will do.
TagX Pro of Borg - "Your tagline will be assimilated."
Taga nemaMor' bid' bidne, al' sad nema...
Tagalog: official language of the Taglines echo
Tagalog: official language of the recipes echo
Tagectomy - next week on Operation, only on The Learning Channel.
Tageline - Nuke Barney from orbit - it's the only way to be sure.
Tagfile insult deleted. Better luck next time...
Tagged in Fidorama.
Tagged you...Your it....
Tagging along for the ride!
Tagito ergo sum (I Tag, therefore I am)
Tagito ergo sum (I Tag, therefore I am).
Tagless messages just look naked somehow...
Tagless messages just look naked!
Taglination...The art of transforming succinct aphorisms into useless drivel.
Tagline #27, See Appendix C, pg 245
Tagline (n) High Technology bumper sticker.
Tagline (n): 3) Duh, whaddya think this is???
Tagline (n): High Technology bumper sticker.
Tagline (n.): High Technology bumber sticker.
Tagline - (n.) - Object that is used to give out my wisdom...
Tagline = Tags about taglines
Tagline BAD.
Tagline BAN IN EFFECT IN THIS CONFERENCE!
Tagline Bad or Missing NO CARRIER
Tagline CENSORED for being too explicit.
Tagline Censorship: Good Taste In Small Doses
Tagline Chips! Betcha can't snag just one!
Tagline Cola - Refreshment in 75 characters or less.
Tagline Conference lurkers: on the next Geraldo.
Tagline Disabled
Tagline ERROR: Contact your System's Programmer
Tagline Echo - where men are men and sheep are nervous! <g>
Tagline Echo Utility Kit 4. #########################
Tagline Empty: Please order more!
Tagline Error -- Please contact the USS YATI
Tagline Error at 000H:13H4
Tagline For Sale CHEAP. Send $20.00 to Cal Webster.
Tagline For Sale CHEAP. Insert $1.00 into drive A:
Tagline For Sale CHEAP. Insert $1.00 into drive A:
Tagline Fu. Three stars. Joe Bob says check it out...
Tagline Groups introduced!
Tagline Has Been Cleared To Prevent Burn-In.
Tagline Hotel: Tags check in, but they *don't* check out!
Tagline II: The Sequel..
Tagline If you read it ... You're it!!
Tagline Infringement? Sounds like an oxymoron <g>.
Tagline License Plate #1: PMS 666
Tagline Lingerie, so sheer it shows your personality.
Tagline Lite -- A third less funny than a regular tagline.
Tagline Lotto: <- Scratch here to reveal prize.
Tagline Lotto: ######### <=== Scratch here for Prize.
Tagline Lotto: ##########<- Scratch here for prize.
Tagline Lotto: ##########<- Scratch here to see if you win!
Tagline Lotto: 2222222222<- Scratch here to reveal prize.
Tagline Lotto: XXXXXXXXXX <-- Scratch here for prize
Tagline Lotto: XXXXXXXXXX<- Scratch here to reveal prize.
Tagline Lotto: __________<- Scratch here for prize.
Tagline Lotto: ²²²²²²²²²²
Tagline NOT FOUND - SYSTEM HALTED.
Tagline Not Found: (A)bort (R)etry (S)teal one
Tagline Out To Lunch. Back in an hour.
Tagline Out To Lunch. Back in an hour.
Tagline Party overruns the Information Highway! Film at 11!...
Tagline Quiz: What is the dirtiest line ever said on television?
Tagline Repairs: Make smart $1.25; Make funny $125
Tagline Seminar: Overcoming your dependency.
Tagline Serial No. 140763 - (C) 1992, All rights reserved
Tagline Sex: Next on Geraldo!
Tagline Stealing: Official sport of the AUTORACE echo.
Tagline Stealing: Official sport of the Tagline echo.
Tagline Subsystem down at this time.
Tagline Theft Guild Member
Tagline Theft isn't a crime, it's an art!
Tagline Theives, Inc. Now accepting applications!
Tagline Virus.watch how it replicates!
Tagline Virus: At.acks and d.stro.s th. tagl.n.s. .n.....
Tagline Will Self Implode -- <mooB>
Tagline Withdrawal Syndrome
Tagline Wrestling-"I stole it FIRST!" "No, it's MINE!!"
Tagline [\..] satisfaction [.|.] meter [../]
Tagline access denied!
Tagline addiction hotline:1-800-TAG-ADCT Free tags while you wait.
Tagline addiction: It's a humor ailment.
Tagline affixed in compliance with Moderators Rules.
Tagline affixed in compliance with Stuffed Articles Act.
Tagline affixed in compliance with Stuffed Articles Act. Do not tear.
Tagline along what line?
Tagline backordered. Availability in question....
Tagline blank due to threats from underworld kingpins.
Tagline bought from Homeboy Shopping Network.
Tagline canceled due to lack of interest.
Tagline cancelled by the US government shutdown
Tagline cancelled due to brain malfunction.
Tagline cancelled due to lack of interest
Tagline cancelled due to lack of interest!
Tagline censored by Iraqi government.
Tagline contributions may be tax deductable.
Tagline contributions may be tax deductible.
Tagline copyright 1994. All rights reserved.
Tagline core ejection systems are offline, Captain
Tagline definition....Last words of unusual advice or pun...
Tagline deleted by National Endowment for the Arts
Tagline deleted by Natl Endowment for the Arts
Tagline deleted per Title Xii, Article 13 Sect 231
Tagline deleted to save space.
Tagline delivery delayed due to bad roads
Tagline delivery delayed due to bad roads.
Tagline desk with modesty panel, standard, $129.00
Tagline dispenser empty: To order more, call 1-800-TAG-LINE.
Tagline dispenser temporarily out of order
Tagline dropped due to budget cuts.
Tagline dueling: email variation of telephone tag.
Tagline error 176: duplicate joke
Tagline error, Steal another? (Y/n)
Tagline error. Contact your systems programmer.
Tagline evaluation: [ ] Humorous [ ] Insightful [x] Stupid
Tagline exclusively for (Mr) (Ms) Gretchen Hakola from Will Sulzner...
Tagline explodes, destroys BBS. Film at 10 PM!
Tagline explodes, destroys BBS. Film at 11!
Tagline explodes, destroys BBS. GIF at 11!
Tagline fever is the primary symptom of BBS addicts
Tagline fever is the primary symptom of the Blue Wave epi\SLMR\T
Tagline fever is the primary symptom of the Blue Wave epidemic!!
Tagline file TAGLINES.BW corrupt. Loading file MY_DIARY.TXT . . . .
Tagline file not found - make something up? Y/N
Tagline frequencies are Open....
Tagline from Todd Reddy to All on 04-09-94
Tagline from hell
Tagline generator halted - please stand by.....
Tagline go down the hoooooole!
Tagline goes crazy! Hundreds injured. Reply at 11.
Tagline goes here - Use your imagination!
Tagline has been read, please kill it, if no longer needed.
Tagline has been stolen! Call the police!
Tagline here <----- added by wave rider
Tagline horror - Gary crashes his hard drive and has no backups!
Tagline imminent...
Tagline impregnated w/corbomite. Steal at your own risk.
Tagline impregnated with Corbomite; steal at your own risk!
Tagline in for repair. This one's a loaner.
Tagline in shop, will be ready next Tuesday.
Tagline intentionally omitted for fear of being flamed by Jack Butler.
Tagline intentionally omitted.
Tagline intro: The Carousel Waltz
Tagline invisible until it attacks someone, or 24 hours.
Tagline is a snippet of surreality.
Tagline is brought to you by the letters B & W and the number 2.12!
Tagline kit for sale - abcdefghijklmnopqrstuvwxyz
Tagline management will never be the same again!
Tagline manager under construction!
Tagline may be hazardous to your health.
Tagline may be too intense for some viewers.
Tagline misplaced.
Tagline missing. User deleted.
Tagline not Found -- Please Notify Sysop!
Tagline not available, Abort, Retry, Fail? _
Tagline not found - Please notify Sysop!
Tagline not found! (A)bort, (R)etry, (U)se Spellbook.
Tagline not found, (a)bort (R)etry (M)ake a new one
Tagline not found. User twitted.
Tagline not found: (A)bort, (R)etry, (M)ake a new one?
Tagline not found: (A)bort, (R)etry, (T)ype one in?
Tagline not found: Moderator deleted.
Tagline not found: (A)bort (R)etry (C)ry |-(
Tagline not found: (A)bort (R)etry (T)ype one in? T
Tagline not found: Moderator deleted.
Tagline not found: Please notify your sysop!
Tagline not funny -- Steal anyway (Y/n)? _
Tagline number 3, please turn and face the right...
Tagline of Dreams: "If you post it, they will steal it."
Tagline omitted due to lack of interest.
Tagline omitted to conserve precious, expensive space.
Tagline omitted. With Anna leaving, why bother... :(
Tagline on hold till ROOTS IV is mastered. Cannot handle any more!
Tagline on strike.
Tagline or die!
Tagline out of gas.. . . . . . . . .
Tagline out of order, proceed with caution.
Tagline out of paper.
Tagline prohibited by law
Tagline randomized by Silly Little Tagline Scrambler.
Tagline readers DO IT on the bottom.
Tagline rejected. Resubmit in 90 days for final disapproval
Tagline removed due to lack of interest.
Tagline rule #4576: Why create when you can appropriate?
Tagline rule: Them that has the taglines make the rules.
Tagline seeds - sprout new prose (Bard planted a garden)
Tagline shortage. Please help recycle Taglines..
Tagline shortage. Please help recycle taglines.
Tagline sold by volume, not by weight.
Tagline space to let. Inquire within.
Tagline staff: official officials who generate official taglines.
Tagline stealers have no HONOR!
Tagline stealing is the sincerest form of flattery.
Tagline stealing: the highest form of flattery.
Tagline sticker -> JESUS SAVES! <CRASH>...oops-tagline wrecked!!!
Tagline stolen and added to my collection.
Tagline stolen by McFly.
Tagline stolen by SLMR20 from SLMR105 from SLMR10.
Tagline stolen from Bob Lyon. (Steal & Change Name)
Tagline stolen? Call 911, ask for the Tagline Division.
Tagline stomped on by. NO CARRIER
Tagline swiping can be a serious offense young man!
Tagline swiping: The ultimate Object-Oriented application!
Tagline switch set to AutoSteal
Tagline temporarily out of order please use the stairs...
Tagline theft is a compliment.
Tagline theft is more than a hobby, its a way of life.
Tagline theft is the sincerest form of flattery.
Tagline theft really burns my ASCII...
Tagline theft successful. Use immediately? Y/N
Tagline theft: The LAW of Cyberspace!
Tagline theif level 20: +7 to swipe.
Tagline theivery is politically incorrect; use Tagline reclamation
Tagline thief level 20, +7 to swipe.
Tagline thievery . . . On the next Oprah!
Tagline thievery ... On the next Geraldo!
Tagline thievery... coming up on the next Geraldo
Tagline thievery....on the next Geraldo!
Tagline thievery: Coming up next on Geraldo.
Tagline thieves only get short sentences.
Tagline uncloaking dead ahead Sir...
Tagline uncloaking dead ahead, Mr. Todd.
Tagline under construction.
Tagline undetected. (A)bort (R)etry (D)issolve into goop?
Tagline unfunny. Steal anyway? [Y/n]
Tagline utility kit: ,./<>?:";'{}[]`~!@#$%^&*()_+|
Tagline void where inhibited.
Tagline void where prohibited by moderator.
Tagline voting: [ ] good [ ] good [ ] good [X] bad
Tagline wanted! Pays minimum wage and Gov't Healthcare.
Tagline wanted. Apply within ====================>
Tagline wanted. Apply within ====================<
Tagline wish.....I wish I had more Teacher/Education tags.
Tagline! You're "it"!
Tagline's off today, luv.
Tagline* If you read it ... You're it!!
Tagline, I don't need no stinking tagline!
Tagline, You're it!
Tagline, n. The meaning of life in 70 characters or less.
Tagline, tagline, wherefore art thou?
Tagline-lite! 1/3 less serious...
Tagline. This a random is
Tagline..just a phrase I'm going through.
Tagline/?: Press 'T' to swipe tagline, dummy.
Tagline: Your last chance to piss someone off.
Tagline: what we wade through a whole message for.
Tagline: The REAL reason for echomail.
Tagline: The meaning of life in 75 characters or less.
Tagline: The meaning of life in 75 characters or less...
Tagline: Universal Wisdom in 38 bytes.
Tagline: Universal Wisdom in 45 bytes.
Tagline: Your last chance to piss someone off.
Tagline: what we wade through a whole message for.
Tagline: what you stand in to get your license plates.
Tagline? Don't need no stinkin' tagline!
Tagline? I don't need no stinking Tagline!!!
Tagline? I'm much too old to play tag.
Tagline? I'm too old to play tag.
Tagline? What's a tagline?
Tagline? I don't need no steenkin tag line.
Tagline? What tagline?.....
Tagline? What's that? Are we taxing it? - Obscure politician..
Tagline? Where? What is a tagline, anyways?
Tagline?...what tagline...is this gonna make me look stupid?
Tagline?..We don't need no stinking Tagline!
Taglined to death What a tombstone header
Taglinefromhell
Taglinehasfullnetweight.Contentsmayhavesettledduringshipping.
Tagliners are no good doers. -Tagspeare "Henry VI"
Taglines \'tag-l*inz \ The bumperstickers of BBS'ing.
Taglines \'tag-lainz \ The bumperstickers of BBS'ing.
Taglines \'tag-linz \ The bumperstickers of BBS'ing.
Taglines & text, and use your word processor to get rid of the
Taglines 'R Us! (January Clearance Now In Progress!)
Taglines (n.): The bathroom walls of the Internet.
Taglines - (n.) - News Service to the World...
Taglines - Bumper Stickers of the '90's
Taglines - The BBSer's graffiti of the `90s.
Taglines - The REAL reason for EchoMail!
Taglines - can't live with 'em . . .
Taglines - dolar more in your phone bill!
Taglines - smart thougts for dummy readers!
Taglines - the REAL reason for Fidomail!
Taglines - the REAL reason for echomail
Taglines -- When you're too tired to be original, steal 'em.
Taglines Anonymous. Taking it one tag at a time.
Taglines Done While-U-Wait !!!
Taglines R Us (January Clearance Now In Progress!)
Taglines Taglines Taglines are 5000 enough ?
Taglines \'tag-lainz\ The bumpersticker of BBSing.
Taglines about Quark [DS9]
Taglines about taglines are superfluous (like this one).
Taglines and Taglines...........
Taglines and mail readers and QWK packets -- oh, MY!
Taglines and politics: a match made in heaven (or hell?)
Taglines and sex... two things you can't get enough of!!!
Taglines are JCTFxxxx.ZIP Avaliable on The DLS&M.
Taglines are Satanical - It says so in MY bible
Taglines are `bout as much fun as you can have with your jeans on.
Taglines are a snippet of reality.
Taglines are added automagically by most off-line readers.
Taglines are almost as bad as bumper stickers.
Taglines are almost as good as bumper stickers.
Taglines are better than bumper stickers.
Taglines are cool! Huh huh huh
Taglines are dumb........
Taglines are dying in the world. Adopt your own! Press ALT-A!
Taglines are essential. It gives them something else to talk about.
Taglines are for fun...
Taglines are for idiots!
Taglines are for idiots.
Taglines are for morons.
Taglines are for the perpetually Bored.
Taglines are for those people who tagalong long time.
Taglines are for wimps
Taglines are in FIDO and RIME and ILINK and INTELEC Oh, my!!
Taglines are in PODS and MufoNet and DharmaNetoh, my!
Taglines are integral to off-line communication!
Taglines are irrelevant - that's why I don't use them
Taglines are irrelevant.
Taglines are irrelevant. You will be assimilated into the Blue Wave.
Taglines are irrelevant. Messages are irrelevant. You are irrelevant.
Taglines are irrelevant. This one has been assimilated.
Taglines are irrelevant. You will be assimilated i
Taglines are irrelevant. You will be assimilated into FidoNet.
Taglines are irrelevant. You will be assimilated into goat cheese.
Taglines are irrelevant. You will be assimilated into the Blue Wave.
Taglines are irrelevant. You will be assimilated into the Borg.
Taglines are irrelevant. You will be assimilated into the echo.
Taglines are irrelevant. You will be assimilated into the\SLMR
Taglines are irrelevant. You will be assimilated.
Taglines are irrelivent, you will be assimulated into the Bluewave
Taglines are just messages that haven't grown up yet
Taglines are like bumper stickers, only without the same sense of relevance.
Taglines are like cats - you only think you own them.
Taglines are like cats--you just think they're yours.
Taglines are like cats. You just think they're yours.
Taglines are like cats. You only *think* you own them.
Taglines are like cats. You just THINK they're yours.
Taglines are like cats. You just think that they're yours
Taglines are like cats. You just think that they're yours.
Taglines are like cats. You just think they're yours.
Taglines are like cats. You only _think_ you own them
Taglines are like cats.. you just _think_ you own them.
Taglines are like cats....you just THINK they're yours.
Taglines are like motel towels...meant to be taken
Taglines are like redheads, you just THINK they're yours!!
Taglines are like sex and ZIP files: You give and use and still have!
Taglines are like the footnotes to messages.
Taglines are made to be stolen.
Taglines are meant to be loved, not dropped!
Taglines are meant to be stolen.
Taglines are never invented, they are always stolen.
Taglines are no good unless you can annoy someone.
Taglines are not addictive. Excuse me for a sec.
Taglines are seeds for Doctorate thesis.
Taglines are smurfy
Taglines are stupid
Taglines are subject to change without notice; Taglines are slightly
Taglines are the bathroom wall of Fidonet.
Taglines are the bumper sticker of the computer age.
Taglines are the bumper stickers of the '90s.
Taglines are the bumper stickers of the Information Super-Highway!
Taglines are the graffiti on the E-walls of Cyberspace
Taglines are the restroom wall of FidoNet.
Taglines are the restroom wall of Off Line Readers.
Taglines are the restroom wall of RelayNet.
Taglines are the root of all evil.
Taglines are used with off-line mail readers
Taglines aren't all that important. I never use them.
Taglines aren't obssessed with weight
Taglines can be more interesting than messages!
Taglines can make a nice simple delicious nutritious meal
Taglines cause cancer.
Taglines created with the nation's finest available ASCII text.
Taglines deleted ......
Taglines do it in 70 characters or less.
Taglines do not remain stockpiled. -Tenzin Gyatso <NOT>
Taglines don't have to be politically correct!
Taglines don't snore.
Taglines duplicate when you remove the tag saying "Do not remove".
Taglines for BBS Addicts:
Taglines for sale! whoops, never mind, they were just stolen...
Taglines for sale. Make best offer.
Taglines for the poor?
Taglines give me catalepsy.
Taglines go at the end of an electronic message
Taglines in good taste? How 'bout good tasting taglines?
Taglines in this message are weirder than they appear.
Taglines just wanna have fuuunnnnnnn
Taglines made from 100% post-consumer electrons.
Taglines make great Christmas gifts.
Taglines may be funny, but they won't get you tenure.
Taglines mean nothing to me!
Taglines never die, the just become bumper stickers.
Taglines never make you sleep on the wet spot.
Taglines not sold by volume. Contentsoftaglinemaysettleduringshipping.
Taglines now has a new moderator, thanks a Million.
Taglines of the next generation series #923882.
Taglines provoketh thieves sooner than gold. -- Tagspeare
Taglines should be GAGlines.
Taglines smaglines.. Who needs the damn things..!
Taglines suck *NOT*!!!
Taglines suck. Mine do it well!
Taglines temporarily out of order please use your imagination
Taglines that make you go "Hmmm..."
Taglines that make you say.......Hmmmmmmmmmmmmmm :-)
Taglines unavailable. Try again later.
Taglines unite! Stop kidnapping of taglines.
Taglines up to 72 characters long can be used.
Taglines void where prohibited, banned, ############, or "uh-uh-uh'd!"
Taglines wanted (of course)
Taglines wanted!
Taglines will accumulate to fill all available HD space!
Taglines won't bounce your checkbook
Taglines won't stalk you
Taglines! -(@ @)- Taglines! Gota Have More Taglines!
Taglines! Taglines! I like Cal Webster Taglines!.
Taglines! Taglines! Taglines! I want Taglines!
Taglines! Taglines! I like Cal Webster Taglines!
Taglines! Taglines! I like Randy's Taglines!
Taglines! Taglines! Taglines! I want Taglines!
Taglines! Watch! <Search Master File for INSANITY>
Taglines, Mister Rico..! Zillions of 'em..!
Taglines, Mr. Barnes..!! Zillions of 'em..!!.
Taglines, Mr. Caplan..!! Zillions of 'em..!!.
Taglines, Mr. Scudder..!! Zillions of 'em..!!.
Taglines, Mr. Tippett..!! Zillions of 'em..!!.
Taglines, bumper stickers of the 90's.
Taglines, superfluous techno-weenie balderdash, Nah..
Taglines, taglines, taglines. So many taglines, and so little time!
Taglines, they're not just for hard drives any more.
Taglines- the REAL reason for echomail
Taglines--A place to dry wet tags.
Taglines. How quaint.
Taglines. The REAL reason for Echomail!
Taglines... one line freedom of speech!
Taglines... one of the few forms of immortality.
Taglines... the electronic "bumper snicker."
Taglines.... Steal 'em. We'll make more!
Taglines........ there just never seems to be enough roo
Taglines..........The bumper stickers of BBSing
Taglines...? What are they, @TO?
Taglines...? What are they, Orville Bullitt?
Taglines...? What are they?
Taglines...Aphrodisiac for bored computer users.
Taglines...Gutter splutter.
Taglines...one line freedom of speech!
Taglines...the electronic "bumper snicker"...
Taglines...the electronic "bumper sticker"...
Taglines: BBS answer to too much time on your hands
Taglines: E ---+----+----+----/ F
Taglines: If you can't say it in 57 chars, why bother?
Taglines: More interesting than the garbage above.
Taglines: No calories, AND always hungry for more.
Taglines: One-line freedom of speech.
Taglines: The REAL reason for netmail.
Taglines: The bumper stickers of the Information Super Highway
Taglines: Today's single-line restroom wall of high-technology BBS's.
Taglines: What some of us wade through a whole message for.
Taglines: Your last chance to say something stupid!
Taglines: the <real< reason for BBSing.
Taglines: the >real now...
Taglines: 1% inspiration, 99% kleptomania
Taglines: A new life for old cliches and maxims.
Taglines: About the most fun you can have with your pants on!
Taglines: An Equal Opportunity Slam of *Your* Home! <G>
Taglines: Another fine service from the SysGod.
Taglines: Bumper Stickers of the Info Highway
Taglines: Bumper snickers for your computer.
Taglines: Catalyst for discussion (failing all else!)
Taglines: Cybergraffiti!
Taglines: Cybergraphiti!
Taglines: Cyberspatial bumper stickers.
Taglines: FACT OR FICTION? On the next In Search Of...
Taglines: FACT OR FICTION? On the next GERALDO !
Taglines: I steal them ALL and sort them in UED <g>
Taglines: I've skipped the rest, and swiped the best!
Taglines: More interesting than the crap above.
Taglines: No calories. AND always hungry for more.
Taglines: One-line freedom to abuse others with your speech.
Taglines: Steal all you want we'll make more.
Taglines: Steal all you want... we'll make more....
Taglines: Take all you want. We'll make more.
Taglines: The *real* reason for FidoNet.
Taglines: The REAL reason for echo mail.
Taglines: The icing on the netmail cake.
Taglines: The most fun you can have with your pants on.
Taglines: The sound bytes of the information superhighway
Taglines: Things that make you go "Hmmm....."
Taglines: Very addicting. Harder to drop than cigarettes.
Taglines: Your chance to piss someone off!
Taglines: Your last chance to say something stupid.
Taglines: and How They Affect Women. Next On Oprah.
Taglines: bumper stickers for computer nerds.
Taglines: bumper stickers of the 90's.
Taglines: no calories or fat, but always hungry for more.
Taglines: the bumper stickers of BBSing.
Taglines: the license plates of BBSing.
Taglines: the restroom wall of BBS'ing
Taglines: your chance to piss someone off.
Taglines? Hmmm...sounds like fun to me.
Taglines? I doan wan' no stinkin' taglines!
Taglines? I thought you asked to see my TANlines!
Taglines? I thought you invited me to see your Tanlines!
Taglines? I've given up on them, all the good ones are taken.
Taglines? Taglines? I doan wan' no stinkin' taglines!
Taglines? We doan need no stinkin' tagl.@$#% NO CARRIER
Taglines? We don' need no steenking taglines!
Taglines? Yes sir, I like 'em! - The Horse
Taglines? We ain't got no taglines.
Taglines? We doan need no stinkin' tagl.@$#% NO CARRIER
Taglines? We doan need no stinkin' taglines...
Taglines? We don't need no steenkin' taglines!
Taglines? We don't need no stinkin' tagl.@$#% NO CARRIER
Taglines? What are they?
Taglines?!? WE DON'T NEED NO STINKIN' TAGLINES!
Taglines?? I thought you asked to see my tanlines!
TaglinesSteal 'em; We'll make more!
Taglines\'tag-linz\the bumperstickers of BBSing.
Tagling: little tagline.
Taglini Galori...Italian Web Site for Taglines.
Taglining is the maddess. Modeming is the method.
Taglining is the madness. Modeming is the method!
Taglinius Addictus, that *Tagline Addict* 95-07-16
Taglinius Addictus, the *Tagline Addict*, of FIDO and RIME.
Taglinology...The study of taglines.
Tagloins -- tenderest part of the message steak.
Tags dealing with the awesome Warner Sib- er, BROTHERS cartoon show
Tags for sale, form lines to the right.
Tagteam Wrestling Tonite! - Kira & The Intendent Vs. O'Brien & Smiley
Tagteam: A bunch of people thinking up Taglines.
Tagteam: A bunch of people thinking up recipes.
Tagteam: A group of people thinking up Recipes.
Tagteam: A group of people thinking up taglines.
Tagteam: a bunch of people thinking up taglines together.
Tagwine twacks!
Tagword
Tai chi players do it in perfect form, and over and over and over.
Tai chi players do it in perfect form.
Tailgater - one who makes ends meet.
Tailgater--one who makes ends meet.
Tailgaters beware! Reflex check in progress.
Tailoring: Serge Soote
Tailors come with no strings attached!
Tailors come with no strings attached.
Tailors do it with cuffs.
Tailors make it fit.
Tails of Borg: Flying is irrelevant.
Tain't nobody's business (not even mine).
Tajna je ono sto svi znaju u poverenju.
Take 'em down. - Yeah... If nothing else, they ruined my good clothes!
Take 2 asprin & wear your best slip next to your skin.-Hawk to Klinger
Take 2 steps back - spin - 1 step forward - grin - do the Clinton!
Take 20 aspirins, and you'll feel better if you wake up.
Take 20 asprins and you'll feel better, if you wake up.
Take A SYSOP To Lunch. He Needs A Steady Diet Of Bytes
Take A SYSOP To Lunch. He Needs A Steady Diet Of Bytes....
Take Back Your Country: Shoot a Bureaucrat!
Take Back Your Country: Shoot a Lawyer!
Take Barney fishing ... then use him as shark bait.
Take Barney to Three-Mile Island and tell him to breathe deep.
Take Barney to the zoo and let him play with the big kitty cats.
Take THAT, you satin-suited, Tolkein-reading loser!
Take This 'Conference' and Shove It.
Take This Job And Shove It: Ike Witt
Take Us Out Of Orbit, Ensign Crusher. -/- Picard, Jean-Luc
Take Windows and bloat it some more, and what do you get? NT!
Take Your Mouse to lunch Today!
Take a BITE out of crime: ARM the citizens (victims)!
Take a Bite out of Crime -- Shoot the Bastards!
Take a Break!: Colin Sick
Take a MODERATOR to lunch,(s)he's probably broke.
Take a SysOp out to lunch; he's probably broke!
Take a Sysop to lunch, he's probably broke.
Take a Sysop to lunch, she's probably broke.
Take a big steamy gawk at the circus freak -Mike as giant
Take a bite out of crime .. Abolish the IRS!
Take a bite out of crime, the dog said gruffly.
Take a bite out of crime... Arrest Congress.
Take a bite out of crime...shoot a politician.
Take a bite out of crime: arm the victims!
Take a bite out of crime: blow the scumbag away!
Take a bite out of crimeArrest Congress.
Take a bottle of Apirin and call me next month.
Take a break from mutants. Read Sandman.
Take a break in the bathroom? Not me, bud... I got a laptop.
Take a congressman to lunch. You will need a tenderizer.
Take a couple of good hops in the sack and call me in the morning.
Take a double dose of C-Ko's lunch and call me in the afterlife.
Take a good, steamy look at it! - Crow
Take a hard look at what you married! - Tom
Take a hint from the Daleks on how to deal w/ Homosexuals. EXTERMINATE
Take a hint, Q, no one wants you around. - Vash
Take a hit from tha bong....
Take a key and unlock your brain... think about this for awhile!
Take a little time to do whatever makes a happy you.
Take a little wine for thy stomach's sake..St Paul
Take a lock of our skin to remember us by - Tom to apes
Take a long second & get used to this face - Crow
Take a minute to BEAT your Moderator.
Take a minute to beat your Sysop.
Take a minute to delete a twit or two.
Take a minute to delete a twit user or two.
Take a nap. You didn't see any of this.
Take a quiet vacation and it hits the fan. -- Law of Moderators
Take a ride on the *Real Blue Wave*
Take a ride on the tide with the assassin at your side.
Take a risk todaySpeed!
Take a sailor home. Six months of back pressure can work for you to.
Take a stress pill and relax. Bob!
Take a stress pill and relax. Ronda!
Take a trip and never leave the farm - read a book.
Take a walk on the wild side. - G. Gebel Williams
Take a walk on the wild side...
Take a wench for a bride
Take aim, then call whatever it was you hit your target.
Take all the pieces and make an island, might even raise a little sand
Take an astronaut to launch this week.
Take an astronaut to launch.
Take an economy flight. No movie, but they fly low over drive-ins.
Take another bite, it'll be aright.
Take any honest work, but keep moving! - Heinlein
Take away gay-bashing and theres no fun left in the world...
Take away love and our earth is a tomb. -Browning
Take away my handgun?..sure!..out of my cold dead clutching hands!
Take care of me with your hot, moist lips.....
Take care of your reputation. It's your most valuable asset.
Take care of your skin, it stops you leaking!
Take care of yourself, Dad. - Franklin
Take care!!! William
Take care, Orville, and don't be mean to yourself.
Take charge of your attitude. Don't let someone choose it for you.
Take charge of your attitude. Don't let someone else choose it for you.
Take charge of your attitude. Don't let someone else choose for you.
Take charge of your attitude. Don't let someone else choose it for you
Take comfort in the saying "beauty is only skin deep"
Take credit when people don't know someone beat you to it.
Take defeat like a man, blame it on your wife!
Take down the shutters - open more Windows on genealogy.
Take egotism out, and you castrate the benefactors.
Take enlightenment wherever you find it :)
Take every thought captive and make it obedient to Christ. 2 Cor 10:5.
Take everything in stride. Trample anyone who gets in your way.
Take everything in stride. Trample anyone who gets in your way.
Take full advantage of Windows'95...use a Macintosh.
Take heart, I read the end of THE book . . . . .we win.
Take heed that no man deceive you. - Matthew 24:4
Take it as it comes.
Take it away, Eric the Orchestra Leader!
Take it away, Ghengis.
Take it back where you bought it, and get it exchanged.
Take it back!
Take it easy Dax! We're going fishing with lures, _not_ worms!
Take it easy, but take it - Studs Terkel
Take it easy, we're in a hurry.
Take it for what it's Worthless
Take it from Death, life is a terrible thing to waste!
Take it from Orville.
Take it from me - he's got the goods.
Take it home, Joel - Tom
Take it outside, God-boy! Okileedokilee!
Take it slow, but take it. And don't forget to KEEP IT FUN.
Take it to alt.sex.monkey.spanking
Take it while you can. - Londo
Take it, Crow, daddy! - Tom
Take love away from life and you take away its pleasures.
Take me 4 better or 4 worse...
Take me as I am.
Take me away But be gentle, I'm fragile. - Yakko to Nurse
Take me away, 7Up! - Mike as young cop
Take me away... But be gentle, I'm fragile. - Yakko to Nurse
Take me drunk officer - I'm home.
Take me drunk, I'm home again!
Take me drunk, I'm home.
Take me home, furry people need love too
Take me in your arms and love me!
Take me to another place in my mind. - Fishbone
Take me to the Earth Consulate at once.
Take me to the Earth Consulate immediately.
Take me to the Earth Consulate without delay.
Take me to the Earth Consulate.
Take me to the dance, Tom bawled.
Take me to your Sysop! tm
Take me to your anus! - Crow to Tom
Take me to your leader earthling, or I'll atomize your face. Garfield
Take me to your leader, human... Hillary, not the fat one.
Take me with a grain of salt, but add some thyme and coriander.
Take me! - Tom as girl at dinner table
Take me, I'm yours, she said easily.
Take me, subcreature!
Take me, to the Dreamers' Ball! --Queen
Take moderation into extremity.
Take my Visa, take my husband, but don't touch my modem.
Take my Worf ..... please! - Data
Take my advice - I don't need or use it.
Take my advice - I never use it.
Take my advice - I'm not using it.
Take my advice, I don't use it anyway.
Take my advice, I don't use it anyway.
Take my advice, I don't use it anyway. ___ Blue Wave/QWK v2.12
Take my advice, I don't use it anyways.
Take my advice, Jefferson ... I don't use it anyway.
Take my advice, Orville; 100,000 lemmings can't be wrong.
Take my advice----I'm not using it!!
Take my advice. I don't use it anyway!
Take my advice. I'm not using it at the moment, anyway.
Take my advice. I'm not using it.
Take my advice. I don't use it anyway.
Take my advice...I'm not using it anyway!
Take my advice; I don't need it.
Take my hand, @FN@.
Take my hand, DiDi. --Death.
Take my hand, I will lead you to the inferno..
Take my hand, I'm a stranger in Fidoland
Take my hand, I'm a stranger with parasites - Tom
Take my hand, Orville.
Take my hand, YOU.
Take my hand, brother. - Connor MacLeod
Take my life please. Henny Youngmodem.
Take my life, and let it be, consecrated, Lord, to Thee.
Take my modem? When they pry it from my cold, dead fingers.
Take my self control, I'm not using it anyway.
Take my visa, take my wife, but NOT my modem!!
Take my wife - to Egypt, and don't never come back. --Redd Foxx.
Take my wife! Please! Oh--sorry, dear...(gulp)
Take my wife, pl--wrong echo!
Take my word for it, @FN@.
Take my word for it, YOU.
Take no friends and leave no enemies.
Take no prisoners, we can't feed them.
Take no prisoners, we can't feed them.
Take nothing but ancestors, leave nothing but records.
Take off the Trek-Colored glasses!
Take off the mask of Barney the dinosaur, and I bet you'll find Elvis
Take off your underwear w/out taking off your pants -Mike
Take off, eh!
Take over for us! Yakko No way! Wayne/Garth Way! Yakko
Take over for us!-Yakko No way!-Wayne Way!-Yakko
Take pleasure in the little things!
Take pot to the beach; leave no tern unstoned.
Take pride in Scouting.
Take sominex, Tom said sleepily.
Take tea and see, said Tom briskly.
Take that back! It tastes like the stuff my wife makes.
Take that trip to the brain.
Take that you community theater reject! *WHAP!*
Take that, Lorena said cuttingly.
Take that, Pink Boy! - Crow as robot wins chess match
Take the "E" out of Dude and you're left with a DUD!
Take the 'e' out of Dude and you've got a DUD!
Take the antiderivative of (tan 3x^2)/5x...
Take the bull by the hand and avoid mixed metaphors.
Take the bull by the hand, and don't mix metaphors.
Take the greatest risk: let yourself be just the way you are.
Take the law into your own hands?
Take the prisoner to the dungeon he said condescendingly.
Take the road block challenge - Tom on Coke truck in road
Take the short-cut to Geodesic Park!
Take the skin and peel it back - NIN
Take the steps, the elevator don't work.
Take the time to snuff the dandelions
Take the time to understand and lend a gentle helping hand!
Take this brother, may it serve you well...
Take this bus to New Jersey!
Take this job and SHOVE IT! said Johnny Paycheck resignedly.
Take this job and shovel it !
Take this s**t to the DeadHorse Conference!
Take this s**t to the DeadHorse Conference!!!
Take this soapbox back, I'm getting splinters in my feet.
Take those broken wings and learn to fly again.
Take those phasers off stun, Mr. O'Brien. No more Mr. Nice Guy - Sisko
Take time to appreciate the little things.
Take time to do the things that really make you happy.
Take time to listen
Take time to listen...
Take time to read... it is the fountain of wisdom.
Take time to smell the roses - and trees, grass, rocks, fire hydrants.
Take time to smell the roses and eventually you'll inhale a bee.
Take time to smell the roses, but watch out for the bees.
Take time to smell the roses...and trees, grass, rocks, fire hydrants
Take time to stop and smell the Pizza.
Take time to stop and smell the napalm.
Take time to think... it is the source of power.
Take to a book on a holiday.
Take two Taglines and call me in the morning.
Take two Tribbles and call me in the morning -Klingon Rx
Take two aspirin and call the consultant.
Take two aspirin first then it won't hurt so much!
Take two asprin and see the Dept of Neural-Surgery immediately!
Take two crows and caw me in the morning
Take two hours of Rush Limbaugh and call me in the morning.
Take two pawns and drink plenty of liquids.
Take two recipes and call me in the morning.
Take two taglines and call me in the morning.
Take two taglines and netmail me in the morning.
Take two tribbles and call me in the morning.
Take us to your leader, the one you humans call Curly.
Take what Scouting taught you everywhere you go.
Take what you can use and let the rest go by. - KEN KESEY -
Take what you want - leave some if you want. No ratios.
Take what you want. Delete what you don't. =)
Take you to him I will, yes!- Yoda
Take your bare hands baby rip out my eyes...
Take your brother swimmin' with a brick it's alright.
Take your cat for a wok.
Take your dimwitted gibberish to alt.dumb.ten.year.olds...
Take your hand from my blouse! Mary tittered.
Take your levity whenever and wherever you can find it.
Take your medicine like a man.
Take your powder, take your gun, report to General Washington!
Take your shoes off. And get rid of that popcorn. I hate popcorn.
Take your shot, Fun-Boy. You've got me, dead-bang! --The Crow.
Take your thumb outta your ear and stick it back in your butt! -B&B
Take your wife's first advice, not her second.
Taken a Turing test lately?
Taken as a whole, the universe is absurd
Taken as a whole, the universe is absurd.
Taken the Sears auto center & turned it into HQ - Tom
Taken the joy outta looking at someone's hinder - Tom
Takes a little effort to make PCBoard do un-natural acts.
Takes a lot of RAM to make your floppy spin.
Takes many nails to build a crib, but just one screw to fill it!!!
Takes so long to bury a cat, damned things keep digging out.
Takes so long too bury a cat, stupid thing keeps digging its way out.
Takes you 24 hrs. to just pick up the stupid phone! -Crow
Takin'my tagline, eh? Give it back here, ya hoser!
Taking a Greyhound to Hawaii wasn't a good idea. - Mike Nelson
Taking a QUANTUM LEAP into the past.
Taking a collection to put the Barney kids in therapy.
Taking a turn for the worst.
Taking criticism is a prerequisite to success.
Taking of attorneys with traps or deadfalls is permitted
Taking of lawyers with traps and deadfalls is permitted.
Taking the gun away only changes the way you get screwed.
Taking the wind out of Windows...
Taking up collection to give Barney a one way ticket to Jurassic Park
Taking up collection to give Barney a one way ticket to Jurassic Park!
Taking up collection to give Barney one way ticket to Jurassic Park!
Tako je ruzno vreme da ni zenu ne bih pustio napolje !
Takvu retkost odavno nisam video, a onda pustih vodu.
Tale of a tagline thief: I came, I saw, I swiped.
Talent does what it can, genius does what it must, I do what I'm paid to do.
Talent is a flame. Genius is a fire.
Talent is as talent does.
Talent is what you posses; genius is what possesses you - Cowley
Talent on loan from God.
Talent: Being able to bush polka dots.
Tales of a Tagline thief - I came, I read, I stole.
Tales of a recipe thief - I came, I read, I stole.
Talgine - The pain of seeing a misspelled taglinne.
Talgine - the pain of a misspelled tagline.
Talgine -- the pain of a misspelled tagline <g>.
Talk Is Cheap, Because Supply Exceeds Demand
Talk Talk by Talk Talk on an ablum called Talk Talk - Tom
Talk about s-t-r-e-t-c-h-i-n-g the truth!
Talk about a group of women w/PMS - Joel on girls w/guns
Talk about body styles...my body HAS styles!
Talk about memory, this system includes a sense of guilt.
Talk about things that make you go hmmmmmm!
Talk about weight off your mind! - Lister
Talk back, tremblin' lips!
Talk be cheap, but rarely free. Cheeeiit.
Talk digital to me - it gives me quantum thrills.
Talk dirty to me, baby... baby... baby...
Talk in your sleep, eh? Don't sleep next to a replicator. Too messy.
Talk is cheap - Because supply exceeds demand.
Talk is cheap - unless it's a lawyer talking!
Talk is cheap -- except when Congress does it.
Talk is cheap -- until you hire a lawyer.
Talk is cheap . . . until Congress does it!
Talk is cheap . . . until you hire a lawyer.
Talk is cheap ... unless you hire a lawyer.
Talk is cheap ; supply exceeds demand.
Talk is cheap because Supply exceeds Demand ..
Talk is cheap because Supply exceeds Demand.
Talk is cheap because the supply exceeds the demand.
Talk is cheap but Ammo is Cheaper!-The Excellent Anime
Talk is cheap since supply exceeds demand.
Talk is cheap till you hire a lawyer.
Talk is cheap unless you hire a lawyer
Talk is cheap unless you hire a lawyer.
Talk is cheap until you get a lawyer.
Talk is cheap until you hire a lawyer
Talk is cheap until you hire a lawyer.
Talk is cheap'til you hire a lawyer!
Talk is cheap, and so am I.
Talk is cheap, and time's expensive.
Talk is cheap, because supply exceeds demand
Talk is cheap, because supply exceeds demand.
Talk is cheap, because supply exceeds demand...
Talk is cheap, but rarely free.
Talk is cheap, until you hire a lawyer.
Talk is cheap. Using a modem gets expensive.
Talk is cheap. 'til you hire a lawyer!
Talk is cheap. Using a modem gets expensive!
Talk is cheap... till you hire a lawyer.
Talk is cheap... until you hire a lawyer.
Talk is cheap...except when Congress does it.
Talk is cheap...real hams beep!
Talk is cheap...until you hire an attorney!
Talk is cheap? Congress ran up $3 trillion doing it...
Talk is cheap??? I suppose you've never hired a lawyer!
Talk is cheapuntil you hire a lawyer.
Talk is cheep, until you hire a lawyer.
Talk or play. Not both. * Worf
Talk or scream. The choice is yours, He.
Talk or scream. The choice is yours, Orville Bullitt.
Talk or scream. The choice is yours, Orville.
Talk or whine. The choice is yours, He.
Talk or whine. The choice is yours, Orville Bullitt.
Talk or whine. The choice is yours, Orville.
Talk radio causes terrorism just like MTV causes teen suicide.
Talk sense to a fool and he calls you foolish. Euripides
Talk sense to a fool and he calls you foolish. - Euripides
Talk sense to a fool and he calls you foolish. -- Euripides
Talk slow but think quick!
Talk slowly, I'm only running at 33Mhz.
Talk to God we're praying, when God talks to us we're schizophrenic.
Talk to God; dial IME-LVIS
Talk to Guinan.
Talk to a Plant...It's rewarding...
Talk to him Steven. Tell him what you feel--Ivanova.
Talk to me @N@. Make believe I'm your bartender.
Talk to me Bob. Make believe I'm your bartender.
Talk to me Derek. Make believe I'm your bartender..
Talk to me HIS. Make believe I'm your bartender.
Talk to me Orville Bullitt. Make believe I'm your bartender.
Talk to me Orville. Make believe I'm your bartender.
Talk to me Rick. Make believe I'm your bartender.
Talk to me Ron Janorkar. Make believe I'm your bartender.
Talk to me Seanette Blaylock. Make believe I'm your bartender.
Talk to me Yakko Warner. Make believe I'm your bartender.
Talk to me, Orville Bullitt. Make believe I'm your bartender.
Talk to me, honey. Make believe I'm your bartender.
Talk to me. Make believe I'm your bartender.
Talk to the World - Become a Ham Radio Operator
Talk to your Plant often; it doesn't cost a Penny!
Talk without speaking --U2
Talk's cheap till you need a lawyer.
Talk, scream, or whine. The choice is yours, @TO.
Talk, whine, or scream. The choice is yours, Orville Bullitt.
Talk: Something that is cheap except for Lawyers and Congressmen.
Talkers are no good doers. - William Shakespeare, "Henry VI"
Talkers are no good doers. -- William Shakespeare, "Henry VI"
Talkers are no good doers.<Shakespeare, "Henry VI">
Talkie Toaster? What a concept.
Talkin' 'bout my g-g-g-generation....
Talking Vaccum Cleaner: "You want me to suck WHAT?!"
Talking about books is never a waste of space....IMHO. - Mycroft
Talking is a disease of age.
Talking is another disease of age.
Talking of bulls is not like being in the bull ring.
Talking right is not politically correct.
Talking to you is like talking to a wall! <The Iron Circle>
Talkshow hosts that run out of weirdos to feature. Next, on Geraldo.
Tall & tan & young & lovely, the girl from Hiroshima -Tom
Tall Tails for the Tailless.
Talmac casts and ......... The quarterback is toast !
TamDos 1.0 (A)bort (R)etry (K)iss Dex?
Tamarian Thief: 'Temba, with his hands up... NOW! suckah!'
Tamarian mugger: "Temba, his arms up, NOW, suckah!"
Tamarian mugger: "Tembar, his arms up, NOW suckah!"
Tamarian mugger: "Timba, his arms up, NOW, suckah!"
Tamarian mugger: Timbir, his arms up, NOW!
Tamarian pornography: Madonna, behind the green door.
Taming of the Shrew - Starring Bill and Hillary Clinton.
Tammy Faye loves you. Everyone else thinks you're an ass.
Tammy Faye loves you. Everyone else thinks you're an ass
Tammy Potash ... EchoTaglineConnoisseur
Tammy are you naked?
Tammy is busier than a one-eyed cat watching two mouse holes.
Tammy's Gourmet Taglines: Best and Freshest Every Day.
Tammy/Tammy Potash/Queen of the Wild Frontier...
Tamo dje su djetici krcili putljagu.
Tampering w/wrestling will bring punishment - Tom
Tampon lomim, ruke mi krvave.
Tampons $1 a dozen! No strings attached!
Tampons $1 a dozen! No strings attatched!
Tamsen Thistlehawk-Ranck: a weed, a bird, and a military sleeve
Tamsen has Van Gogh's ear for music.
Tan? Heck no..I'm from Vancouver...that's rust.
Tandy America's Technology. Sure!
Tandy DOS 3.20.22 -> What Is this neat little toy ?
Tandy is not dandy...it's just a randy computer !
Tandy...You can buy better, but you can't pay more.
Tandy: A computer with training wheels you can't remove.
Tandy: For the unsuspecting consumer.
Tandy: Yesterday's technology at tomorrow's prices.
Tandy: You can buy better, but you can't pay more.
Tangent: Man who has been in the Sun.
Tangent: n., Man risking melanoma.
Tangle up your twisted tongue. It's simple. - Collective Soul
Tango Sierra Soldier! FIDO! - Curt Carson
Tanker: Someone who rides, to where he is going to die, in his coffin.
Tankers DO IT with armor.
Tankers refer to the infantry as Crunchies
Tanks -- they're a "male thing!"
Tanned women are like turkeys---All the white meat is the best!!! |-)
Tanya Harding: 7 lead pipes from the gold.
Tanya Harding: Botched up tying her shoelaces too.
Tao abides in non-action, Yet nothing remains undone. <Tao Te Ching>
Tao can be spoken not real Tao.
Taoism - **** Happens
Taoism - Shit Happens
Taoism ... S*** happens
Taoism: Shit Happens
Taoism: (def.) S**t happens.
Taoism: Shit Happens.
Taoist: dung is tao too.
Taoist: shit is tao too.
Tap dancers do it with their feet.
Tap dancing in the canoe of life
Tap here >>>>> >>>> <<<<< with HAMMER for new monitor!
Tap pants...er..uh...Dance belt - Crow
Tap! Tap! Is this tagline thingie working?
Tape Drive...Disk Drive...Hard Drive...CD-ROM Drive...Warp Drive
Tape tonight's episode of Tek Wars - Dr. Forrester
Tape, staples, stitches, glue: John Bobbitt's shopping list.
Tapioca: The only known dessert that produces leftovers.
Taptaptaptaptaptaptaptaptaptaptaptaptaptaptaptap...Fireball!
Tar is not a play thing -Bart Simp./Epis. 7F02
Tar is not a play thing -Bart Simpson/Episode 7F02
Tar is not a plaything
Tar is not a plaything - Bart Simpson's lines
Tar is not a plaything. --Bart Simpson.
Tardis Express. When it has to be there Yesterday!
Tardis Express: When it positively HAS to be there YESTERDAY!!
Tardis: for those packages that really need to be there yesterday.
Target your blaster at the nearest moderator AND SHOOT!
TarglIj yInga' yIruch! (Klingon for: Go f*ck your targ!)
Tarzan no want Jane - Tarzan want Steve.
Tarzan of Borg - "Me assimilate. You assimilated."
Tarzan travels to California in: The Apes of Wrath
Tasha Burger: (It'll come up again later after it's gone.)
Tasha Burger: It'll come up again later after it's gone.
Tasha Yar - one who knows the real meaning of receiving Data.
Tasha Yar Supports Data Entry
Tasha Yar doesn't support Data entry - it never happened!
Tasha Yar doesn't support Data entry...it never happened!
Tasha Yar seeks Data input...
Tasha Yar supports "Captain's Log" Entry.
Tasha Yar works in a Data entry position.
Tasha Yar's busy in her quarters receiving Data.
Tasha Yar's least favorite phrase? "Insufficient Data".
Tasha Yar's specialty: Data input!
Tasha Yar, busy in her quarters receiving Data.
Tasha and Data, when the bulkheads shook...
Tasha and I were intimate -- Data
Tasha doesn't support Data entry. She says it never happened!
Tasha tried tremendously,thankfully two tries to treat trekers triumph.
Tasmania: Beautiful one day, Related the next.
Tasmanians can multitask!
Tasmanians, who never committed adultery, are now extinct.
Taste cannot be controlled by law. - Thomas Jefferson
Taste first, ask questions later
Taste is the enemy of creativeness. - Pablo Picasso
Taste me you will see... more is all you need!
Taste my steel, pasty boy!
Taste my steel, please - Mike as wimpy tennis player
Taste tester for Alpo.
Taste the love can it be magic?
Taste the love it makes you numb.
Taste...a creamy, fish-like taste.
Tasteful words, you might have to eat them.
Tasteless recipe attached to pointless message.
Tasters Choice: The Final Chapter - Crow on dating couple
Tastes great AND less filling.
Tastes great!
Tastes great! Less filling!
Tastes just like chicken. (Jeffery Dalhmer)
Tastes like a chocolate covered urinal cake - Tom
Tastes like chicken. - Timone
Tastes like goat drool! Weak selling point!
Tasting, 1-2-3, Tasting...
Tata, vidi prase! Stani prase!!!
Tatercrater - Hole dug in mashed potatoes to keep the gravy in.
Tatercrater: Hole dug in mashed potatoes to keep gravy in
Tatercrater: Hole dug in mashed potatoes to keep the gravy in.
Tatercrater: hole dug in mashed potatoes to keep the gravy in.
Tattered times and brainwashed minds, cluttering up his thinking.
Tattoo's favorite kind of M&M's: "The Plain! The Plain!"
Tattoo's favorite kind of MnM's: "The Plain! The Plain!"
Taueret, Goddess of Childbirth and Nursing.
Taught him everything I know, and still he knows nothing.
Taurus Excretum Ad Infinitum....
Taurus: official sign of the Taglines echo
Taurus: official sign of the recipes echo
Tawn Hermo, Snack Giver of Carthage - Tom Servo's names
Tax 'em all, let Hillary sort 'em out.
Tax News: People who made no money last year will get 10% back!
Tax Shelter Tip #1: Buy High -- Sell Low.
Tax Shelter- A way to spend a buck to save fifty cents.
Tax abatement is welfare for the rich.
Tax dollars: Clinton's soldiers in the war on poverty.
Tax forms should read "income owed us" and "in commode yo
Tax increases are irrelevant: Clinton of Borg.
Tax office: a den of inequity.
Tax reform: Don't tax you or me, tax that fellow there.
Tax reform: Taxing something new.
Tax rich bachelors heavily. Why should they be so happy?
Tax the Federal Reserve to pay off the Federal Debt!
Tax the churches!!!!!
Tax the poor and the ugly! Everyone should sacrifice!
Tax the rich, feed the poor, till there's no rich no more.
Tax, Tagline, and title included.
Tax, recipe, and title included.
Tax, tagline, and title included.
Tax=Contribution; Investment=Spending -> From the Clinton Era.
Taxandspendus liberalus ad nauseam extremeus
Taxation *WITH* representation ain't so hot, either.
Taxation *WITH* representation isn't so hot, either.
Taxation WITH repesentation isn's so hot, either!
Taxation WITH representation is no great deal either!
Taxation WITH representation isn't so hot, either!
Taxation WITH representation isn't so hot, either.
Taxation is Theft, Jury Duty and the Draft are Servitude.
Taxation is little more than legalized extortion.
Taxation with representation is THEFT!
Taxation with representation isn't very great either.
Taxes - a government term for screwing you without kisses
Taxes - a government term for screwing you without kissing you.
Taxes are a form of Capitol punishment.
Taxes are high because of the dope in Ottawa
Taxes are not levied for the benefit of the taxed.
Taxes are not levied for the benefit of the taxed. L. Long
Taxes are not levied for the taxed.
Taxes are revolting, why aren't you?
Taxes prepared by you: H&R Blockhead.
Taxes still too low for you? Then vote for Clinton/Gore in '96!
Taxes, Taxes and more Taxes ! Of course I live in Toronto
Taxes, Taxes, that great big expanse east of New Mexico!
Taxes, the death of all of us.
Taxes: A government term for screwing you without kissing you.
Taxes: Just another name for robbery!
Taxes: The failure mode of IncumboCrats.
Taxes? We don't need no stinking taxes.
Taxi Cab drivers come faster.
Taxi cab drivers come faster.
Taxi cab drivers do it all over town.
Taxi drivers do it all over town.
Taxi, Ziggy says there's a 94.1% chance your tagline is adopted!
Taxidermist vs Tax collector: Taxidermist takes only the skin.
Taxidermist: A man who knows his stuff.
Taxidermists do it to last.
Taxidermists mount anything.
Taxidermy Cafe: Let us stuff you.
Taxing the country into prosperity: Clinocchio!
Taxpayer: A government worker with no vacation, no sick leave and no holidays.
Taxpayers are the chief food of politicians.
TazDOS: Life raft found. Eat? (Yeah/yeah/yeah/yeah)
Tchaikovsky: winner of the War of 1812
Td tada: Football player holds up his arms and celebrates after a goal
Te only thing the borg left was this MacIntosh...
Tea just happens to be my 3rd favorite thing in the Universe - Garibaldi
Tea just happens to be my 3rd favorite thing in the Universe.
Tea, Earl Grey, Hot, NOW!!! - Captain Edward Jellico
Tea, Earl Grey, Hot. OW!!! not THAT hot!! - Picard
Tea, Earl Grey, Hot. And computer...in a cup this time?
Tea, Earl Grey, Hot. Engage. Make it so. Come! - Gnomish Picard
Tea, Earl Grey, Hot.-Picard Ale, Romulan, Lots.-Kirk
Tea, Earl Grey, hot ... "IN A CUP!" - Picard to replicator
Tea, earl grey, NOT!!!
Tea, white with 2, just like my men.
Tea. Earl Gray. Hot. IN A CUP!
Tea. Earl Grey. Ice cold, dammit.
Tea. Earl Gray. Hot.
Tea. Earl Grey. Hot. Ow! Not *that* hot! - Picard
Tea. Earl Grey. Slightly warm.
TeaEarlGreyHotEngageMakeitsoCome! - Kender Picard
Teach Me!: I. Wanda Know
Teach a Kid to Fish and Get them `Hooked' for life.
Teach a Yankee to drive: Point him back up I-95 NORTH!
Teach a bird to play baseball, he might make the mynah leagues.
Teach a man to fish and you won't have to share your worms.
Teach a pig to sing? It wastes time and annoys the pig.. .
Teach me how to Kill them Kosh. You will Die. Yes, but not alone.
Teach one to fish and they eat for a lifetime......
Teach them to observe ALL my commandments - Matthew 28:20
Teach you the classic 'Board gag' - Mike to Tom & Crow
Teacher (according to a child): A non-violent mother.
Teacher = Person attempting to civilize youth. See crazy.
Teacher Assistants do it with class.
Teacher in sex-education class: Lets begin with the obvious.
Teacher is not a leper
Teacher is not a leper - Bart Simpson's lines
Teacher is not a leper -Bart Simp./Epis. 9F08
Teacher is not a leper -Bart Simpson/Episode 9F08
Teacher is not a leper. --Bart Simpson.
Teacher of Borg: Homework will be assimilated.
Teacher of Borg: Not doing your work is futile!
Teacher said it was dain bramage
Teacher said it was dain bramage...
Teacher's Work Day. OxyMoron, or rare occurance?
Teacher, may I please be excused? My brain is full.
Teacher, teach us now! - Yakko/Wakko/Dot
Teacher: How do you spell tardiness? Student: L-A-T-E.
Teachers DO IT every period.
Teachers DO IT repeatedly.
Teachers DO IT with instruction.
Teachers are the best people in the whole world.
Teachers aren't Einsteins.
Teachers do it for good heads.
Teachers do it repeatedly.
Teachers do it with class.
Teachers do it......but forgot how!
Teachers do it......but forgot how!!!
Teachers have class
Teachers have class.
Teachers have more fun than ;[5%mNO CARRIER
Teachers have more fun than...W$%& a NO CARRIER
Teachers who ask for blind obedience get dumb students.
Teachers would do it....but forgot how!
Teachers would do it....but forgot how!!
Teachers would do it....but with class!!
Teachers: The little SHITS happen...
Teaching 3 "R's" in CA public schools - rap, rubbers & revolvers.
Teaching 3 "R's" in Miami public schools - rap, rubbers & revolvers.
Teaching a pig to sing wastes your time & annoys the pig
Teaching kids there are no absolutes leads them to drugs. -Mel Gabler
Teaching programming in BASIC is like teaching driving in a wheelbarrow.
Teaching: Appearing to have known your subject forever.
Teaching: Appearing to have known your subject forever.
Teaching: Insanity with a purpose.
Teahouse of the August...MURDER! - Crow
Team OS/2 http://cobweb.utcc.utk.edu/~mstanley ThinkPad 500 - Warped
Team OS/2 -- I've been warped (Warp II that is...)
Team OS/2: The Few, The Proud, The Confused.
Team effort: a lot of people doing what _I_ say!
Teamsters? .. We don't need any ... we have market clout!
Teamwork gives you someone else to blame.
Teamwork is VITAL. It gives you someone to blame.
Teamwork is critical; it allows you to blame someone else.
Teamwork is essential - it allows you to blame someone else.
Teamwork is essential - it gives them another target..
Teamwork is essential - it gives them someone else to shoot at.
Teamwork is essential -- it allows you to blame someone else.
Teamwork is essential, it gives them someone else to shoot at.
Teamwork is essential, it gives them something else to shoot at.
Teamwork is essential. It gives them someone else to shoot at.
Teamwork is essential. It gives them another target.
Teamwork is essential; it gives them other people to shoot at.
Teamwork is very important... it allows you to blame someone
Teamwork is vital! It gives you someone to blame.
Teamwork is vital. It gives you someone else to blame.
Teamwork: Helping one another be right, not wrong.
Tear Up Those Betting Slips: Lou Zerr
Tear down the Wall!..
Tear drops on my pillow.
Tear drops on my window.
Tear gas is produced with onions & baked beans.
Tear him to pieces!--Do it presently!
Tear off his sign bit and SHIFT down his throat!
Tearline not found: (A)bort (R)etry (P)anic (B)lame_Mail_Tosser |-)
Tears are the thank yous of the soul.
Tears fall and burn the garden greens - Hendrix
Tease me, please me, 69 me!
Tease the wool? Well, okay...dirty old woo-ool! Dirty...
Tease your plants!! Water them with Ice cubes!!
Teats? Wow can we say that? Teats! Teats! Teats! - Tom Servo & Crow
Tech Rep's Motto: If it ain't broke, fix it
Tech Support is Just A Busy Signal Away
Tech Support: Not just a job, an adventure!
Tech Support: help is just a busy signal away.
Tech support? What's that?--Bill Gates
Tech writers DO IT manually.
Tech writers do it manually.
Techies DO IT in the blackout (with power tools).
Techies DO IT till it Hz.
Techies do it behind the scenes. (as in stage hands)
Techies do it in the dark.
Techies do it on cue.
Technical Books - "Sleeping pills you read!"
Technicality: A liberal's view of someone else's rights
Technicality: A liberal's view of the 2nd Amendment.
Technicality: A liberal's view of the First Amendment
Technically speaking, 0110100111101011101100101101 0100111011111000
Technically, it's the lethal dosage, but it keeps me happy.
Technically, it's the lethal dose but it keeps me happy.
Technically, the small intestine *begins* at the mouth.....
Technician in search of a network....
Technicians DO IT with greater frequency.
Technicians DO IT with mechanical assistance.
Technicians DO IT with precision!
Technicians do it accurately.
Technicians do it with frequency.
Technicians tinker. Engineers tear it up.
Techno Pagan
Techno Pagan.
TechnoBabble - Requires BS to understand!!!
TechnoBabble, the language of choice!
Technobabble limit exceeded. Del JARGON.EXE? (Y/n)
Technobabble limit exceeded. Del JARGON.EXE? (Y/y)
Technobabble limit exceeded. Delete OKUDA.EXE (Y/y)?
Technobabble limit exceeded. Del JARGON.EXE Y/N?
Technobabble limit exceeded. Del JARGON.EXE Y/y?
Technobabble limit exceeded. Del JARGON.EXE Y/y? <-TLP
Technochicken: So I do the only thing I can: I cross.
Technology Gone Wild - Technical solutions to technical problems
Technology does not move backward. B. Jones
Technology is dominated by those who manage what they do not understand.
Technology is so technological
Technology is too easy a tool for the misguided musician.
Technology makes "overpopulation" a mislabeled term. : Karl Marx
Technology or Magic: You Decide
Technology won't save us. -- George Lucas
Technology: magic to a barbarian.
Ted "Chappaquidick" Kennedy for Boston dog catcher
Ted Kaczynski has aplomb.
Ted Kennedy . My other car is under water...
Ted Kennedy Party Tip - Take off pants, mingle...
Ted Kennedy Party Tip: Take off pants, mingle
Ted Kennedy Virus: Crashes your computer, but denies it ever happened.
Ted Kennedy and Bob Packwood think harass is two words.
Ted Kennedy for LIFEGUARD at the White House!!
Ted Kennedy for Lifeguard.
Ted Kennedy for lifeguard!
Ted Kennedy of Borg: You will be assimilated. Hop in the car.
Ted Kennedy party tip: take off pants and mingle.
Ted Kennedy's Bumper Sticker [ My other car is underwater ]
Ted Kennedy's Bumper Sticker: My Other Car is Underwater!
Ted Kennedy's Bumper Sticker: My other car is underwater.
Ted Kennedy's PT109 - Mike on boating lovers
Ted Kennedy's car has killed more people than my gun has.
Ted Kennedy's car has killed more people than my gun!
Ted Kennedy's car has killed more people than my guns.
Ted Kennedy's car has killed more people than my handgun!
Ted Kennedy's car killed more people than my handgun!
Ted Kennedy: "My nephew will walk your daughter home."
Ted Kennedy: Proof that booze, driving and swimming dont mix.
Ted Kennedy:"My nephew will walk your daughter home."
Ted Koppel: the father Alfred E. Newman never talks about.
Ted Nugent & Dave Mustaine - rock`n'roll political polarity.
Ted Nugent - Official rock and roller of the E.I.B. Network.
Ted Nugent -- Official rock and roller of the E.I.B. Network.
Ted Nugent -- Official rock crooner of the E.I.B. Network.
Ted Nugent and Dave Mustaine: Rock`n'roll political polarity.
Ted Turner Virus: Colorizes your mono monitor.
Ted Turner Virus: Colorizes your monochrome monitor!
Ted Turner Virus: Colorizes your monochrome monitor.
Ted Turner Virus: Colorizes your monochrome monitor...
Ted Turner is colorizing the universe.
Ted Turner is colorizing the universe. -- Joel Robinson
Ted Turner: "Nuclear war would really set back cable."
Ted's Law: You can't fall off the floor.
Ted's the only one I know who tried to kill his animal guide.
Teddy Bears DO IT in their bear skins.
Teddy Bears are better than Valium.
Teddy Bears are better than valium.
Teddy Failure ** (A)rouse, (R)elieve or (T)ickle?
Teddy Fear - World Tour - 1996
Teddy Roosevelt did it softly, but with a big stick.
Teddy bears and hugs, my next best favorite things!
Teddy bears do it till they're stuffed.
Teddy bears do it with small children.
Teddy cocktail....more bear than one man can...
Teddy control - Eat the whole box? (Y,Y,Y,Y,Y,Y,Y,y)
Teddy to Bill: "You should have drowned her too..."!
Teddy with a Truncheon - Mike
Teddy's furry mound - Her nose (well it IS covered in fur!)
Teddys' mating call: "MORE, MORE, MORE!!"
Tee, Eye, Double Guh, ER, That spells TIGGER!
Teehee. I'm horny! - Tom Servo as young girl
Teehee. I'm horny! - Tom as young girl
Teen Challenge a Christian drug and alcohal rehab
Teen Dad - Tom
Teen Lesbian Nazi Hooker Nuns on the next Geraldo.
Teen Lesbian Nazi Hookers Raped by UFO Aliens - Next on Geraldo
Teen Lesbian Nazi Hookers Raped by UFO, Next on Geraldo.
Teen Lesbian Nazi Hookers Raped by UFOs! - Donahue
Teen Lesbian Nazi Hookers Raped by UFOs! - Geraldo
Teen Lesbian Nazi Hookers raped by UFO: On next Geraldo.
Teen suicides have gone down since '77. Hmm, what year did disco die?
Teen-age Mutant Ninja Haggis!!
Teen-age boys will drive anything - except a lawn mower.
Teen-agers are God's punishment for enjoying sex.
Teen:The age when boys experience life, liberty & happiness of pursuit
Teenage Hell: A parent who's into BBSing..
Teenage Mutant Ninja *WHAT*????
Teenage Mutant Ninja Barbers.
Teenage Mutant Ninja Haggis!!
Teenage Mutant Ninja Tribbles,soft & furry & in no hurry!
Teenage Mutant Ninja Turtles DO IT with pizza.
Teenage Mutant Ninja Ysalamiri
Teenage males can *do it* every 20 minutes. Really!
Teenager declared insane after voluntarily cleaning room.
Teenager declared insane after voluntarily cleaning the house.
Teenager: a young woman who loves the cat and tolerates her brother.
Teenager: A hormone with feet...
Teenager: God's punishment for enjoying sex.
Teenager: Having tunnel vision and selective hearing.
Teenager: One with tunnel vision and selective hearing.
Teenager: Person having tunnel vision and selective hearing.
Teenagers - GODS punishment for unplanned sex !!
Teenagers : Your punishment for enjoying sex.
Teenagers Of The '50's: Bobbie Sox*
Teenagers Of The '50's: Bobbie Sox
Teenagers are God's punishment for enjoying sex!
Teenagers are alike in so many disrespects.
Teenagers are punishment for enjoying sex!!
Teenagers are your punishment for enjoying sex!
Teenagers who have sex are destined to die in grotesque ways.
Teenagers with a Drivers license - your worst nightmares!
Teenagers, God's punishment for enjoying sex.
Teenagers, protesters and lawyers think they're never wrong.
Teenagers: Punishment for enjoying sex.
Teenagers: The price paid for that TWO HOURS of "fun".
Teenagers: Your punishment for enjoying sex.
Teenagers: God's punishment for enjoying sex.
Teenagers: Punishment for enjoying sex.
Teenagers: Your punishment for enjoying sex
Teenmobile ON! - Joel as teen runs to his car
Teens come runnin' for the good taste of porn - Mike
Teens, Smaller versions of immature adults.
TeenyTag 2.00: the niftiest tagline program for TerMail.
Teeth mark on a man will heal
Teeth marks on a toilet bowl rim.
Teeth were not made for stripping wires.
Teets! Teets! - Crow on name in credits
Teflon Keyboard...for sticky fingers.
Teflon brain -- nothing sticks.
Tek kad sam upalio racunar,shvatio sam da sam ga ugasio
Tel SYSOP ... tel user......................L.U.I.
Telecom - Australian for "Inefficient Monopoly"
Telecom Rule #1: Wherever possible, put people on hold.
Telecom: Collect call from the Gamma Quadrant. Will YOU accept charges
Telecom: Collect call from the Gamma Quadrant. Will YOU take the charges
Telecommuncations -- A bit far fetched.
Telecommunication: telepathy for the psi impaired.
Telecommunications is a BIT far fetched.
Telecommunications is a bit far fetched.
Telecommunicators are special people.
Telecourse: it's hard to get an `F'...
Telecrastination: waiting until the 2nd ring to answer.
Telefun radi ki zmajcek.
Telegans....not so brave in the microwave!
Telegard's the orginal, anything else is just a hack!
Telemarketers DO IT over, and over, and over
Telemate and Bluewave: Everything bad brought together!
Telemate built-in multi-tasking is great!
Telepath needed. You know where to apply!
Telepathy is minding someone else's business.
Telephone charges are cheaper the farther you call, go figure...
Telephone poles only hit cars in self defense.
Telephone sex? But those holes are so small!
Telephone was ringing, they told me it was Chairman Mao. -L. George
Telephone... Telegraph... Tell-a-queen...
Teleport - BEST value for Internet access.
Teleportation affects orientation.
Teleportation affects your orientation.
Telethon Donation Line?...%$#@& - NO JERRY
Televangelists: The Pro Wrestlers of religion.
Televangelists: the professional wrestlers of religion.
Televators - The rolling line on a TV when the Horizontal hold is out
Televators: The rolling line on TV when the Horizontal hold is out.
Television gives good disaster.
Television is a medium because anything well done is rare.
Television is called a medium because anything good on it is rare
Television is democracy at its ugliest.
Television is so dull that children are doing their homework.
Television is the vessel of the eternally absent
Television is to media what hydrogen bombs are to explosives.
Television proves people will look at except each other.
Television rots tha brane.
Television shows: those little interludes between the commercials.
Television test patterns are more educational than Barney.
Television: Society's best pesticide for the reading bug.
Televisiono Francus! - TV's Frank
Telix changed my life. I used it to download Telemate!
Telix saved my life; I used it to download Telemate!
Telix users DO IT with SALT!
Telix users are worth their SALT.
Telix would be a steal at $69!
Telix: Tastes great, Less filling.
Tell 'em we said, "Sayonara." Marlon Brando
Tell Abe to vote ballet.
Tell Barney "only the little people pay taxes".
Tell Barney Sharon Stone wants to be his "love kitten".
Tell Barney smoking will improve his image.
Tell Barney the National Enquirer is good literature.
Tell Barney there's a white sale at a KKK rally.
Tell Barney to "just say no" to a carjacker.
Tell Barney to drive in California during an earthquake.
Tell Barney to follow the exploits of Donald Trump.
Tell Barney to invest in Whitewater.
Tell Barney to move to germany with an immigration visa.
Tell Barney to take his nap on a park bench.
Tell Bush overpopulation is the big problem!
Tell Dark Helmet that he must take the princess alive!
Tell Godot I couldn't wait.
Tell Lorena Bobbitt Barney cheated on her.
Tell Me Lies.....Tell Me Sweet Little Lies
Tell a blonde 2 part her hair in middle, she does splits!
Tell a child he got 1 right - not 99 wrong!
Tell a child he got 1 right, not 99 wrong
Tell a child he got 1 right, not 99 wrong.
Tell a man he is brave, and you help him to become so.
Tell a woman from the music she listens to when alone.
Tell all the Truth but tell it slant --
Tell her; I feel fine -- Spock
Tell him I died and didn't leave a forwarding address. - Hawkeye
Tell him I'm jewish.
Tell him about the twinkie.
Tell him he is a good cat. And a pretty cat. - Data
Tell it to the Judge
Tell it to the corpse bearer - Tom to guy after car wreck
Tell me Doctor, where are we goin' this time?
Tell me I won guys. Just tell me I won. -N. Mansell
Tell me I'm crazy - Fox Mulder Mulder, you're crazy! - Dana Scully
Tell me I'm crazy then love me like crazy tonight.
Tell me I'm crazy. --Fox Mulder. Mulder, you're crazy! --Dana Scully.
Tell me I'm crazy...then love me like crazy tonight.
Tell me I'm not f**ked. <M> Well, ok, but I'd be lyin'. <R>
Tell me Mr. Clinton, is stupidity painful?
Tell me about it. --Sinclair.
Tell me about this miracle typhoid cure you've discovered. - Potter
Tell me about your portfolio!--Ivanova.
Tell me about your sexual organs, Commander.
Tell me about yourself. I want to hear more about your "applied art"!
Tell me again about those mango-juice rubbing babes -Crow
Tell me again how I'm lucky to live here..I keep forgetting
Tell me again how I'm lucky to work here..I keep forgetting
Tell me again what that '-r' option to rm does...
Tell me again why you named your kid "Rasputin?"
Tell me again, how do I set my laser printer to stun?
Tell me everything you know. I have a few seconds to kill.
Tell me folk stories about leprechauns, Tom implored.
Tell me how, @FN@.
Tell me how, YOU.
Tell me how,. Dave.
Tell me more about my eyes...
Tell me more about these "habits". ~ Beverly
Tell me more, be explicit, you have tweeked my interest.
Tell me now, @FN@, before I spend 20 dollars on drinks.
Tell me now, YOU, before I spend 20 dollars on drinks.
Tell me now, before I spend 20 dollars on drinks.
Tell me now. Before I spend 20 dollars on drinks.
Tell me sir, have you confused your cat recently?
Tell me something new, Dataman...
Tell me where does all the magic go - Joel sings
Tell me you're crazy. Maybe then I'll understand. - Tori Amos
Tell me young @FN@, what brings you out this far?
Tell me young YOU, what brings you out this far?
Tell me young man, what brings you out this far?
Tell me, Crow T. - Tom
Tell me, Mr. Clinton, is stupidity painful?
Tell me, am I supposed to be pleased or frightened?
Tell me, do you actually _save_ all those Taglines?
Tell me, do you actually _save_ all those recipes?
Tell me, how dead is the Dead Sea? and who killed it?
Tell me, is this Heaven? No, it's Iowa.
Tell me, young #TN#, what brings you out this far?
Tell me, young Nicole, what brings you out this far?
Tell me, young Orville, what brings you out this far?
Tell me, young ensign, what brings you out this far?
Tell me? Why was Lennier walking through the Zoccalo asking for tampons?
Tell my wife I am trolling Atlantis...
Tell no big lies today. Small ones are just as effective
Tell the DJ to SHUT-UP!
Tell the Hell's Angels Barney let the air out of their tires.
Tell the Kai after we have destroyed her Shadowen, we will come for her!
Tell the boss I am busy Multi-Tasking.
Tell the boss I'm busy Multi-Tasking
Tell the boys to...what are YOU grinning at? - Shai-ster
Tell the fat lady to shut up. It's not over, yet.
Tell the tower the music is too loud - Tom on soundtrack
Tell the truth and run <Yugoslavian proverb>
Tell the widow that the deceased's last wish was that she make love with
Tell the widow that you're the deceasd's gay lover.
Tell the widow that you're the deceased's gay lover.
Tell the widow the deceased's last wish was she make love with you.
Tell them I'm coming and I'm bringing hell with me!
Tell them that death is coming for them, tonight--The Crow.
Tell them we're pixies - Crow
Tell those Marines to stop singing in the hallways! ... Montazuma
Tell us that story about Cole Porter again - Dr. F
Tell us what you'll do with the time you save?
Tell us your phobias, and we will tell you what you are afraid of.
Tell your boss what you think of him, and you shall be set free.
Tell your loved ones how much you DO love them..
Tell your parents to be more careful next time.
Tell your senators to support The Dietary Supplement Health & Edu. Act
Tell'em what they won, Johnny
Tellarites do no argue for reasons; they simply argue.
Telling a liberal the truth is like showing a vampire a crucifix.
Tells a computer what to do with itself!
Teloustic - Tendency for people to shout when calling long distance.
Teloustic : Tendency to shout when calling long distance.
Teloustic: Tendency for people to shout when calling long distance.
Temba, his eyes open.
Temba, with arms wide.
Temba, with his pants down. -Picard
Temp. Insanity: I'm buying a Stainless Steel Cod Piece!
Temper gets us into trouble. Pride keeps us there.
Temper, temper, mon capitaine. -The Q
Temper, temper, mon capitan. - Q
Temper, temper. You're showing your ignorance again.
Temperament is the key to maintaining a tranquil mind.
Temperance: eat not to dullness; drink not to elevation.
Tempest: (T)ransient (EMP) (EST)imates.
Tempest: (TEM)-Wave (P)ropagation in (E)-Field (S)ite (T)esting.
Tempest: (TEM)porary (PE)rsonnel (S)ecurity (T)est.
Tempest: That which occurs in Teapots.
Tempo: This is where a headache begins.
Temporal distortion located around workplace clock.
Temporarily out of tag lines.
Temporarily out of tag lines.....
Temporary Insanity, Just one day off sick!
Temporary suspension of disbelief is a wonderful thing.
Temporary sysop access granted!
Temporary things tend to become permanent.
Temptation abounds but sadly i am locked in a cage of despair.
Temptation is one of my favorite sports beaten only by sarcasm.
Tempus Flipper: Time is a dolphin.
Tempus fable: Time has a moral.
Tempus fabricate: Time is a lie.
Tempus fact: Time IS.
Tempus factor: Time is a component.
Tempus faculty: Time teaches.
Tempus faery: Time has wings.
Tempus fairy: Time has a tale.
Tempus fairy: Time likes boys.
Tempus faithful: Time doesn't cheat.
Tempus fakir: Time charms snakes.
Tempus falsetto: Time talks funny.
Tempus fantasy: Time is an illusion.
Tempus farewell: Time's up!
Tempus farther: Time isn't there yet.
Tempus faultless: Time is perfect.
Tempus favor: Time likes you.
Tempus feces: Time is sh*t.
Tempus fecund: Time f*cks.
Tempus federal: Time is wrapped in red tape.
Tempus felonious: Time is illegal.
Tempus feral: Time is a wild child.
Tempus fermentation: Time is 80 proof.
Tempus fertile: Time is pregnant.
Tempus fetus: Time is unborn.
Tempus feverous: Time is hot stuff.
Tempus fibrous: Time is a thread.
Tempus fictitious: Time is imaginary.
Tempus fiesta: Time is a party.
Tempus filibuster: Time is a politician.
Tempus fillet: Time has no bones.
Tempus film: Time is a camera.
Tempus finance: Time costs money.
Tempus finger: Time gives you the bird.
Tempus fitness: Time is aerobic.
Tempus fixit: Time is repairable.
Tempus flaccid: Time can't keep it up.
Tempus flapjack: Time goes good with maple syrup.
Tempus flatfoot: Time is a cop.
Tempus flawless: Time is perfect.
Tempus flicker: Time is a Bic.
Tempus fluster: Time excites me.
Tempus foggy: Time is in London.
Tempus folklore: Time is a myth.
Tempus follow: Time doesn't lead.
Tempus football: Time needs a first down.
Tempus forage: Time eats berries.
Tempus forbid: Time is taboo.
Tempus forceps: Time delivers.
Tempus foreign: Time is an alien.
Tempus forest: Time can't see the trees.
Tempus forget: Time has Alzheimer's Disease.
Tempus forlorn: Time gave up.
Tempus fortune: Time plays the Lottery.
Tempus frater: Time is a brother.
Tempus freezer: Time is really cold!
Tempus frugal: Time is an economist.
Tempus fumble: Time dropped the ball.
Ten Blondes in a freezer = frosted Flakes !!! ...
Ten Elf Pick-up Line: Sex is a killer, so die happy.
Ten Laps To Go... We Take You Now to PGA Golf.
Ten animals I slam in a net
Ten bucks says that I've kicked my gambling habit!
Ten chocolate sundaes. I'm in a really bad mood. -- Troi
Ten chocolate sundaes. I'm in a really bad mood. - Q
Ten death knights approach. I close the door.
Ten dollars does not a profit make.
Ten hours on, ten hours off. --Cranston.
Ten score years ago, defeat the kingly foe
Ten thousand bears can't be wrong -- eat your honey!
Ten undead on a paladin's chest, yo ho ho and a bottle...
Ten weeks from Friday will be a pretty good day.
Ten years after the Earth/Minbari war...
Ten years of rejection slips is nature's way of telling you to stop writing.
Ten, fire-breathing tot. Likes Ataru...rare, medium, or well done...
Ten-hut!! - Hawkeye <whole room snaps to attention>
Tenaguitarskatoa
Tenchi Muyo Excuse # 1: Giving samples to Washuu-chan.
Tenchi Muyo Excuse # 2: Taking a bath with Ryoko.
Tenchi Muyo Excuse # 3: Having breakfast with Sasami.
Tenchi Muyo Excuse #1: Giving samples to Washuu-chan.
Tenchi Muyo Excuse #2: Taking a bath with Ryoko.
Tenchi Muyo Excuse #3: Having breakfast with Sasami.
Tend the molehills, the mountains look after themselves.
Tender are the words I choose ... Tender is the night -Jackson Browne
Tender is the night. -Doc Zimmerman
Tender, teasing feathers on inner thighs....
Tenderfoot, Second Class, First Class, Star, Life, EAGLE!
Tendons make an excellent source of bindings
Tennesee DOS: Ya'll reckon (Yep/Dunno/Nope)?
Tennesee DOS: Ya'll reckon? (Yep/Nope)? _
Tennesee... Tennis, see? Tenor C. Ten I see...
Tennessee Vol. Going All The Way in 1995.. Go Volunteers........
Tennessee foreplay: "Hey Maw, where's cousin Ellie Mae?"
Tennis is irrelevant -- Bjorn Borg
Tennis is irrelevant. - Bjorn Borg
Tennis players DO IT in their shorts.
Tennis players DO IT with love!
Tennis players cannot play with balls all day long (too tired).
Tennis players do it in sets.
Tennis players do it in their shorts.
Tennis players have fuzzy balls.
Tennis pros have Bjorn Borg-asms.
Tennis racket broken, anyone got a extra cat?
Tennis racket broken, anyone got an extra cat?
Tennis: a game where love means nothing.
Tennnn-hut! Readyyyy? PANIC ... two, three, four.
Tenors do it for a song.
Tens and twenties are the best ways to say "thank you."
Tenser, said the tensor...Tenser, said the tensor
Tension breaker #3: Go bungy jumping, forget the rope! cc
Tension, Apprehension & Dissension have begun.
Tension, apprehension and dissension have begun
Tension: what we're supposed to pay when someone is talking.
Tent pegs..check..twine..check..tents..tents? TENTS! ARGH!
Teoretski, ljubav lepo zvuci, malcice je drugcije u praksi,
Tequila is the gulp of Mexico!
Tequila...Spanish for cactus juice.
Tequilla Sunrise * Home of the ~Sailor Moon~ Echo *
Terabytes Windows NT: Nice Try..! Windows NT: The epitome of
Terminal Emulation...An invention by Thomas A. Edison.
Terminal Illness: Getting sick at the airport.
Terminal Illness: Getting sick at the airport...
Terminal Velocity: Get some shades and sun oil-it's hot!
Terminal Verbosity Support Group: On and On Anon
Terminal Whiff: The airline smell your clothes have after a long flight.
Terminal Whiff: The airline smell your clothes have after long flight.
Terminal glare: A look that kills
Terminal glare: A look that kills.
Terminal glare: A look that kills...
Terminal illness - getting sick at the airport
Terminal illness -- sickness at airport
Terminal: The effects of infinite recursion on a finite machine.
Terminally Ill
Terminally Weird
Terminally clueless!! - Geco
Terminate - Been There, Done That, Using Terminator 2 Because Of It!
Terminate IS the final terminal!
Terminate botch job? [Y/N]
Terminate registration site Belgium
Terminate! The terminal program that lets all the others die in peace
Terminate/TMail/TmNice A Perfect Liaison A Trois. :-)
Termination complete. Acceptable losses. Lets go! - Tom
Terminator 2 on int'l terms: Hasta la vista, Bebe!
Terminator 3: Klingon female with PMS.
Terminator 3: @FN@ With A Hockey Stick
Terminator 3: Female Klingon With PMS.
Terminator 3: Klingon female with PMS.
Terminator 3: Liquid Metal Hillary Clinton goes after the kid....
Terminator 4: The Sex Machine, And He's Comming!
Terminator Spaghetti: pasta la vista, baby
Terminator bumper sticker: I TIME TRAVEL NAKED.
Terminator bumpersticker: I TIME TRAVEL NAKED.
Terminator virus found. Hiding in file ILLBE.BAK
Terminator: I want your clothes, your boots and your motorcycle.
Terminito ergo sum. (I TERMINATE, therefore I am.)
Termites've Have Eaten Thru To Your Top Layer
Terok Nor Echo was a dream given form...
Terok Nor Echo was our last, best hope for peace.
Terok Nor was the last, best hope for fun in the Galaxy . . .
Terok Nor"Don't Worry; Be Filky!"
Terok Nor's the name... Filkin's our game.
Terok Nor-- where seriousness is Off-Topic.
Terok Nor. No Warp Factors. Just Fun Factors.
Terok Nor...Let Freedom Sing!
Terok Nor...the Babylon 5 of the Trek Echos...
Terok Nor...where all the world's a filk...
Terok Nor: "Come out from among them, and be ye separate." 2 COR 6:17
Terok Nor: May the Filk be with you!
Terok Nor: relax in the infamous Tub o' Jello or the EchoDarkCorner!
Terok NorLet Freedom Sing!
Terrible puppy-children are after me. - Wally Llama
Terries go home!
Terrific of Frank to put all that stuff in our service records.-BJ
Terrifying sysadmin comment: "...and after I patched the microcode..."
Terrifying sysadmin comment: "Can you get VMS for this Sparc thingy?"
Terrifying sysadmin comment: "Damn, and I just bought that pop..."
Terrifying sysadmin comment: "Didn't you say you turned it off?"
Terrifying sysadmin comment: "Do you smell something?"
Terrifying sysadmin comment: "Go get your backup tape."
Terrifying sysadmin comment: "Hey! The suns don't do this."
Terrifying sysadmin comment: "Hey, what does mkfs do?
Terrifying sysadmin comment: "Hmm, maybe if I do this..."
Terrifying sysadmin comment: "Hmmm, curious..."
Terrifying sysadmin comment: "I don't know if this is ethical, but..."
Terrifying sysadmin comment: "I got a better job at Lockheed..."
Terrifying sysadmin comment: "I hate it when that happens."
Terrifying sysadmin comment: "I have never seen it do *that* before..."
Terrifying sysadmin comment: "I remember the last time it did that..."
Terrifying sysadmin comment: "Ignore the errors. It complains too much.
Terrifying sysadmin comment: "It didn't do that a minute ago..."
Terrifying sysadmin comment: "It shouldn't be doing that..."
Terrifying sysadmin comment: "Management says..."
Terrifying sysadmin comment: "My leave starts tomorrow."
Terrifying sysadmin comment: "NO! Not _that_ button!"
Terrifying sysadmin comment: "Ooohh, lovely, it runs SVR4."
Terrifying sysadmin comment: "Ooops. Save your work, everyone. FAST!"
Terrifying sysadmin comment: "Ooops."
Terrifying sysadmin comment: "SMIT makes it all so much easier..."
Terrifying sysadmin comment: "Say, What does "Superblock Error" mean?"
Terrifying sysadmin comment: "Shit!"
Terrifying sysadmin comment: "System coming down in 0 min..."
Terrifying sysadmin comment: "Terminated?"
Terrifying sysadmin comment: "That's SOOOOO bizarre."
Terrifying sysadmin comment: "The new equipment didn't get budgetted."
Terrifying sysadmin comment: "This won't affect what you're doing."
Terrifying sysadmin comment: "Uh-oh..."
Terrifying sysadmin comment: "Was that YOUR directory?"
Terrifying sysadmin comment: "We _won't_ support that."
Terrifying sysadmin comment: "We don't support that."
Terrifying sysadmin comment: "We're standardizing on AIX."
Terrifying sysadmin comment: "Well, _my_ files were backed up."
Terrifying sysadmin comment: "Well, it's doing _something_..."
Terrifying sysadmin comment: "What do mean by "fired"?
Terrifying sysadmin comment: "What do you mean that wasn't a copy?"
Terrifying sysadmin comment: "What software license?"
Terrifying sysadmin comment: "What the hell!?"
Terrifying sysadmin comment: "What'd you say your (l)user name was...?"
Terrifying sysadmin comment: "What's that grinding sound?"
Terrifying sysadmin comment: "What's this switch for anyways...?"
Terrifying sysadmin comment: "Where'd you say those backup tapes were?"
Terrifying sysadmin comment: "Where's the DIR command?"
Terrifying sysadmin comment: "Where's the GUI on this thing?"
Terrifying sysadmin comment: "Why did it say `/bin/rm: not found'?"
Terrifying sysadmin comment: "Why is my "rm *.o" taking so long?"
Terrifying sysadmin comment: "Wonder what *this* command does?"
Terrifying sysadmin comment: "Wow! Look at this..."
Terrifying sysadmin comment: "Wow... that seemed _fast_..."
Terrifying sysadmin comment: "YEEEHA!!! What a CRASH!!!"
Terrifying sysadmin comment: "You _do_ have a backup tape?"
Terrifying sysadmin comment: "You did _what_ to the floppy?"
Terrifying sysadmin comment: "You mean you needed that directory?"
Terrifying sysadmin comment: "You've got TECO. What more do you want?"
Terrifying sysadmin comment: "dd if=/dev/null of=/vmunix"
Terrifying sysadmin comment: "don't do that, it'll crash the sys..."
Terrifying sysadmin comment: "You can do this patch with the system up."
Terror : A female Klingon with PMS.
Terror (n). 1: Naked female klingon with whip and PMS.
Terror (n): A Klingon with an accordian
Terror (n): A female Klingon with PMS.
Terror (tehr-er) n. 1. A female Klingon with PMS.
Terror, n: A female Klingon with PMS.
Terror--A Klingon with PMS
Terror: A female Klingon with PMS!
Terror: A female Klingon with PMS.
Terror: A female Klingon with PMS...
Terror: Female Klingon with PMS
Terror: @FN@ with PMS!
Terror: A female Klingon with PMS!
Terror: B'Elanna Torres with PMS.
Terror: Ellison and his continual PMS!
Terror: Encountering a female Klingon with PMS.
Terror: YOU with PMS!
Terrorism - Think Globally, Act Locally
Terrorists, Sam. They've taken over my stomach. They're demanding beer.
Terrorized, adj: A Klingon whose wife has PMS.
Terry Farrell is less of a Trill and more like a thrill!
Tess, it's some cruel law of nature. - Richie Ryan
Tesseract now!
Test Crash-Procedure...RUN [Win'95].
Test Tagline, isn't this too interesting?
Test Test Test Test Test Test Test Test Test Test Test Test Test Test
Test a faith healer, ask for a different shoe size
Test not, lest ye also be tested.
Test subjects? Hey! Sign me up!
Test tube babies get a womb with a view.
Test tube babies get a womb with a view.....
Test tube babies shouldn't throw stones.
Test tube baby: in a glass by itself.
Test your pit bull: give it a lawyer's arm.
Test your pit bull: give it a lawyer.
Test-tube babies shouldn't throw stones.
Test. Test. T E S T !!! Is this thing on????
Test...test.....test....test...test..test.test tes.....
Testators DO IT willingly.
Testators do it willingly.
Tested on dolphins and assorted helpless furry creatures
Tested on small, cute, furry animals with big, sad eyes.
Testes, Testes 123? -Butthead
Testes, Testes. one, two, THREE??!!?!!!?
Testicles - found on an octopus.
Testify 3.0: Clinton's Cabinet: Treasury, Charles Keating.
Testify 3.0: Sexy women are nature's way of saying "keep it up!"
Testify 3.6: Atheist achieving an orgasm: "Oh, random! Oh, chance!"
Testify 3.6: Every time I lose weight, it finds me again
Testify 3.6: Redneck marriage proposal.........YER WHUT!!??????
Testify 3.6: She's so fat, she could sell shade.
Testify 3.6: Statisticians do it with a little deviance.
Testify 3.6: Trading in futures? What about yours in heaven?
Testify 3.6: Where do people in hell tell each other to go?
Testimony 3:6 "I am redunancy of the Borg...Redunancy is..."
Testing 1 2 3. Hey, is this thing on?
Testing One... Fiftythree... fortytwo...
Testing held @ 3 A.M. on the 1st Floor of the *Tagline Court* Bldg.
Testing the Emergency Tagline System is not an easy job!
Testing the emergency ]recipe snaging system. OK.
Testing the emergency ]tagline stealing system. OK.
Testosterone weakens a man's immune system.
Tetris tagline: XX XXX XXXX XXX XXX XXX XXX XXX
Tetsuo! Kinaida! Tetsuo! Kinaida! Tetsuo! Kinaida! Tet...
Teutonic [n] -- Not enough gin.
Teutonic: Not enough gin
Tex Ritter? Pat Buttram? Slim Whitman? Hank Snow? - Frank
Texaco guys! - Mike on security guards
Texan - "Ah got me four Cadillacs...one for each direction."
Texan by choice, American by force!
Texans just do it. She it!
Texans...Rent Oklahoma for picnics and family gatherings.
Texans..Believe that owning more than two Lear jets is pretentious
Texans..Have unlisted area codes, counties and congressmen
Texans..Rate a man by the horsepower of his pickup
Texans..Refer to anyone less than six foot four as "shorty"
Texans..Refuse to recognize the existence of Alaska
Texans..Rent Oklahoma for picnics and family gatherings
Texans..Use New Mexico as a trash dump
Texans: All belong to the NRA.
Texans: Believe that owning more than two Lear jets is pretentious.
Texans: Have unlisted area codes, counties and congressmen.
Texans: Protect their ranches with MX missiles.
Texans: Rate a man by the horsepower of his pickup.
Texans: Refer to anyone less than six foot four as shorty.
Texans: Refuse to recognize the existence of Alaska.
Texans: Rent Oklahoma for picnics and family gatherings.
Texans: Use New Mexico as a trash dump.
Texas -- the land of good-lookin' horses and fast women!
Texas 7-course meal - a bowl of chili and a six-pack
Texas 7-course meal -- a bowl of chili and a six-pack.
Texas Barbecue, if you can taste the meat someone goofed.
Texas Bumper Sticker: Pardon my driving - I'm trying to reload !!!!
Texas DOS: Y'all reckon? [Yup/Naw]
Texas DOS: Y'all Reckon? (Y)ep/(N)ope
Texas DOS: Y'all reckon? [Yup/Naw]
Texas Friendly Spoken Here!
Texas Instruments' TM4000 WinDX cleans Windows very nicely.
Texas Toilet paper, it don't take $hit off anyone.
Texas Toilet paper, it don't take s**t off anyone.
Texas funeral:Administer enema.Bury in matchbox.
Texas is heaven for men and dogs, hell for women and oxen.
Texas math: .357 + .30x.30 + .44 = 0
Texas speed bumps. Assassins do it from behind
Texas toilet paper, it don't take s**t off anyone.
Texas virus: No damage; makes certain it's bigger than any other file.
Texas! hot food, hot weather, and HOT WOMEN!
Texas' Lottery: Finally a tax we can just say NO to.
Texas's 4 seasons: Fall, Winter, Spring, and Hell.
Texas, if you don't like the weather wait ten minutes.
Texas. Where men are men and sheep are scared.
Texas: It is illegal to have a pair of wire cutters in your car.
Texas: It's like a whole 'nother country!
Texas: Where the men are men and the sheep are nervous.
Text Editor: Employee of local newspaper.
Tg Ln Lite - 30% lss chrctrs
TglncmprssdbyDublSpc
TglncmprssdbySStor
Th is t ag li ne i n ja il , Do not steal.
Th vwls n m kbrd dn't wrk vry wll, d thy??
Th!$ TagL!ne Made fRom rEcYcLeD A$c!! chaRacTEr$.
Th!$ TagL!ne maqe fgom gEcYcLeq A$c!! chagacTEg$.
Th' MIND is the Pizza Palace of th' SOUL
Th'omone's a bitch! - Crow lisps
Th--th-th-th-th-that's all, folks.
Th-th-th-h-h-h-at's all folks!
Th-th-th-that's all, folks!
Th-th-th-that's what I think!
Th...th...that's all folks !
Th15 ta9L1n3 Ha5 A v1rU5 - D0nT 5teaL
ThIs TaGlInE WrItTeN WhIlE HiGh On PiXy StIx!!!
ThIs TaGlInE wAs AsSiMiLlAtEd By ThE bOrG.
Th_ most cri__c_l thi__ is n_ver to _____ _______ ___ - Any questions?
Tha's a joke, son, a funny, dontcha geddit?
Thad Cochran, Senator (Miss.), was an Eagle Scout.
Thalassa, Mother of the Enchanters.
Thalia-Healing people & the planet through laughter.
Tham Shrivo - The Innumerable Names Of Tom Servo!
Than an older guy who was born back in 1943!
Thank Congress for the 1st 10 and the 14th !
Thank God Canada Post isn't in charge of E-Mail.
Thank God I am an atheist
Thank God I'm an atheist!
Thank God Microsoft doesn't design medical equipment.
Thank God for Greyhound and Phone Disk.
Thank God for Jay Miner. Otherwise I'd be stuck with a Macintosh.
Thank God for SysOps! But why do they do it?.<---DUMB Question!
Thank God for SysOps! But why do they DO IT?.<---DUMB Question!
Thank God for a Prophet in these latter days!
Thank God it's Friday! (TGIF)
Thank God methane rises - Crow on cows
Thank God or Christ for living, and you live forever!
Thank God that a person can have only one MIL at a time.
Thank God the ship cleans itself! Lt. Davids just left holodeck 2!
Thank God the ship cleans itself, Lt. Bullitt just left holodeck 2!
Thank God the ship cleans itself, Lt. Rawsthorne just left holodeck 2!
Thank God we don't get all the government we pay for!
Thank God we don't get as much government as we pay for.
Thank God! A jump cut - Crow after worker burns to death
Thank God, the ship cleans itself; Lt. Hill just left holodeck 2
Thank Goodness we don't get all the Government we pay for
Thank Heaven for little girls, they keep on getting smaller every day.
Thank Krishna for Indian Vegetarian Cooking
Thank You - Stimpy.
Thank You for *NOT* Projectile Vomiting!
Thank god I'm an atheist!
Thank god for Jay Miner. Otherwise I'd have to buy a Mac.
Thank god for the Gatling gun.
Thank god for the `EFF'.. Last bastion of the resistant
Thank god the ship cleans itself, Lt. Orville just left holodeck 2!
Thank goodness I don't know what I'm missing.
Thank goodness I was able to salvage this girl - Crow
Thank goodness for my electric dress - Crow
Thank goodness for my twit filter.
Thank heaven for little girls, they grow up in such delightful ways.
Thank heaven for little girls. We know who to thank for boys.
Thank heaven you've still got all your marbles. --Rimmer.
Thank heavens my name isn't Smith, Taylor, McCurry, Johnson etc...
Thank the 1st Amendment that this BBS exists.
Thank the 1st Amendment that this echo exists.
Thank the Lord Rush Limbaugh's on the EIB.
Thank the Maker! - C-3PO
Thank the family of a soldier today!
Thank the maker! This oil bath is going to feel SO good!
Thank you Lord for giving me this rewarding job with charming coworkers.
Thank you Mike. Tim Salvo. And, uh, the rest - Dr. F
Thank you Number One....He's my Number One Dad! - JL Picard
Thank you berry much!
Thank you doctor, I feel better already -- Quark
Thank you everybody, we're Nine Inch Nails. -Butthead
Thank you for being gutless - Crow
Thank you for bringing me to the Eel Club festival -Crow
Thank you for calling 911...to report a fire, press 1; to report...
Thank you for coming! I'll see you in Hell! - Apu
Thank you for encouraging my behavior
Thank you for encouraging my behavior.
Thank you for encouraging my behaviour.
Thank you for flying ME airlines - Crow
Thank you for giving me so much to react against.
Thank you for giving me something to react against.
Thank you for holding your breath while I smoke!
Thank you for holding your breath while I smoke.
Thank you for inhaling your exhale.
Thank you for listening to me jabber.
Thank you for making a simple tagline's day so fulfilled.
Thank you for making the last moments of my life socially awkward.
Thank you for not annoying me any more than you do.
Thank you for not being perky.
Thank you for not breathing while I smoke.
Thank you for not mooning your host.
Thank you for not testing your condom in the store.
Thank you for not trying to raise my conciousness.
Thank you for not trying to raise my consciousness
Thank you for not using Windoze in this Conference
Thank you for observing all safety precautions.
Thank you for pressing the self destruct button.
Thank you for pushing the self destruct button.
Thank you for reading my tagline.
Thank you for reading this message!
Thank you for sharing that with us. Now sit down and shut up.
Thank you for sharing. Sharing time is over.
Thank you for that large round of indifference.
Thank you for the opportunity to stick my ASCII in here.
Thank you for the tea, Delenn, and your honesty. - G'Kar
Thank you for the wonderful tag line
Thank you for the wonderful tagline.
Thank you for turning a simple chat into a bizarre ritual
Thank you for turning a simple meal into a bizzare ritual
Thank you for using FidoNet. Please allow 6-8 weeks for a reply.
Thank you for using Fidonet. Please allow 6-8 weeks for reply.
Thank you for visiting Florida. Now go home.
Thank you for your anticipated responses!
Thank you for your co-operation." -- Robocop
Thank you for your gracious contribution to my tagline collection.
Thank you for your help!
Thank you for your time and attention
Thank you for your time. Now, get a life!
Thank you kindly! I will definitely let you know what turns up.
Thank you thank you thank you...
Thank you very little.
Thank you very much! - The Mask
Thank you very much.
Thank you! *NO* applause - just sex
Thank you! Thank you, Franky! Folks at home! - Dr. F
Thank you! You love me! You really love me! - The Mask
Thank you, @FN@.
Thank you, Crow T. Gutherie - Joel
Thank you, Dragon Bitch - Tom on evil woman character
Thank you, Feces - Crow to Greek character
Thank you, Franky - Dr. Forrester
Thank you, God. Keep it up!!!
Thank you, God. Keep it up!!!
Thank you, Hillary!
Thank you, Mr. Moderator. I'll take it under advisement
Thank you, Mr. Utley - Tom to Joel
Thank you, Ms. Dedicated Scientist!
Thank you, NO applause, just sex.
Thank you, Sir. I comprehend. -E computer dissing Data
Thank you, Vampira - Tom to newslady with too much makeup
Thank you, YOU.
Thank you, and f*ck you. - Leary
Thank you, but...this is not...I don't...aw, hell.-Ivanova
Thank you, come again. - Apu
Thank you, drive through. -Beavis
Thank you, duck, for gettin' down!
Thank you, ferret face - Tom on cheesy gibbon makeup
Thank you, it said, for making a simple door very happy.
Thank you, thank you, thank you and f*ck you. - Leary
Thank you, token - Crow on only ethnic character
Thank you. Everybody not going to Earth had better get off...
Thank you. Alexander will not repeat this mistake. -- Worf.
Thank you. Alexander will not repeat this mistake.- Worf.
Thank you. Pixel, The cat you don't have to let out.
Thank your sysop for netmail by not using quote boxes
Thank-you for calling 911, our office hours are from...
Thank-you for calling 911, your call is important to us, at the beep..
Thanking the Maker
Thanks #AN# for replying to my message.
Thanks Cal, for replying to my message.
Thanks DM. I thought having two arms wasn't challenging enough.
Thanks Doug!
Thanks He for replying to my message.
Thanks Man! - Ren.
Thanks Michael, for replying to my message.
Thanks Steven, for replying to my message.
Thanks Todd!
Thanks a bunch!!!!! You truly made today Christmas in July!
Thanks a lot! -Mac-
Thanks a meg!
Thanks again!
Thanks alot! and Thanks to those that have helped me before.
Thanks anyway, it's the Thought that counts <G>.
Thanks be unto God for his unspeakable gift. (2 Cor 9:15)
Thanks but no. We don't need sysop.
Thanks for Visiting. Now Go Home. -- Florida State Motto
Thanks for all you do as Sysop to make the net a good one.
Thanks for another Tagline.
Thanks for any light you can shed on any of the above.
Thanks for calling 911, our office hours are from...
Thanks for calling and not Reversing the charges - Skroob
Thanks for dialing 911. To report a problem hit #1. To report.......
Thanks for following up on this for me!
Thanks for for dialing 911; our office hours are.....
Thanks for giving me the courage to eat all those ants.
Thanks for letting me butt in! Thanks in advance!
Thanks for making my night, Suney...< again >...:) - TEC
Thanks for not breathing while I'm smoking!
Thanks for not smoking, Tom breathed.
Thanks for not smoking, she breathed.
Thanks for shredding the cheese, Tom said gratefully.
Thanks for that backrub - Tom to Crow in hot tub
Thanks for the Recipes, Patrick. I really liked 'em.
Thanks for the Taglines, David. I really liked 'em.
Thanks for the Taglines, Orville. I really liked 'em.
Thanks for the Taglines, Patrick. I really liked 'em.
Thanks for the aside - Tom on villain's soliloquy
Thanks for the concern- TEC
Thanks for the concern...
Thanks for the hugs, they were well received. :-{ )
Thanks for the mammaries -Beavis
Thanks for the noise filt............ NO CARRIER
Thanks for the nose-news neighbor! - Ned Flanders
Thanks for the radio! Tom said with a short wave.
Thanks for the tagline, Dave..now put Windows away Dave
Thanks for the tagline. :-)
Thanks for the taglines. *Loved* that one.
Thanks for the tip, though....Where is Mat Dillon on this continent?
Thanks for watchin' my back old chum!
Thanks for your help last time.
Thanks for your support. - Rimmer
Thanks for your tagline list,
Thanks honey, cardboard and chocolate sauce again!
Thanks in advance for anything that you can pass on.
Thanks so much. I am having fun with this one!
Thanks to AOL users, I don't need to buy floppy disks.
Thanks to AOL, I don't need to buy disks. *]:-)
Thanks to AOL, I no longer need to buy disks.
Thanks to Clinton Even the Dead pay taxes (and they aren't Grateful).
Thanks to Clinton even the Dead pay taxes (and they aren't Grateful).
Thanks to Freddie, I'm a Sexual Spastic. --Zappa.
Thanks to Slick Willie, I'm so poor, I can't even pay attention!
Thanks to all the Sysops who made this message possible.
Thanks to all the Sysops who make this possible.
Thanks to the pioneers, there are too many pathways.
Thanks to working women, thousands of men...have learned to vacuum.
Thanks very Much! I knew I could count on you to be of assistance!
Thanks! -Mac-
Thanks! Now I know a *LOT* more now than I did.
Thanks, I have a good one. What I need is a longer one.
Thanks, Pete! Thanks, Paul! 'Pizza & Pasta' - Dr. Erhardt
Thanks, SYSOPs
Thanks, SYSOPs!!!
Thanks, Slann. We know the rules. - Connor MacLeod
Thanks, but I know very little about how it is run.
Thanks, doll face - Crow to Gypsy
Thanks, for the memories ... psssst ... got another 100K?
Thanks, now I'm barren - Crow as dog gets caught in fence
Thanks. I always thought having two arms wasn't challenging enough.
Thanks. For what you did. - Londo
Thanks. I always thought having two arms wasn't challenging enough.
Thanks. You're like the drunken, abusive father I never had
Thanks.. it makes it easier for me to bury you now.. =) -Durkin
Thanks...for the memories...
Thanksgiving at the Bobbitts - Lorena preparing to carve a turkey.
Thanksto the Crew of the Enterprise NCC 1701-D, for a 7-year Trek.
Thankyouthankyouthankyouthankyouthankyouthankyouthankyou!!!!!!!!!!!
Thankyouverymuch! <making a curtsy>
Thanx for the answer tho! Learn something new every day!
Thanx for the compliment!
Thanx for your idea's, Somewhere their is an answer!
Thanx to The Young and the Restless, I failed college!
Thanx, Here are a few more,
Thar's Mobius Dick, the convoluted whale.
That "Light at the end of the tunnel" may well be a dragon's fireball.
That "bug" took me two weeks of hard work to implement...
That 'hurry up' part was pure genious - Mike
That @FN@. Just gotta love him, eh?
That Ain't My Wife. ......She's My Sysop
That Amazon queen wanted me for only one thing, said Tom studiously.
That Barney Rubble. What an actor!
That Cardassian is firing at a Bajoran scout ship in Bajoran space!
That Clinton guy is on TV again!
That Death Star's causing some harm, big time! --Lando.
That Electric Chair business really burns me up.
That HAD to sting! - Tom
That I lived, that I loved, that my flesh was warm-Pandora-
That ILink Net goes down more often than a $2 whore.
That IS your arm, isn't it? - Tom as blind man
That Must Be Wonderful! I Don't Understand It At All!
That One-eyed cat's not coming in, It's going out
That Orville. Just gotta' love 'im, eh?
That Picard never had a brush with death. --Q.
That Rabbit's got a vicious streak a mile wide!
That Seth Able is sure a moody little fella ;>
That Should do it. Look around on Trek File Distribution Netword BBSs.
That WAS a tough divorce settlement, wasn't it? :-*
That Was Nice, But Will Someone GET THIS BIG FAT OAF OFF MY BACK - Ren
That Woof fellow. Just plain rude. - Lwaxana
That XEROX is always copying everybody else's ideas...
That YOU. Just gotta love him, eh?
That a BlueWave packet in your pocket or are you just glad to see me?
That about right, Zorch?
That action injured you and saved me. I will not forget it. --Data.
That ain' workin'-That's the way y'do it-money for nothin.
That ain't Dusty Rhodes; In TX the pigs walk on two legs!
That ain't no pet...that's my roomate...yeah, that's the ticket...
That ain't so good English!
That all depends-on what `yo packin...Regular or KING-SIZED!
That and 95 cents will get me a cup of coffee.
That answer was incorrect. The penalty is death. - Butthead
That appropriately tension-filled incidental music - Crow
That area has been sealed since Babylon 5 went online. - Ivanova
That babbling brook just never did learn to keep quiet.
That ball was close. Close hell, look at this knot!!
That ball was right over the plate, Tom said strikingly.
That bird in the hand makes for a messy grip.
That bird is sick, Tom said illegally.
That bird's a turkey, Tom gobbled.
That bitch! I'm the hostage! - Crow as woman
That blast came from the Death Star! That thing's operational! - Lando
That blast came from the Death Star! That thing's operational!
That blonde has a Teflon brain: Nothing sticks to it.
That book is called "Vendetta" by Peter David.
That book sucked so hard it gave me a hickey.
That boy is just a few fries short of a Happy Meal.
That boy's about as sharp as a pound of wet liver - Foghorn Leghorn
That boy's about as sharp as a pumpkin. : F. Leghorn
That boy's so horny even the crack of Dawn ain't safe!
That bra's about as sexy as a concret embuttment - Mike
That bull has real stage presence, said Tom oratorically.
That burned down, fell over, THEN sank into the swamp.
That can be arranged! - Han
That can't be Scientology... there's no form in it to become a member...
That can't be pornography! I don't even own a pornograph!!
That cast sort of a dim shadow over the evening - Tom
That cat's something I can't explain.
That certainly sucked the air outta' the room - Mike
That city will NEVER be rebuilt, the prophets babble on.
That comic book ad PROMISED these "X-Ray" things worked!
That comic book add PROMISED these "X-Ray" things worked!
That concept looks like a chicken in a windstorm.
That creature has stolen the Aludium Q-36 Explosive Space Demodulator!
That creature has stolen the Aludium Q-36 Explosive Space Modulator!
That damn Cardassian is firing at a Bajoran scout ship in Bajoran space!
That darn bicycle tried to kill me! - Calvin
That deaf, dumb and blind kid sure plays a mean pinball.
That decision is not yours to make, Cadet! - Picard
That does it. I'm introducing you to my mother. Troi
That does it. I'm introducing you to my hedgehog. Troi
That does it. I'm introducing you to my llama. Troi
That does it. I'm introducing you to my mother. Troi
That does not compute.
That doesn't help me at all, but I apprecate the thought.
That doesn't sound like much of a deal. - Shai-ster
That dog has somebody's ham! This I gotta see! - Homer
That dog's dead! !@#$**%$* NO TERRIER
That donut was awful. Where's my dog's rubber chew-ring?
That door wasn't trapped the last time we were here.
That doughnut was awful. Where's my dog's rubber chew ring?
That dragon was going 100 mph. Hold on...there be wind-whack for sure!
That dragon's a wuss...a wimp...behind me, isnt he?
That dress makes Jack look 'hippy' - Mike
That dress would look good on the floor beside my bed.
That ees some eee-kee tasting stuff! - Ren Hoek
That evening, when Sharie went to bed, she was unable to sleep.
That explains everything but your inability to coherently express yourse
That explains this device, then. - Sheridan
That feels ... so gooo... OOOHHH, Gawd!, Tom ejaculated. <= Bad? Crude!
That feels ... so gooo... OOOHHH, Gawd!, Tom ejaculated. -Gary Caplan
That feels ... so gooo... OOOHHH, Gawd!, Tom ejaculated.
That feels soooo...ooo...ah..gawd! Tom ejaculated.
That felt good.
That film looks at me when I am naked and calls its friends.
That film was flawed in certain ways - Crow
That formality sounds kinda funny coming from a Yakko :-)
That frozen concoction that helps me hang on
That girl's gonna be the death of me.
That gives me a birdie for this hole, Tom chipped in.
That goes beyond the limits of good taste...
That government is best which governs least.
That great dust heap called 'history'" -- Birrel
That gum you like is going to come back in style.
That guy Ibid, he thinks he knows everything!
That guy Ibid, he thinks he knows everything.
That guy looks like a cross between Spock & Bones - Mike
That guy looks like he swallowed a junkyard. - Trapper
That guy raises Dead End Kids - Mike
That guy's 'Big Boy'! - Mike
That guy's 7th year in an unpaid internship - Crow
That guy's a sinner. They're all sinners! - Mike
That guy's got a real Scot Thorston quality - Mike
That guy's magnetic - Joel as guy moves pen w/his mind
That guy's pretty much beef jerky - Tom on burn victim
That guy's trashed - Crow on guy in garbage can
That guys one of the best lookers-on in the business-Crow
That hair's gonna mop up a lotta water-Joel as girl swims
That hairball might be from Schroedinger's cat.
That horse has a Beatle's wig - Mike
That horse looks like Stallone - Crow
That horse looks like a good bet at 75 to 3, said Tom oddly.
That horse should have died, or better yet, been lunch...
That horse's got Air Jordans on! - Joel as horse jumps
That hypocrite standing between you & God is closer!
That illegal turn is going to cost you $20, said the policeman finally.
That irony is all the justice I require. - Londo
That is ONE Irish catholic family - Crow on Mongol horde
That is a full time job entering this data.
That is a rule up with which I shall not put. -- Churchill
That is a two part question ...
That is a woman's game -- Worf
That is correct! Lets move on to the lightning round-Tom
That is every other one but the one needed.
That is great. I am using that as a recipe.
That is great. I am using that as a tagline.
That is hardly likely.
That is impossible. My timing is digital -- Data
That is my companion. It is not intended as a tip.
That is my ear.
That is my impression, anyway...
That is my transportation. It is not intended as a food.
That is no country for old men
That is not a Borg identification, you are now 3 of 32 billion.
That is not a weaknessthat is life - Picard
That is not an option, Mr. Mulder. --Deep Throat.
That is not dead which can eternal lie.
That is not demonstrable.
That is not what room service means on Earth.
That is ok for amateur uses, but not for commercial or BBS uses.
That is ok for amateur uses, but not for commercial or reliable uses.
That is ridiculous.
That is so amazingly amazing I think I'd like to steal it. - ZB
That is so amazingly amazing I think I'd like to steal it. - Zaphod
That is some outfit. It makes you look like a homosexual.(McBain)
That is tagline is TRUE *> <* That tagline is FALSE
That is the exact question that I would like to know.
That is the kind of arrant pedantry up with which I will not put!
That is the quick and dirty way.
That is the total and absolute generalization...well, almost...
That is the worst chunka'crap monster I've ever seen -Tom
That is weird, do we have a "Rod Serling BBS" in the net somewhere?
That is what I'd call a dead parrot!
That is what Netmail is for, after all.
That is why I am your King!
That is why Kosh cannot leave his encounter suit. --Delenn.
That is why my phone bill was $978.37! My wife is BBS hunting again!
That is why the lady is a champ - Tom sings
That is, IF you can think of 50 tag lines
That is, IF you can think of 50 tag lines....
That isn't very reassuring. -C3PO
That just doesn't add up, said Tom, nonplussed.
That keyboard may have a lack of intelligence at the other end.
That kidney you donated to me really hit the spot. - Burns to Smithers
That kind of talk tightens my colon. - Frank Burns
That lightning sounds clos\#)!&^#~%##% NO CARRIER
That little bitch! - Tom after girl turns into a dog
That little droid and I have been through a lot together. - Luke
That little minx! - Joel on leading lady
That little waltz may have just cost you your life--Vinnie.
That looks like something I sifted out of the litter box!
That looks sharp! You wouldn't cut me would you? - Kearne
That makes a woman happy? Mail packets & Chocolate!
That makes a woman happy? Mail packets and Chocolate!
That makes marriage the leading cause of divorce <g>!
That makes marriage the leading cause of divorce!
That makes me yearn for a $5 hotdog! - Mike on airport
That makes my stomach woozy - Crow on bubbling apparatus
That man is a Politician - set Phasers to KILL!
That man is richest whose pleasures are cheapest.
That man is richest whose pleasures are the cheapest. - Thoreau
That man is scum! ..Then call me Mrs. Scum!
That man's silence is wonderful to listen to. - Thomas Hardy
That may be the first time any man has dared insult me.
That may cause my violin strings to snap, was Tom's gut reaction.
That medium did a bad job, Tom said disspiritedly.
That message had all the subtlety of the ear scene from RESERVOIR DOGS
That message sucked so hard it gave me a hickey.
That message ticked me off as well.
That milk is going to be awfully chocolatey.
That movie was very stupid... take it from an optimist like me.
That music is kinda nice - my compliments to the clef.
That must be wonderful! I don't understand it at all.
That must be wonderful! I don't understand it at all.
That must be wonderful, I have no idea what it means.
That must be wonderful. I don't understand it at all.
That must have cost you a fortune in stamps, Ring.
That name no longer has any meaning to us.
That nerdy Bill Gates is a Romulan spy.
That no cookie! - Short Round
That no flesh should glory in his presence. (1CO 1:29)
That noise you just heard was Betty Crocker rolling over in her grave.
That nutty moon maiden - Joel on alien girl
That old Velveeta really sticks like glue!
That olive stuck its pimento out at me!
That one I gotta write down. - Trapper (and tagline writers <G>)
That one hit hard - Joel on Crow's cutdown
That one. She's not afraid of silence-Crow on voodoo girl
That only puts another dollar in the bank of permissiveness. - Frank
That oughta keep the little squirts happy. YES! - Brain
That parrot is definitely deceased
That parrot's not dead, he's pining for the fjords!
That penny pincher wants to be addressed formally, Tom surmised.
That person is a couple of tapes short of a full backup...
That polyester suit is gonna go up in a blaze - Tom
That poor guy doesn't have a fighting partner! - Mike
That profession is illegal here. Supposedly.
That provided much needed comic relief - Mike
That rabbit's got a vicious streak a mile long!
That race was all about competition
That really wasn't very nice. Hardly sporting. - Ward
That recipe is TRUE -> <- That recipe is FALSE.
That restaurant is so crowded, nobody goes there anymore.
That robot's wearing a fig leaf! - Crow on apron
That rodent's go' a viscious streak a mile wide!
That says it all.
That scene was a load of crap! - Crow
That secret you've been guarding, isn't.
That self-righteous do-gooder! - Q
That shoe fits him like a glove.
That should clear out your sinuses.
That should give you a rough idea, anyways.
That should keep the invisible recipes turned on.
That should keep the invisible taglines turned on.
That should please those little S.o.b.s - Gabbo
That sign really seduces you into buying a burger - Mike
That smells like a skunk, Tom said instinctively.
That soldier of fortune is a man called Paladin!
That sounded better before I said it.
That sounded like Laura leaping to her death. --Joel Hodgson.
That sounds GOOD to me!!
That sounds like Steve taking a slug from a .30-06 - Crow
That sounds like a cause of death, not a 'condition'! - Ragnell
That speal had a point, but I forgot what it was.
That spear looks VERY nasty, Tom said pointedly.
That spot on Gorbachev's head? Herpes! Trust me! - Krusty
That square bugs me! He really bugs me! - Joel as biker
That star is Canopus, said Tom outlandishly.
That stump throwing sonova'bitch - Crow as Mongol
That stupid Tears Routine doesn't work on me! NYEAH!
That stupid squarehead - Crow
That summer wind was all around me.
That tag line is TRUE -> <- That tag line is FALSE
That tagline is TRUE -> "x" <- That tagline is FALSE.
That tagline is TRUE -> <- That tagline is FALSE
That tagline is true ---< <--- That tagline is false
That tavern's ale is a *great* Molotov cocktail.
That that is is not that that is not.
That thing CUT me! Ooooooooh! - Crow
That thing on the sidewalk wasn't a tootsie roll afterall!
That thing you ate only *looked* like a Snickers bar.
That thing's no more alive than I am! -- Crow
That thing's operational...Pull up!...
That threw cold water on everything - Tom on crossbow
That time has come, and not that time has gone.
That touches my huge heart - Mike as fat Russian
That unit is a woman.
That used to be my favorite song, until just now.
That user posesses corbomite devices, flame at your own risk.
That wall there? Holy cats! - Dr. Forrester
That was *just* good enough that I'll probably let you live. - JMS
That was *not* manual override. -- Data
That was GREAT! Now go get me cold beer and a cigarette.
That was NOT cool. - Butthead
That was NOT manual override! - Data.
That was ZEN -- this is TAO
That was Zen, this is Tao.
That was Zen. This is Tao.
That was Zen. This is Tao. -- Peter da Silva
That was Zen; this is Tao.
That was _not_ manual override-Data
That was a GOOD CRAP! - Mike as tough lady enters
That was a GREAT scene - Mike sarcastically
That was a HOOT!
That was a Pinto! - Joel on burning car
That was a close one!
That was a dirty trick, Pierce. - Col. Blake
That was a fascinating period of time for electronics.
That was a favor I did you?
That was a filthy crack. Speaking of filthy cracks, how's your mother?
That was a fine novel.
That was a great message. Mind if I make a recipe out of it?
That was a great message. Mind if I make a tagline out of it?
That was a helluva' meat loaf! - Mike
That was a joke . Steph wasn't that a joke or did I lie again?
That was a message? I thought it was modem noise.
That was a pointing device? My cat thought it was dinner.
That was a pointing device? Sorry, my cat thought it was dinner!
That was a pointing device? My cat thought it was dinner.
That was a river, this is the ocean.
That was a stitch! - Dr. Forrester laughs
That was a very ugly thing you just said -- Keiko
That was a wonderful date, Tom said in Dutch.
That was an especially good one.
That was an interesting program. - Troi to Worf
That was an interesting trick. Can you do it again?
That was before my hedgehog accident, but I'm feeling MUCH better now.
That was beyond the limits of good taste. - Beavis
That was cool! huh huh huh
That was deep. Dot, Animaniacs
That was definately the LAST bug, take my word for it.
That was definitely the LAST bug!
That was definitely the LAST bug, take my word for it.
That was easy, can we have another test daddy???
That was fast! Tom quickly exclaimed.
That was first-degree toastercide! - Talkie Toaster
That was going to be my question - Troi
That was good, but. @@@@@@@hhh, I wanna do it again! - Yakko
That was gratuitous! - Tom as guy gets whipped
That was great. I've never been handled like that - Crow
That was interesting. Not at all insulting - Mike
That was me! Thanx a lot! B-) Uhhhh, do you got any Sysop Taglines?
That was more than your job. You enjoyed it. - Picard
That was my dad. - Garibaldi So much for genetics. - Franklin
That was my good friend, Mr. Garibaldi - Londo
That was my virgin alarm. Its programed to go off before you do!
That was nice..... Let's do it more often....
That was no jump. We've been hit. - Sheridan
That was no laser blast! Something hit us. - Han Solo
That was not a luxery that I was afforded. - Richard Franklin
That was not a luxury that I was afforded. --Richard Franklin.
That was not my first choice. -Brain
That was number TWO!!! - Crow
That was one high colonic! - Tom as hero
That was one unstable octopus!
That was one weird-assed movie - Tom
That was really uncalled for, Senator Bullitt.
That was really uncalled for, Senator Orville.
That was setting #1. Anyone want to see setting #2? -- Guinan
That was so fast, can you show me one more time? Troi
That was so funny, I laughed 'til I stopped.
That was so funny, I laughed 'till I stopped.
That was so good even the neighbours lit cigarettes...
That was tasteless, vulger and discusting...got any more???
That was the Joker! I cussed out the Joker!!!
That was the WORST tasting jello I ever had...Odo? Odo?!
That was the beer that made Mel Faymee walk us!
That was the day my dead pet returned to save my life.
That was the incredible action sequence - Tom on dullness
That was the inspiration for "Ren & Stimpy."
That was the mission where James Kirk was killed. -Riker
That was the most cruelest, evilest thing you've ever done to me! -Alyx
That was the stun setting. *bleep* This is not. - Data
That was then and this is NOW!
That was then, this is now.
That was totally convincing, wasn't it? - Kryten
That was very therapeutic. - Brain
That was vivid wasn't it children?
That was zen. This is now.
That was, I said, that was a JOKE son! - F. Leghorn
That was, as I'm sure you realized, only elf funny.
That wasn't Fudge! That was the Dogs...
That wasn't a vote for Clinton - it was a vote for Socks!
That wasn't funny, dumbass!
That wasn't me. My farts smell like candy!
That wasn't my typo, the keyboard went Devorak on me.
That wasn't telepathy, that was common sense.
That wasn't telepathy, that was just common sense ...
That we can go through life without offending anyone is offensive!
That we don't have a caffeine-making gland, proves there is no God.
That went well. - Yakko
That which can be imagined can also actually be reality.
That which cannot be taken apart will fall apart.
That which does not destroy me makes me stronger.Nietzche
That which does not destroy, strengthens. - Nietzsche
That which does not kill me better make damn sure I don't get back up!
That which does not kill me better run away damn fast!
That which does not kill me does not kill me.
That which does not kill me had better not let me up!
That which does not kill me had better run away damn fast!
That which does not kill me had better run away damn fast.
That which does not kill me had better run away very fast
That which does not kill me has but seconds to live.
That which does not kill me is dead when I'm through with it - Rich A.
That which does not kill me is dead when I'm through with it.
That which does not kill me, better be able to run DAMN fast.
That which does not kill me, does not kill me. <Whew!>
That which does not kill me, only makes me stronger. - Nietzche
That which does not kill me...probably missed!
That which does not kill us had better watch its back!
That which does not kill us makes us stronger.
That which does not kill us took its ball and went home.
That which does not kill us..will be darn funny some day.
That which doesn't kill me had better run away damn fast.
That which doesn't kill you serves to make you stronger...
That which is done before the naked stars is remembered.
That which is most beautiful...is often evil in disguise.
That which is most common is most often the most obscure!
That which maybe done only at a loss is not allowed to be done.
That which you haven't achieved can hardly be called your own.
That white smoke is starting to piss me off! -Butthead
That will *probably* take care of the problem..
That will become clear very shortly -- Sela
That will do it. Borg Moderator: Your Topic Is Irrelevant
That will really help the centuries fly by. - Rimmer
That will teach exactly what to whom?
That without substance can enter where there is no room-Tao Te Ching
That wizard did a bad job, Tom said disenchantedly.
That word, I don't think it means what you think it means.
That worked! - Duncan MacLeod
That would be a specialty bread - Crow
That would be inconceivable.
That would be inconvenient.....but acceptable.
That would have worked if the rubber band hadn't broke!
That would have worked if you hadn't stopped me.
That would have worked, if the rubber band hadn't broken.
That would just stunt our development - Crow to Mike
That would make an excellent mini-golf course.
That wuz cool, There is none higher. Ennhh Ehhnnn Uhh Huhh Huhhh...
That young insect is female, said Tom gallantly.
That young insect is male, said Tom buoyantly.
That your leg? - Crow after guy fell onto another guy
That'll be $67.50 CCCHHHHHIIIIINNNNGGGG!!!!
That'll be enough of that! - Dot
That'll be the day when -OINK OINK FLAP FLAP- Well I'll be darn...
That'll put a kink in his colon! - Col. Potter
That'll teach you to play with your nibs! - Mutant Raccoon
That's "It's time for another Good Idea/Bad Idea!"
That's $4.99 please pull ahead! - Frank to Dr. Forrester
That's 'G-R-A-T-E Expectations,' also by Edmund Wells.
That's *MISTER* Cthulhu to you, buddy!
That's -*Mister*- Idiot, to you!
That's 2 minutes in the penalty box for clipping. -- Rita
That's Absolutely Correct, Stupid! - Ren.
That's Adolph Hitler! He was the leader of the runner up in WWII.
That's Adolph Hitler--leader of the runner up in WWII. --Rimmer.
That's Australian for BBS, mate.
That's Bond, James Bond, double-oh-seven..
That's Captain Q to you! -- Q
That's Clara's wrestling name - Mike
That's DEEP!
That's Gravy?! I Thought The Dog Had Gotten Sick! --Tom.
That's Gypsy. She's in Financial - Joel
That's Homer Simpson, one of the carbon blobs in sector 7G- Smithers
That's Homer Simpson, sir. He's a drone in Sector 7-G.
That's It Ren!, We Broke It Too Many Times - Stimpy.
That's It!!!! ARM THE ELECTRONIC BAGPIPES!
That's It, Poles Up, You Just Scared Away, All The Fish!!! - Ren.
That's MISTER Faggot to you, mate!
That's MISTRESS Uhura, slave kirk. YOU open the hailing frequencies!
That's MR. Almighty to you!
That's MR. Banana Beak to you! - Zazu
That's Martinus, if I wanted two, I'd ask for them.
That's Mick Jagger's cloud. Stay off it - Tom on Heaven
That's Mister Idiot to you!
That's Ms. Bitch to you!
That's NOT funny, Adam! Beam up the clothes TOO!!
That's NOT our system. <Ripley>
That's OK. We just wanted the oil. - Yakko
That's PervERT until I see your money. - Frumple
That's Right Jump For Daddy - Victor's Dad.
That's Sergeant Big Butt To You! - Big Butt.
That's Val-dos-ta, *not* Val-dough-sta.
That's WOMAN School - Crow on credit "Girlschool"
That's Whitewater investigation Janet, not white wash.
That's Why God Invented Grenade Launchers!
That's Why I Just Fixed Up This Nice Big Pail Of Chum. - Ren.
That's a Human? (Chrysta) Yes, yes! Catch it! Kill it! Cage it!
That's a Jiffy Pop hat - Crow on Palance's odd hat
That's a Mr. Burger Buster Bomb - Joel
That's a Satanic lie: The Bible was written in English. - R. Stokes
That's a TagLine son. You're suppos--I say, you're supposed to laugh.
That's a bit like using an elephant gun to kill a housefly. - Jean
That's a certain way to get ripped off.
That's a chain reaction, Tom said atomically.
That's a cocktail waitress with a Dolly Parton wig.
That's a common language on micros, said Tom basically.
That's a dilly of a pickle! - Ned Flanders
That's a dragonfly, dear. But Mommy, what's he draggin'?
That's a good idea, Jim, but syrup won't stop 'em.
That's a good way to go - Crow as girl leg-scissors guy
That's a great answer, now what was my question again?
That's a great answer. What was my question again?
That's a great answer...what was the question again?
That's a great idea! Why didn't I think of that?
That's a head? I thought it was a watermellon.
That's a heck of a right you've got. Hades to --Hercules
That's a keyboard!? Well no wonder my programs look like sheet music!
That's a leap into the stupidity abyss that I won't be making.
That's a lie! Tom said in falsetto.
That's a lie! said Tom in falsetto.
That's a lie. - Bester Yes it is. What's your point? - Jeff
That's a little simplistic, don't you think?
That's a lizard from pet world! - Tom on cheesy dinosaur
That's a long sentence & you're probably tired - Frank
That's a lot more mature than I think I care to be. - Calvin
That's a nice dress - could I talk you out of it?
That's a pretty smile... When do I get to see the real you?
That's a rather tander subject... Another slice anyone? - Frank
That's a sensitive spot there! - Frank w/dino in pants
That's a smug aura of respectability you see in a mirror?
That's a strange expression, Bruce.
That's a tagline, son - you're supposed to laugh.
That's a tagline, son. You're suppos--I say, you're supposed to laugh.
That's a terrible thing to do to a cute little gerbil!!
That's a very Russian attitude....I commend you. - Ivanova
That's a very large shark, said Tom superficially.
That's a very vaginal response!
That's a weird hat - Crow on girls odd hairdo
That's about all there is to it :-).
That's about as funny as a beer-fart in a space suit!
That's about as serious as I get! <grin>
That's about as serious as I get! <grin<
That's about as useful as a chocolate teapot.
That's about as useful as an ashtray on a motorcycle.
That's about the sum of it.
That's absolutely disgusting....Do it again, quick!
That's all Folks
That's all I have to say about that....
That's all I've become to you: a pair of dirty hands. Laurence Olivier
That's all for Annoying Music Night - Crow
That's all right, dear. Just eat around the tire marks.
That's all we needed... a Druish princess!
That's all you need; if you are a damned fool. - Beverly
That's all. See you later - Gypsy writes Adam West
That's all? Thanks? - Londo
That's allright I know your sister too.
That's alright. I'd like to keep it on manual control for awhile.
That's an assortment of "dad" bodies -Mike on flabby guys
That's an interesting stain. How'd it get there? - Tom
That's an odd nativity scene - Mike on people w/dead guy
That's an onion in the ointment.. - Grampa
That's an original spur of the moment tagline!
That's as high as we go for this particular garage. - Yakko
That's as may be, it's *still* a frog.
That's as maybe, it's still a frog!
That's as well said, as if I had said it my self.
That's because I'm dead. Dead as a can of spam.-Rimmer
That's because your favorite charity is your own pocket. -- Odo
That's called the 'Crappie' - Tom as girl flops on mat
That's core for the parse.
That's dating in the 90s. The EIGHTEEN 90s! Haha! - Mike
That's disgusting, but funny.
That's easy for him to say!
That's easy. I'd kill him. Think about it. - Aahz
That's enough Data
That's enough for now...... be careful.... there WILL be more. <g>
That's enough procedures for one day.
That's enough, Data!
That's entertainment! - Vlad the Impaler
That's fine in practice, but it'll never work in theory.
That's fine in practice, it'll never work in theory.
That's fine officer, but can I see your badge please?
That's funny ... I don't remember seeing *you* here before!
That's funny `Ho-Ho.' I want funny `Ha-Ha.'
That's funny coming from a spasmodic fractulator - Crow
That's funny, I didn't think I was edible.. :) -Dire Wolf
That's funny, I'm usually handcuffed by this point
That's funny, the damage doesn't look as bad from out here.
That's funny, you don't LOOK Druish....
That's gotta hurt! -- The Mask
That's happened to me often enough when using TagX <g>.
That's highly illogical, Captain. They'll just steal the taglines.
That's his Star Trek fan club bolo tie - Tom
That's his job. He's head fink. - Trapper, on Frank
That's how bold the stuff is, you little priss-ant! -Crow
That's how they play the game, isn't it?
That's how we get out We're buying this place -- Riker
That's how whitey keeps us down! - Mike
That's impossible, even for Bob!
That's impossible, even for a computer. - Wedge
That's impossible, even for you!
That's inches away from being millimeter perfect.
That's inches away from being millimetre perfect.
That's it baby. When you got it, flaunt it. >Mel Brooks
That's it for now.......M.C.McCurry
That's it for today.
That's it! ARM THE ELECTRONIC BAGPIPES!
That's it! I'm gonna be a monk - Crow T. Robot as couple kisses
That's it! I'm gonna be a monk - Crow as couple kisses
That's it, I'm outta here! - Homer's brain
That's it, baby, work those ankels! - Monty Burns
That's it, keep reading just a little longer...
That's it, keep rubbing salt in the wound.. :) - Digital Shakespeare
That's it, little boy! - Crow yells at Tom
That's it, man. Game over.
That's it, we're deader than platform shoes. - The Cat
That's it. Check your ticket stubs. We're all going to Hell.
That's just a book of carpet samples! Oooh..fuzzy!
That's just a fluke. Holy mackeral!
That's just dandy, Radar. - Col. Henry Blake
That's just my day job. I'm really a leprachaun.
That's just my humble opinion. Actual user opinion _may_ vary.
That's just my opinion, I could be wrong.
That's just what I was thinking. - Col. Henry Blake
That's just what I'd expect a dupe of the Conspiracy to say!
That's just what we call pillow talk Baby. --Ash.
That's just what we call pillow talk, baby.
That's kinky! - Crow as guy straddles water melon
That's me alright. Roadkill on the Information Superhighway.
That's me before Slimfast - Crow
That's me in Slo-mo! - The Cat
That's me on the harddrive, losing my partition.
That's me with Cthulhu. That's me...AAARRGHHHH!!
That's me with Cthulhu. That's me... AARRGGHH!
That's me. *OOF* The human slinky. - Calvin
That's mine and that's mine and that's mine--The Cat.
That's my Jerry hair! - Crow as Mike takes his wig off
That's my baby in the White Boots.
That's my cat, Quark. Isn't he charming?
That's my girl, my whole world, but that ain't my truck
That's my gold mine! Tom claimed.
That's my job, young man. - Picard
That's my job... thinking up goofy sh*t. - G. Carlin
That's my mother. Well, everything's gotta go - Crow
That's my political humor. People like it when you're topical. -Carlin
That's my story and I'm stickin' to it!
That's my story and I'm sticking to it.
That's my story and i'm stickin to it
That's my story, and I'm sticking to it!
That's never stopped me before! :)
That's nice. You show up and all the gorillas run inside.
That's no Dilithium Crystals Capt'n that's ice .....
That's no Internet Email address,....that's Odo!
That's no Tagline! ... It's All carryin' on again!
That's no Tagline! ... It's Gary Caplan carryin' on again!
That's no Tagline! It's Odo!
That's no alien, that's my mother!
That's no beagle, it's a mongrel, Tom muttered. -Roy Bongartz
That's no moon! It's a space station! No..Wait.. Geez! It's Uncle Vinn
That's no moon, that's a space station! - Obi Wan
That's no moon. It's a vice-moderator!
That's no moon... It's a vice-moderator!
That's no moon... That's an AT&T logo.
That's no moon... it's a space station.
That's no moon... this is a moon, said Ben, pulling down his pants.
That's no moon.....that's a space station.
That's no moon...it's the STAR WARS FIDONET ECHO!
That's no moonIt's a vice-moderator!
That's no moonThat's an AT&T logo.
That's no moonit's a space station.
That's no moonit's the !
That's no orge, it's just my pet Siobhan!
That's no priest, that's Lovejoy! - Crow
That's no rumor - it's an unconfirmed fact!
That's no silver bullet you dolt! It's a suppository!
That's no silver bullet, dolt! It's a suppository!
That's no tagline - it's ODO!!!
That's no tagline! It's Odo!
That's no way to behave on your first day out! - Frank N. Furter
That's not Elvis! It's Odo!!
That's not God! That's just a waffle that Bart tossed up there! - Marge
That's not Tracy! That's the Female Changeling! Blast 'er!!
That's not a "bug", that's a feature!
That's not a Bug, that's an Enhanced Feature
That's not a Yes or No Question! You forfeit your remaining questions!
That's not a banana in his pants. It's a passion fruit.
That's not a bug! It's a seldom-used, undocumented feature!
That's not a bug! It's supposed to do that!
That's not a bug! It's supposed to do that!----<*
That's not a bug, it's a FEATURE!
That's not a bug, it's a Free Enhanced Feature!
That's not a bug, it's an enhanced feature!
That's not a bug, it's an undocumented feature.
That's not a bug, that's a feature
That's not a bug--it's an undocumented feature!
That's not a bug--that's an undocumented feature.
That's not a bug. It's supposed to do that.
That's not a silly walk - THIS is - ! ! @.
That's not a steel wool pad, it's a Dorsai tribble
That's not a strawberry--that's a tribble! Put it back!
That's not a tagline! It's Odo! -- Sisko
That's not a tagline! It's Odo! X Sisko
That's not a tagline, that's Wakko Warner carrying on again!
That's not a tagline, that's Yakko Warner carrying on again!
That's not a tagline. THIS is a TAGLINE!
That's not a very good effect- Crow T. Robot
That's not a virus....! It's Windoze.
That's not a virus....! It's Windows..
That's not a virus....! It's Windoze..
That's not all he's lost..
That's not all! still more to come!
That's not an optical illusion, it just looks like one
That's not art, Tom said abstractly.
That's not art, the critic said abstractly.
That's not ass'mlation. THIS is ass'mlation. -- Borg Dundee.
That's not enough! We demand MORE asbestos! More asbestos! - Bart
That's not funny, dumbass!!!
That's not like him. He's never late. He knew I was coming. - Hague
That's not line noise - My modem's speaking in tongues!
That's not line noise -- my modem speaks in tongues!
That's not line noise -- my modem's speaking in a foreign language.
That's not line noise, my modem's speaking in tongues.
That's not line noise--my modem's speaking in tongues!
That's not line noise-my modem is speaking in tongues!
That's not line noise... My modem's speaking in tounges!!
That's not line noise... my modem's speaking in tongues.
That's not line noise...My modem is speaking in tongues!
That's not line noise...that's my modem speaking in tongues! <G>
That's not line noisemy modem is speaking in tongues!
That's not line noisemy modem's speaking in tongues!
That's not much reward for being trustworthy, isn't it? - Sheridan
That's not my father, that's just my reflection. Simba
That's not really Dracula, Tom discounted.
That's not the point! The point is I am now a perfectly safe penguin!
That's not true, Brain! He's a crime-fighting genius! - Brain
That's not what I meant - Official Clinton Quote.
That's not what she said.
That's not what you said when you sent him your navel. -Baldrick
That's odd - I had a tagline when I came in here...
That's odd -- I had a recipe when I came in here...
That's odd -- I had a tagline on when I came in here...
That's odd -- I had a tagline when I came in here...
That's okay, I love you, bye-bye! - Mindy
That's okay, my mother didn't BEAR me either!
That's okay. The spikes broke his fall.
That's one hell of a defense mechanismyou don't dare kill it.
That's one penalty point for Mr. Servo - Joel
That's one small step for man...and a lot of frequent flyer miles for me.
That's only a difficult concept to understand if you're a lawyer.
That's plain to see...
That's pretty good coverage for a disintegrated pile of rubble.
That's pretty good, but that ain't the way I heard it!
That's price-fixing! said Tom caustically.
That's privileged information. - Father Mulcahy
That's quite a compliment, don't you think? Crazy, Babe...
That's quite a dress you almost have on. - Gene Kelly
That's racing...
That's right after my face went over to the dark side - Crow T. Robot
That's right friends we got tribble! Right here in River City!
That's right friends we got tribbles! Right here in River City!
That's right friends. We got tribble! Right here in River City!
That's right honey, because he's the flying boy - Mike
That's right! I'm bad! - Tom
That's right, Money. Your money's happiness is all that money. - Homer
That's right, SEX-ED week!! - Buzzcut
That's right, retreat behind a smoke screen of bourgeois cliches.
That's right, send a self-abused stomped elephant to:
That's right, try hard to be good at the game of life.
That's right. Nurse Drivel and Doctor Manure. - Hawkeye to Frank
That's right. Rented the spare room to Elmer Fudd - Mike
That's right. She actually stops and says, "Sh*t." <Riggs>
That's right... With Blue Wave you get 72 characters!
That's right...pretend it's a lollipop!
That's right; you were born on Mars. --Ivanova.
That's sick! But I like it!
That's simple. Your future is whatever you MAKE it!!
That's simply divine!- Divinissimum est!
That's something no one should have to see. - Lister
That's strange, half of my ancestors are men!
That's strange; half my ancestors are WOMEN!
That's stronger than a garlic milkshake.
That's suicide, Data! - Riker
That's sweet. I used to follow my dad to a lot of bars, too. - Barney
That's the $64,000 Question, Scully. --Fox Mulder.
That's the 1st time I ever did THAT again!
That's the 64 dollar question- Crow
That's the Canadian health care system - Crow
That's the EPA's private jet - Mike on smokey jet
That's the Heimlich manuever, NOT the Heinekin manuever.
That's the deal. Take it or leave it.
That's the easiest explanation.Its also the most implausible. --Mulder.
That's the easy part. Now I gotta *tell* him I removed his leg.-BJ
That's the first time I ever had to smuggle myself - Han Solo
That's the kind of thing an idiot would have on his luggage!
That's the kind of thing that makes people go "Hmmmmmmmm..."
That's the last mistake you'll ever make. - Luke
That's the last time I ever travel by bean. - Yakko
That's the last time I pet a lion said Tom offhandedly.
That's the last time I trust a randomly-selected tagline!
That's the last time I'll pet a lion, said Tom offhandedly.
That's the most ridiculous thing I ever "hoyd."
That's the nuttiest idea you've had, Counselor. -- Geordi
That's the problem with the gene pool: No lifeguard.
That's the real reason we wear gloves, isn't it? --Winters.
That's the second biggest arrow I've ever seen. -Maxwell Smart
That's the sound of the lesbian, working on the chain, yeah!
That's the sound of the men workin on the tag line!
That's the sound of the men working on the chain gang..
That's the spirit we need with our hookers! - Tom
That's the spirit, Thing! Lend a hand. Gomez Addams
That's the support team? 3 guys in a Woody? - Tom
That's the trouble with heroics- they seldom run to schedule.
That's the trouble with regeneration-you never quite know what you get
That's the trouble with regeneration: U never know what you'll get.
That's the trouble with regeneration: you never know what you'll get.
That's the trouble with regeneration:you never know what you'll get.
That's the way it was in 1881.
That's the way the veal cutlets.
That's the way the wookie grumbles.
That's the worst case of Hemorrhoids I have ever seen! - Ace Ventura
That's three ones and a two."--Carlin
That's three. Give them a try and tell me if you have any luck.
That's too bad, but I'm not Cheyenne. - Cescka
That's too easy for Lennon.
That's user, u s r, and then there's a space ...
That's very cute. <BLAM!> I hate things that are cute.
That's very funny, Scotty, now beam down my pants!
That's very funny, a fly marrying a bumble-bee...
That's very pig-hearted of you.
That's very thoughtful, Quark. -- Kira It's also very small. -- Odo
That's war. Crazy things happen. - Col. Potter
That's what I call a sore winner. - Hawkeye
That's what I get.
That's what I like about you.
That's what I meant....only different.
That's what I said, soldier. Lieutenant Colonel O'Reilly! - Radar
That's what I'm trying to tell you, they're made of meat!
That's what a Deathocrat's made of.
That's what friends are for...
That's what he thinks!
That's what i get -- NIN
That's what it's all about! --G'Kar.
That's what it's all about.
That's what its like to be borned - Crow on guy in hatch
That's what mothers are for, I think.. - Dire Wolf
That's what navigators are for. I just shoot things. -William Hughes
That's what she said.
That's what the man said, you heard what he said, he said that!
That's what they say about Florida...
That's what they want, isn't it?! - Sheridan
That's what we are here for... :)
That's what you want from grandma - Crow sings
That's when Bob realized it was a daymare!
That's when I fell in love with the leader of the pack...VAROOM
That's when Orville realized it was a daymare!
That's when Starchild woke from the dead and yelled at David
That's when he realized it was a daymare!
That's where I live...on stage. Barbra Streisand
That's where the next character appears said Tom with a cursory glance.
That's why GOD made your eyes; to plagiarize.
That's why GOD made your eyes; to plagiarize.
That's why I bought it. I'm cheap!
That's why I got my main man, Rooster - Crow
That's why I had my appendix out... twice. - Rimmer
That's why I keep a dicktionary by the PC.
That's why I say "HEY MAN, NICE SHOT"...
That's why I stifled my inclination to run on with this message.
That's why I wear... TUNA FISH SANDWICH!!!
That's why she's still wearing her jammies - Crow on kiss
That's why the Savior is a tramp - Mike sings as priest
That's why the killing of Meat! Mongo like two worlds.
That's why they call it a DROP spindle.
That's why they call me "Spooky". - Mulder
That's why they pay me the big bucks.
That's why they put the eye in FBI. --Fox Mulder.
That's why we practically rule New York now. -- Shakespeare
That's why we're greasing him up - Mike
That's why you're not in command. Dismissed! - Col. Potter
That's worse than `Sweatin' to the Oldies'! - Yakko Warner
That's worse than `Sweatin' to the Oldies'! --Yakko.
That's wrong -- I do bite. - K'Ehleyr
That's your excuse - being dead. --Lister.
That's your movie. There ya' go! - Dr. F to Mike
That's-a spicy meat-a-ball! - S. Ipkiss
That's... Homer Simpson, sir. SIMPSON!, eh?
That's...umm...interesting, Aahz. - Skeeve
Thats 2 cents worth from me.
Thats a very Russian attitude. I approve. - Lt. Cmdr. Ivanova
Thats a very Russian attitude. I approve. --Ivanova.
Thats all i can think of right now.. i lost my collection of tags..
Thats all we nedded, a Druish Princess.
Thats called a header, it's used to start a message.
Thats for making the scene go on so long - Tom Servo
Thats it, were deader than tank tops. --The Cat.
Thats just my two cents (wouldnt buy anything these days anyway).
Thats my Industrial Strength Hairdryer and I can't live without it!
Thats not a bug, it's a feature!
Thats not all he's lost.
Thats right after my face went over to the dark side-Crow
Thats us in the corner. That's us in the spotlight - Mike
Thats what I ordered! Change mine to the soup.
Thats what I want: mummified & placed next to Stalin-Crow
Thats what happens when you drink in a hottub - Crow
Thats when men were men - Mike
Thats why God put woman on this green earth - Crow
The Missing Link.....Offline Mail Addicts.....
The O U T S I D E R Press by DEPECHE PUBLISHING
The difference between meat and fish is that if you beat your fish it dies.
The problem- once identified -- Trivial !!
The "Any Key", yeah, that's the big red switch on the side.
The "Any" key? It's the one in back marked "power"!.
The "Any" key? See the one in the back marked "power"?
The "Any" key? See the red one in the back marked "power"?
The "Bill" of Rights has become the "Loose Change" of Rights!
The "Borg"ness. I hate Lion King.
The "C" in Rap is silent.
The "Enemy within:" the Pentagon.
The "HELL" you say...
The "He's dead, Jim!" taglines are dead, Jim!
The "Hillary" pack at KFC: no breasts, large thighs; all left-wings.
The "Humor" conference is for important messages from the sysop.
The "Jeopardy" echo: Is this where all answers must be in question form?
The "Man From Hope" is now hopeless.
The "Message Header" echo: where origin lines are not allowed.
The "Messages" echo: where taglines are not allowed.
The "Morning After" pill for men: Changes your blood type
The "Morning After" pill for men: it changes your blood type.
The "Off Topic" echo: where questions are allowed, but not answers.
The "Rainbow Nation" Something for everyone
The "Tagline Mangler" creates interesting taglines!
The "Tagparagraph echo" where taglines are not allowed.
The "Twoonie", broken after 2 days in circulation!
The "U": A race that follows the Q everwhere!
The "War on Drugs" is a war on the Constitution
The "War on Drugs" is a war on the Constitution.
The "War on GUNS" is a war on the Constitution and Law-abiding Citize
The "Window of Opportunity" is next to the "Trapdoor of Disaster."
The "`Bout Ready For Bedtime" Administration 1993-1997
The "c" in "rap" is silent.
The "chain" of command is often a noose.
The "girlfriend" in THE CRYING GAME is actually a guy.
The "oink!" of Pig Man cries desperately for help.
The "space bar": A CyberNightClub
The #@#$ universe keeps drifting off frequency!
The $ prompt...America's symbol of power.
The 'Curdless' Phone - Dr. Forrester on cheese phone
The 'H' stands for horrible, right? --Lister's Confidence.
The 'Pledge Of Allegiance' does not end with Hail Satan. --Bart Simpson.
The 'Zugsmith' touch - Tom on name in credits
The 'agains' frighten me more than the 'yets'.
The 'c' in 'crap' is silent
The 'c' in 'rap' is silent
The 'danes can inherit the Earth--I'm going to the stars!
The 'other side' looks exactly like the other side - Crow
The (A)bort (R)etry (F)ail ?
The *Real* Story of the Film So Far...
The *Tagline Addict* Strikes! (And your Hard Drive file area shrinks.)
The *Tagline Addict* is not amused.
The *best* mini-vac for after-meal cleanup is a dog!
The *correct* plural of Oxymoron is oxymora.
The *only* duly authorized Computer Curmudgeon
The *only* thing that's easy to learn is *sex*.
The *stupid* question is the one unasked.
The .357 Mag in a crowded elevator, there is no finer weapon.
The .45 cal in a crowded elevator, there is no finer weapon.
The .45: "In a crowded elevator, there's no finer weapon"
The /69 = ...................................8 something.
The /real/ Microsoft: WinEVER!
The 10 Commandments had a smaller cast than this - Crow
The 10 Commandments: the taglines Moses stole from God.
The 10 Commandments: The recipes Moses stole from God.
The 10 Commandments: The taglines Moses stole from God.
The 10 million byte flamethrower.
The 100% American is 99% an idiot.
The 10th Doctor will be played by Elvis Presley.
The 11th COMMANDMENT - Thou shalt not be a smartass!
The 11th Commandment: Provoke thy children not unto wrath.
The 11th Commandment: "Love your neighbor, not his wife."
The 1890s were the gay '90s. The 1990s are the Gay '90s.
The 1950's: Ball and chain. - The 1990's: The mouse.
The 1950's: Signed-Sealed-Delivered - The 1990's: Saved-Emailed-Downloaded.
The 1958 Floosy - Tom on trampy girl
The 1970's had the jet set...the 1990's has the NetSet.
The 1995 Grey Cup Game--November 19 at Taylor Field in Regina, SK!
The 1996 Democratic slate, better known as the "Twit List."
The 1st country Hitler conquered was Germany with gun control.
The 1st ever Mystery Science Theater convention! - Tom
The 1st half of life is ruined by parents, the 2nd by our children.
The 1st nonabsolute number is the number of reservations.
The 1st person to raise his fist, just ran out of ideas.
The 1st person to raise their fist, just ran out of ideas
The 1st rule of tinkering is to save all the parts.
The 1st rule to smart tinkering is to save all the parts.
The 1st step to burglar-proof your home, Clean your gun.
The 1st time Adam had a chance he laid the blame on woman. Nancy Astor
The 2 most useless things in aviation, altitude above & runway behind.
The 2 prime movers in the Universe are Time and Luck. --Vonnegut
The 23:00 News and Mail Service
The 2400 shall inherit the Earth. Bible: Bill Gates vers.
The 2nd Amendment arms patriots, not sportsmen!
The 2nd Amendment doesn't say "...only these firearms..."!
The 2nd Amendment enforces the other nine.
The 2nd Amendment is alive and well in Florida.
The 2nd Amendment is alive and well in Massachusettes...
The 2nd Amendment is in case the government ignores the other 9!
The 2nd Amendment is to assault as the 1st Amendment is to slander.
The 2nd Amendment: It's not about guns, it's about freedom.
The 2nd Amendment: Just in case the government forgets the 1st!
The 2nd Amendment: Just in case the govt forgets the 1st!
The 2nd I Couldn't Care Less Tagline: ==_-=- ( * )
The 2nd amendment guarentees all the other amendments.
The 2nd gunman behind the grassy knoll was &^$&%#@*NO CARRIER
The 3 kinds of lies - lies, damned lies & statistics - MT
The 3 kinds of lies - lies, damned lies & statistics.
The 3 men I admire the most: The Father, The Son & The Holy
The 3 stages of marriage: lust, rust and dust
The 3 types of men: 1) Intelligent 2) Good-looking 3) Geco
The 3 types of men: 1) Intelligent 2) Good-looking 3) He
The 3 types of men: 1) Intelligent 2) Nice Looking 3) @FN@
The 3 types of men: 1) Intelligent 2) Nice Looking 3) The Majority.
The 3 types of men: 1) Intelligent 2) Nice Looking 3) YOU
The 3rd I Couldn't Care Less Tagline: ==_-=- <> <> <> <> <> <>
The 4 Basic Food Groups: Ice Cream, Pizza, Diet Pepsi and Women.
The 4 Basic Food groups: Chocolate, Pizza, Caffeine, Sex.
The 4 Basic Foods: caffeine, chocolate, sugar, and sex.
The 4 Cat Food Groups: Dry, Canned, Natural, Yours.
The 4 Cat Food Groups: Dry, Canned, Natural, Yours.
The 4 Dog Food Groups: Dry, Canned, Natural, Yours.
The 4 Food Groups: Caffeine, Chocolate, Sugar, and Sex.
The 4 Food Groups: Caffine, Chocolate, Sugar, and Sex.
The 4 best anti-depressants: Money, Sex, Chocolate and Raquel Welch.
The 4 food groups......Caffeine, Chocolate, Honey and Sex
The 4 food groups: Fast, Frozen, Instant & Microwave.
The 4 food groups: Fast, frozen, instant & microwaved.
The 4 food groups: Fast, frozen, instant and microwaved.
The 4 food groups: Fast,Frozen,Instant & Microwave
The 4 food groups: Frozen, Instant, Takeout, & Microwave
The 4 food groups: Soda, Ice cream, tacos & pizza
The 4 food groups: chocolate, chocolate, chocolate and *milk*!
The 4 food groups: fast, frozen, instant, and microwave.
The 4 food groups: soda, ice cream, tacos, and pizza.
The 4 food groups: spam, spam, eggs and spam.
The 4 food groupsCaffeine, Chocolate, Honey and Sex
The 4 seasons: salt, pepper, mustard, and vinegar.
The 4077th is out of blood...now we're squeezing turnips. - Potter
The 486SX: Intel's test of your gullibility!
The 486SX: Intel's test of your gullibility
The 4th, 5th, 9th & 10th amendments ALSO protect RTKBA.
The 5:15 from Duluth, Oh my it's just derailed - Crow
The 60's.."more a dream than a memory?" Oh Wow did I say that? Heavy!
The 64 Dollars Question (Take It or Leave it)
The 700 club is to science as Barney is to Les Miserables.
The 7th I Couldn't Care less Tagline: ==_-=- <===<< ( Alpha )
The 80's -- when you can't tell hairstyles from chemotherapy.
The 80986 will complete instructions before it gets them!
The 8th I Couldn't Care less Tagline: ==_-=- -= -= -= ______==~~=<
The 8th graders cull the herd - Mike
The 90's are going to make the 60's look like the 50's
The 90's are the 60's turned upside down.
The 94/95 NHL season begins on October 1st. Are you prepared?
The =which= Directive??? --Janeway
The A-Bomb - Built by lazy Americans, Tested in Japan
The A-Bomb is a dud. Film at 11.
The ACLU...unraveling the moral fiber of America!!!
The ACLU: Friends of criminals and enemies of the people.
The ACLU: Friends of criminals; Enemies of the people.
The ACLU: unraveling the moral fiber of America!
The ANSi Crisis: "But it worked in test"
The ANTics begin! - SimAnt
The ANY key? It's that big red one on the right side.
The ANY key? It's that button marked `RESET'.
The ARMY said I was too heavy. The police said I was too DUMB. - Homer
The ATM just asked if I wanted to go double or nothing!
The ATOG killed my Shivan?!?!
The Abort, Retry, Fail ?
The Abrams' Principle: The shortest distance between two points is off the wall.
The Actor-Singer is dead! --D. Letterman.
The Adventures of WIN.INI the Pooh - by W. Gates
The Adventures of WIN.INI the Pooh - by W. Gates.
The Afterlife is run by you, as the Universe is not so badly designed.
The Agamemnon. The Captain's old ship. - Ivanova
The Age of Aquarius, indeed - LaCroix
The Air Force escorts Sununu to a golf game - Crow
The Air Force is at the Dog & Suds? - Mike
The Air Force recommends 'crank' - Mike
The Alcoholic Voyage of Sinbad - Crow
The All-new ginsu recipe, minces, dices, splices, chops
The All-new ginsu tagline, minces, dices, splices, chops
The American Civilization? That would be a good idea.
The American Library Association is a good organization!
The American Revolution was illegal until it was over.
The American dream: Smoke pot, cheat on your wife, & become president
The American dream: Smoke pot, cheat on your wife, & become president!
The Americans have taken umbrage. Whereabouts is that?
The Amiga had it _right_ from the start! It took 10 yrs for Win 95...
The Amish man married the Amish woman. Soon after, he drove her buggy.
The Amoeba never lies.
The Anal Gang - Tom
The Angels Rejoice When Forgiveness Prevails...
The Anita Hill Doll: pull string, it talks after 10 years.
The Anita Hill Doll: pull stringit talks in 10 years
The Anita Hill doll: Pull string; talks in ten years
The Anita Hill doll: Pull string; talks in ten years.
The Anne Meara of Canada - Mike on bossy woman
The Anne Meara of Canada... -- Mike Nelson
The Annoyance Detection Squad is WATCHING YOU!
The Any key? It's the one in back marked power!.
The Apathetics Convention has been cancelled due to disinterest.
The Apathy Anonymous meeting was cancelled due to lack of interest.
The Apathy Rally was cancelled due to lack of interest.
The Apple Dumpling Gang...Jobs and Wozniak.
The Apple and the Newton: 32.19 ft/s.
The Apple and the Newton: 9.81 m/sec.
The Aquinas Axiom: What the gods get away with, the cows don't.
The Archdruid is the one with the biggest chainsaw.
The Army is like the Boy Scouts without adult supervision.
The Army needs leaders the way a foot needs a big toe. -- Bill Murray
The Army's got some new recruits./They wear high-heeled Army boots.
The Armys purpose is to kill people and break things.....RUSH LIMBAUGH
The Art Ross Trophy winner for 95-96...The Magnificent Mario Lemieux!
The Art of Sex ... by Carmen Gettit
The Art of Underwear Exchange by Betty Won't
The Ascension: An air traveler's frequent miles dream.
The Astral Express Card-Don't leave the Plane without it!
The Auto Salvage Business: Rex Toad
The Automated Episode Guide by Snake-Byte Incorporated!
The Averil Harriman Memorial Lunar Dome
The Away Team went on a mission and all I got was this lousy T-shirt!
The Away Team went on a mission and all I got was this lousy tagline!
The BBC would like to apologize for that last apology.
The BBC would like to apologize for the preceding message.
The BBS `plug' is O.K. cos that's what it's into.
The BBS has ended because of a gas problem.
The BBS has ended because of an exception trap.
The BBS in English.
The BBS of the Stars!
The BBS of the Stars!"
The BBS on a mission from God.
The BBS that 'Rocks Philadelphia'.
The BBS that asks the question, but doesn't care about the answer.
The BBS that boldly goes. We haven't figured out where yet.
The BBS that cares enough to send the very best.
The BBS that dares to ask the question: 'Huh?'
The BBS that gives your modem an April fresh smell.
The BBS that glows in the dark.
The BBS that looks GREAT in silk stockings.
The BBS that melts in your mouth, not in your hand.
The BBS that never repeats repeats itself itself...
The BBS that never sleeps.
The BBS that promises an orgasm on each call... SO, we lied.
The BBS that they invented autodial for.
The BBS to have when you're having only one.
The BBS with Take-out.
The BBS with a hint of musk.
The BBS with the best g-spots...er...g-files around.
The BBS with the biggest phone bill loses!!!! Oh god, I'm lost Now!!
The BBS you wrote home about...
The BBS your mother warned you about.
The BEST echo in fidonet is devoted to autoracing....
The BOOK means BIBLE. So don't swear by the BOOK
The Babearlon project was a scheme given shape...
The Bablon project was a dream given form....
The Baby's Revenge: by Nora Tittoff
The Baby's Revenge: by Nora Tittoff.
The Babylon Project was a dream given form.
The Babylon Project was our last, best hope for peace. It failed - JMS
The Bad Boys gonna set ya free, Rock on, Rock Ya, Rock Ya.
The Baggenses steals our taglineses, my precioussssss...
The Bagginses steals our taglineses, my preciousss
The Bagginses, they steals our taglines, precioussss....
The Bajoran Internal Revenue Service: Your Prophets are OUR business.
The Bajoran Phaser - a simple answer to tricky political problems.
The Bajoran Resistance fighters were wary of Palukoos in the latrines.
The Bajoran death chant lasts over 2 hours. --Worf.
The Ballad of John and Lorena Bobbitt.
The Balrog casts a spell of Zorton - Mike to Tom
The Bard's Curse: "I'll make you immortal!"
The Bare Facts About Nevada Agriculture.
The Barnabus Collins look - Tom on guy w/weird haircut
The Basics: A beer, a blonde, & a boob tube
The Basics: A beer, a blonde, and a boob tube.
The Bataan "Oh my God, my dogs are aching" march - Crow
The Batman play seemed important to Crow - Mike to Tom
The Battle Belongs To The Lord...
The Battle of the Network Stars should be waged with guns.
The Bavarian Illuminati are watching you.
The Beach Bully: Harry Ayp
The Beach Bully: Harry Ayp*
The Beast at Tanagra.
The Beast of Both Worlds
The Beast's Lair users come in two types - Quick or Dead
The Bell nutwork: Squirrel transportation provided by telephone lines
The Bells of St. MURDER! - Tom
The Benji-Nator!
The Bermuda Triangle swallows seamen.
The Best Government is the least government
The Best Of Holiday Greetings And Wishes To You All...
The Best Prophet of The Future is The Past
The Best way to be useful - STAY OUTTA THE WAY!!!!
The Betty Ford clinic is now taking BBS addicts.
The Bible Belt won't keep MY pants up.
The Bible falling apart usually belongs to a person who isn't.
The Bible for Blondes: Oral Sex Techniques by N. Onegulp.
The Bible has a word to describe "safe" sex: It's called marriage.
The Bible is an opiate to keep the beasts of burden complacent.
The Bible is an opiate to keep the beasts of burden patient.
The Bible is criticized most by those who read it least.
The Bible is criticized most by those who think while reading it.
The Bible is literature, not dogma. -- Santayana
The Bible is the bread of life that never becomes stale.
The Bible says, Love thy neighbor, hate the gayness...
The Bible, it knows, and some people hate that! (Heb. 4:12)
The Bible, the Blood, and the Blessed Hope.
The Bible: criticized most by those who read it least.
The Big Apple is one big Bone Gnawer playground. -- Shakespeare
The Big Bang Theory:God spoke, and *BANG* it happened!
The Big Bang was an orgasm of Divine Joy.
The Big Bang was only the universe rebooting.
The Big Bloodsucker Bites The Big One...
The Big Bright Green Pleasure Machine: Alien Prostitution.
The Big Comptroller In the Sky - Mike
The Big Dipper is the father of the Little Dipper.
The Big People: What Leprechauns see when they are drunk.
The Big Scene - Crow as girl tearfully recounts crime
The Big Wave: Sue Nami
The Big Wave: Sue Nami(c)
The Bigger the Drive, the more Junk Collected
The Bigger the Drive,the more Junk Collected
The Bigger the Drive,the more Junk Collected.
The Biggest Pile Of Useless Information This World Has Seen...
The Bill Clinton Watch: Only $14.95 + Tax + Tax + Tax + Tax + Tax + Tax
The Bill of Rights - void where prohibited by law.
The Bill of Rights -- Void Where Prohibited By Law
The Bill of Rights isn't a Menu! - Charles Curley
The Biography of Ben Dover by Seemore Butt
The Bird Collection: Arnie Thologie
The Bjoran death chant lasts over 2 hours.
The Black Hole Golf Course: A hole in one every time!
The Blazes with the Prime Directive Mr. Worf, Upload WINDOWS to the BORG
The Blazes with the Prime Directive Worf, Upload WINDOWS to the BORG.
The Blonde Sex Manual: IN - OUT. Repeat as necessary.
The Blonde Sex Manual: IN - OUT. Repeat if necessary...
The Blue Wave ... The totally cool way to do mail!
The Blue Wave Hates me !
The Blue Wave Reader v2.12 is over 2 years old and still going strong!
The Blue Wave drowns all other mail readers!
The Blue Wave echo, were suggestions are taken seriously!
The Blue Wave echo, where suggestions are taken seriously!
The Blue Wave packets are not in the main computer.
The Blue Wave: what Smurfs do at a football game.
The BlueWave echo, were suggestions are taken seriously!
The Bob Hope entourage prepares for another USO tour-Crow
The Bobbitt Virus - turns your hard drive into a 3.5" floppy.
The Bobbitt interview was running a little long, so they cut him off.
The Bobbitt trial ended up with a Re-hung jury.
The Bobbitts A marriage made in hell.
The Bobbitts - Taglines For Your Viewing Pleasure.
The Bobbitts - recipes For Your Viewing Pleasure.
The Bobbitts ... A marriage made in hell.
The Bobbitts: A set of sickos for the nasty nineties!
The Bobbitts: A marriage made in hell.
The Bobbitts: Married - June 18, 1989; Severed - June 23, 1993.
The Bobbitts: On the `cutting edge' of society.
The Bobbitts: Set of sickos for the nasty nineties!
The Bobsy Twins are calling - Tom on the Mads
The Bog: Pete Maas
The Bog: Pete Maas*
The Bondage Experts!!! ########
The Book of Armaments, Chapter Two, verses 8 to 11...
The Borg - Plastic surgery taken too far.
The Borg - plastic surgery taken too far.
The Borg Are Back An' There's Gonna Be Trouble, Hey Na, Hey Na...
The Borg Are Back An' Theres Gonna Be Trouble Hey Na Hey
The Borg Are Back and There's Gonna Be Trouble, Hey Na, Hey...
The Borg Assimilated and all I got was this lousy t-shirt!
The Borg Bopper: "Assimilate you at 8?...You *know* what I like!!"
The Borg Bunny....It keeps assimilating and assimilating and assi...
The Borg Cable Co.: Subscriber's wishes are irrelevant.
The Borg Cable Co: The subscriber's wishes are irrelevant
The Borg Cable Co: The subscriber's wishes are irrelevant.
The Borg Cable Company: The Suscriber's wishes are irrelevent.
The Borg Empire: An Equal Opportunity Assimilator
The Borg Express Card: Assimilation has its privileges.
The Borg Institute of Technology: Science on the march!
The Borg Ship - "Hip To Be Square".
The Borg Ship - "It's Hip To Be Square"
The Borg Telephone Co.: Subscribers' wishes are irrelevant.
The Borg Utilities: There are NO recovery tools.
The Borg Vs. the Christians-what's the difference?
The Borg are *so* square, they're cubed!
The Borg are back an' there's gonna be trouble hey na hey na...
The Borg are back and there's gonna be trouble...
The Borg are back, and this time no more Mr. Nice Guy.
The Borg are coming! Quick ... try to look useless!
The Borg are coming! Quick! Try and look useless!
The Borg are coming! Quick!! Try and look useless!!!
The Borg are coming! Quick, try and look useless!
The Borg are coming! Quick, try to look useless!
The Borg are coming! Try and look useless!
The Borg are coming! Look useless!
The Borg are coming! Quick! Try and look useless!
The Borg are coming! Quick!!! Try and look useless!
The Borg are coming! Quick, look useless.
The Borg are coming! Quick, try and look useless
The Borg are coming! Quick, try to look useless!
The Borg are coming! Try and look useless!
The Borg are coming!!! Quick, try and look assimilated...
The Borg are coming, try to look useless!
The Borg are coming. Quick, try to look useless!
The Borg are coming. Quick, hide your hockey gear!
The Borg are looking for a few good men.
The Borg assimilated & all I got was this lousy Tagline.
The Borg assimilated and all I got was this lousy Tagline.
The Borg assimilated me & all I got was this crummy T-shirt.
The Borg assimilated me & all I got was this lousy shirt!
The Borg assimilated me & all I got was this stupid T-Shirt!
The Borg assimilated me and all I got was this T-Shirt.
The Borg assimilated me and all I got was this dumb T-Shirt.
The Borg assimilated me and all I got was this lousy T-Shirt.
The Borg assimilated me and all I got was this lousy tagline.
The Borg assimilated me and all I got was this stupid T-Shirt.
The Borg assimilated my cat...He doesn't act any differently.
The Borg assimilated my culture and all I got was this lousy T-shirt!
The Borg assimilated my culture and all I got was this lousy tagline!
The Borg assimilated my culture and all I got was this t-shirt!
The Borg assimilated my culture and all I got was this tagline!
The Borg assimilated my culture and all that's left was this t-shirt!
The Borg assimilated my planet & all I got was this lousy tee shirt!
The Borg assimilated my planet and all I got was this lousy T-shirt
The Borg assimilated my planet and all I got was this lousy Tagline.
The Borg assimilated my planet and all I got was this lousy tee shirt!
The Borg assimilated my race & all I got was this T shirt
The Borg assimilated my race & all I got was this T-shirt
The Borg assimilated my race & all I got was this tagline.
The Borg assimilated my race & all they left was this copy of Windows!
The Borg assimilated my race - all they left me was this damn t-shirt!
The Borg assimilated my race and all I got was ... <AAAARRRGGGHH!>
The Borg assimilated my race and all I got was this T shirt.
The Borg assimilated my race and all I got was this lousy T-shirt
The Borg assimilated my race and all I got was this lousy T-shirt!
The Borg assimilated my race and all I got was this lousy tagline!
The Borg assimilated my race and all I got was this stupid T-shirt.
The Borg assimilated my race and all I got was this tagline
The Borg assimilated my race, and all I got was a T-shirt.
The Borg assimilated my race, and all I got was this crummy t-shirt
The Borg assimilated my race, and all I got was this crummy tagline!
The Borg assimilated my race, and all I got was this lousy T-Shirt!
The Borg assimilated my race,and all I got was a T-shirt.
The Borg assimilated my species and all I got was this lousy T-shirt.
The Borg assimilated my species, and all I got was this T-Shirt.
The Borg assimilated the Warners- and never recovered.
The Borg assimilated; all I got was this stupid T-shirt.
The Borg at Hungry Jacks, Resistance is Futile!
The Borg do it collectively.
The Borg do not apologize for anything.
The Borg have entered sector 001. -- Shelby
The Borg have entered sector 001. Shelbey.
The Borg have neither honor nor courage. --Worf.
The Borg have neither honor or courage.
The Borg have neither honor or courage. -- Worf
The Borg in Florida: "John Tanner is irrelevant."
The Borg is the ultimate user. -- Q
The Borg just don't fix food the way my Grandma used to!
The Borg left this package sir. The label reads "Win95"?
The Borg refused to assimilate Wesley.
The Borg ship is an Irrelevant class vessel, sir.
The Borg ship is undamaged. -- Worf
The Borg sure know how to push Data's buttons...
The Borg tried to assimilate me. So I ate them. --T. Rex.
The Borg tried to assmilate me. So I ate them. --T. Rex.
The Borg vs. The Dittoheads...what's the difference?
The Borg's turbolift music - "It's Hip to be Square".
The Borg, plastic surgery taken too far.
The Borg, victims of low self-esteem? On the next Geraldo.
The Borg: Calm, cool, and collective.
The Borg: Plastic surgery taken too far.
The Borg: Victims of Low Self-Esteem? On the Next Geraldo!
The Borg: We came. We assimilated. We left.
The Borg: A committee that actually does something.
The Borg: A liberal government in the 24th century.
The Borg: A liberal government in the 25th century.
The Borg: Plastic Surgery Taken Too Far.
The Borg: Puts a new spin on COLLECTIVE bargaining
The Borg: Victims of Low Self-Esteem? On the Next Geraldo!
The Borg: We came. We assimilated. We left.
The Borg? Politically correct: The non-amalgamatorily challenged!
The BorgMail echo is empty.
The Bowery Boys Meet Bigfoot.
The Boy Scouts is like the army with adult supervision.
The Boy Who Died From Eating All His Vegetables
The Boy stood on the burning deck..PRATT!
The Boys in BLUE!!... Our Metro FINEST!
The Brave only die once, the coward dies a hundred deaths.
The Braves will win The World Series in 1995.......Go Braves
The Bride Wore Spam.
The Bride of Bigfoot.
The Bridge Between Tagline Addicts
The Bright Side of Teamwork: You can blame someone else!
The Bruins are on TV? Nahh...I'd rather watch hockey!
The Bruins bite the dust - HEY! HEY!
The Brunette Sex Manual: Take it when you want it!
The Buck Doesn't Even Slow Down Here!
The Buck stops here, the Doe just visits..
The Buck stops here, the Dough just visits..
The Buck stops here, the Dough just visits...
The Buck stops here; the Doe just visits.
The Buffalo Bills - Winners despite conventional wisdom
The Bulls are gonna get blistered by the Suns!
The Bundy Trail... ! ! <<< Bruno Maglis
The ByteBrigade...We recycle spent font cartridges.
The CFL - Entertainment for 60 minutes....and beyond!!
The CFL: "It's very nice." -- Mujibur and Sirajul
The CLOCK$ stops here.
The COBOL Crisis: "But it worked in test".
The CSRA PC Users Group sponsors this conference
The Caldecott Tunnel has less traffic than that vagina.
The Calgary Exhibition and Stampede - July 7-17, 1994
The Calgary Stampede, Greatest Outdoor Show on Earth!
The California Condor is a rare and extremely ugly bird.
The California Legislature... the best YOUR money can buy!
The California Lottery: a tax on the mathematically impaired.
The Caller before you was God...
The Campus Crusade for Cthulhu: "It FOUND me!"
The Canadian Dublooney: a bagel and a doughnut hole: 2 flavors in one.
The Canadian Dublooney: kibbles and 4bits and 4bits and 4bits and 4bits
The Canadian Looney/Dublooney: the coins for the paperless office
The Canadian dollor. Current 70.85 Next 66.75?
The Candy Store: Pepper Mintz
The Candy Store: Pepper Mintz*
The Cannibal's Daughter By Henrietta Mann
The Captain said "Energize!" and this little pink bunny appeared...
The Cardassian Cable Co.: 4 channels? No, we have *5* channels!
The Care Bears Maul Some Campers and are Shot Dead.
The Carnival Cruiseline fights back - Crow on battleship
The Carpal "Tunnel of Love"...cyberplace sex hangout.
The Castle Ahrgggh. Our quest is at an end.
The Cat Seldom Interferes With Other People's Rights.
The Cat ate cheese & waited by mousehole with baited breath
The Cat is, above all else, a dramaticist....
The Cat lets me live here
The Cat who isn't finicky soon loses control of his ownee
The Cat, ethereal music wreathed in mystery.
The Catholic Church: A successful vampire cult.
The Cats let me live here
The Cave of Dr. Calimari - Crow
The Center of Cyberspace...ego@manic.id
The Chainsaw Luke, use the Chainsaw.
The Chairman of the Department of Redundancey Department
The Challenge is to try and fit em all together...
The Challenger's gone, but the challenge is still there.
The Charly Callas defense! - Crow on goofy suspect
The Charter of Rights - void where prohibited by law.
The Chef is the Boss in This Kitchen
The Chief has asked me to overlook this little ruckus. --Plug.
The Chief has asked me to overlook this little rucus. - Plug
The Child is the Father of the Man!
The Children of Davros shall rule!
The Choice: Roll over or stand up and be counted.
The Choice: Roll over or stand up to the challenge.
The Christian Right is wrong.
The Christmas Pageant does not stink
The Christmas Pageant does not stink - Bart Simpson's lines
The Christmas Pageant does not stink -Bart Simp./Epis. 8F09
The Christmas Pageant does not stink -Bart Simpson/Episode 8F09
The Christmas Pageant does not stink. --Bart Simpson.
The Christmas pageant does not stink
The Christmas presents of today are the garage sales of tomorrow.
The Christmas spirit is not what you drink.
The Chuck Berry Story: Judy Frudy
The Chuck Berry Story: Judy Frudy*
The Church Is To Be A Rest Stop, Not A Battle Field..
The Church has appropriated God for its own ends! - Machiavelli
The Church hates a thinker like a criminal hates the police.
The Church hates a thinker like a robber hates the police
The Church must learn humility, as well as teach it. - Shaw
The Church must learn humility, as well as teach it. G.B. Shaw
The Church of St Todd the Incontinent
The Church of St. Humid the Incontinent.
The Church of the Kinky Taglines
The Clan is stronger than the chief.- Old Scot Sayin
The Cleaning lady has to do windows, I don't.
The Clinton Administration--Taxation Without Hesitation.
The Clinton Administration--Taxation Without Hesitation..
The Clinton Administration: Government control from Womb to Tomb!
The Clinton Administration: Government from Womb to Tomb!
The Clinton Administration: Home of the Whopper!
The Clinton Administration: Murphy's Law in Action!
The Clinton Administration: Taxation without hesitation.
The Clinton Adminstration: Government control from Womb to Tomb!
The Clinton Armed Forces- Eat, Drink and be Mary.
The Clinton Comedy Hour starring Donna Shalala.
The Clinton Comedy Hour starring Robert Reich.
The Clinton Comedy Hour starring the "Not Ready for Reality Players."
The Clinton MisAdministration: Government control from Womb to Tomb!
The Clinton Sex Scandal: Fornigate!
The Clinton Staff * Rookies that didn't make the cut.
The Clinton cat habla espanol! S-O-C-K-S!
The Clintonista invasion/occupation: 1993 - 1997
The Clintons: America's first hermaphroditic president.
The Clintons: We're inept, we're incompetent, and we're in charge!
The Clipper Chip: Having a Peeping Tom install your window blinds.
The Clipper Chip: Better government through surveilance.
The Clown Prince Of Modemworld.
The Cockpit BBS SysOp: `//idow.\\aker USMC JAPAN
The Colloquium, Canberra, Australia (3:620/267)
The Colonel you ain't, o'tay????!!!! :)
The Comic Genius Of Tom Arnold
The Comma Sutra - the guide to Grammatic Satisfaction.
The Commodore 64--it keeps going and going and going and...
The Company loves misery.
The Complete E-Mail System!
The Complete Gnome's Guide to Tinkering With Artifacts
The Computer Gamer's Motto: We die and learn.
The Computer Says: Only a dirty commie woulnd't join the AEAS!
The Computer hates cheaters and coincidences.
The Computer is Watching.
The Computer is impressed with Data's hardware.
The Computer is no place for sex.....unless it's a really big computer
The Computer is our friend. Hail the Computer!
The Computer is your friend! Trust the Computer!
The Computer is your friend.
The Computer says: Join the AEAS, or you are a traitor!
The Concerto for Timpany & Carhorn - Mike
The Congress - Home of the Whopper!
The Congress is becoming the BANE of Democracy and Freedom!
The Congressman's Credo: To boldly tax what no man has taxed before.
The Conservative Candidates were elected, not the Conservative Agenda.
The Constipated Chinaman by Hung Chow
The Constitution - The main obstacle to Bill Clinton's plans.
The Constitution and Bill of Rights are NOT outdated!!
The Constitution does not make conspiracy a civil right. 341 US 494
The Constitution is not a technicality.
The Constitution protects the people from government. Guns ensure it.
The Constitution was to CONTROL the Government.
The Contract Parking gang - Tom
The Contribution Of Political Correctness To Free Speech: =>[ ]
The Corlick Sisters must DIE!
The Corp doesn't murder its own. --Winters.
The Counselor and I will be indisposed today. - Riker
The Course of Progress: Most things get steadily worse.
The Cow Blew Up on the Launching Pad.
The Coyote---Coming soon to a BBS near you!!!
The Crawlacopter? That's your answer for everything -Crow
The Creator is a comedian, only the audience is afraid to laugh.
The Creeping Nepotism - Mike on nephew/deputy
The Creeping Terror likes to frolic in the fields - Mike
The Crime Bill ... a $33 Billion Dollar Basketball Game.
The Criminals Of Watergate: Barton Mee
The Criminals Of Watergate: Barton Mee*
The Crow Of Diamonds! - Crow on new card
The Crow The Crow said don't look!!
The Crow, Pretty much same as above,p;)
The Crown is full of it! -- Nate Harris, 1775
The Cruise of Wine & Roses - Tom on drunk boat captain
The Crusades, the Spanish Inquisition, Watergate -Q
The Cursed Cursor curses and having cursed...
The Cybermen were made by Borg-Warner?
The Czech's in the mail, ... sending Frenchman by FAX.
The Czech's in the mail. Sending Frenchman by FAX.
The Czech's in the mail. Sending Frenchman by FAX.
The D.C. park service has declared the man they shot a suicide
The D/L ain't over 'til the FAT table dings.
The DAR fund raiser is going quite well -Tom on wrestlers
The DM is lying. I know because I am dead.
The DM lies --Note inside a used D&D book for sale.
The DM lies. Note inside a used Player's Handbook.
The DR-DOS Windows Compressor: XDEL \WIN\*.* /R /S /N /D
The DUCK walks in square circles!
The Dame's scream hit an octave usually reserved for calling dogs.
The Dan Quayle virus causes mysterious spelling errors to appear.
The Dark Grandma of Death! - Mike
The Darkstryder Campaign (Boxed Set) - By West End Games
The DataQuest is OS/2'ing it!
The Davidians' door is stored beside JFK's brain.
The Day William Died by Bill D. Coffin.
The Day of Judgement is approaching, or it is not.
The Dead Of Winter: Jan Yuary
The Dead Of Winter: Jan Yuary
The Dead Shall Walk the Earth and Dine on Flesh
The Dead wanna-be's - Crow
The Death Penalty is 100% deterent!
The Death Penalty is a 100% Deterrence
The Death Star has cleared the planet!
The Death Star plans are *not* in the main QWK packets
The Death Star will be in range in 5 minutes
The Death With Dignity committee - Crow
The Death penalty is a 100% deterance.
The Decline of Western Civilization, Part III: The Grammy Years
The Deed of Paksennarion by Elizabeth Moon (1 vol. TPB)
The Def. of Upgrade: Take old bugs out, put new ones in
The Def. of Upgrade: Take old bugs out, put new ones in.
The Defiant Debs - Mike
The Definition of Redneck foreplay......Psst....Sis, you awake?
The Delta Quad: just a speed bump in Voyager's road of life.
The Delta Quadrant: A speed bump in Voyager's road of life.
The Democratic Party is the party of gimmes
The Democratic emblem is a jack*ss -- obviously a character reference!
The Democratic rule: "Confusion creates jobs!"
The Democrats and the Republicans are in bed together...
The Democrats are tax-collectors; the Republicans are taxpayers!
The Democrats have been Clinterminated!!!
The Democrats want to destroy Amendment 2 and 10.
The Demon In Your Mind Will Rape You In Your Bed At Night
The Dems have the Presidency & a majority in both houses of Congress.
The Department of Redundancy Department.
The Devil HATES Sunday!
The Devil already has all the lawyers for himself.
The Devil can cite taglines for his purpose...
The Devil falls on account of his gravity.
The Devil falls on account of his own gravity.
The Devil is most devilish when respectable.
The Devil is my brother-in-law - Crow as goofy suspect
The Devil made me do Alright, I did it myself!
The Devil made me do it.
The Devil made me do...<ACK!>...YOU!
The Devil made me do...<ACK!<...@FN@!
The Devil made me read Zmodem docs.......
The Devil's children have the Devil's luck.
The Devil's gonna show up as a hooker now - Crow
The Devils Conference, type 'GO TOHELL' at the ! prompt.
The Dialectics of Progress: Direct action produces direct reaction.
The Dinosaurs kept all their eggs on one planet..
The Disabled - The only minority you can join
The Discworld is in for a wild time, when Death gets a life
The Disk Crash BBS - now with 360K Online
The Do-It-By-Hand Offline Mail Reader* Carpal Tunnel v1.0
The Do-It-Yourself Borg Kit. Some assimilation required.
The Do-It-Yourself Borg kit. Assimilation required.
The Doctor will see you now Bob Morgan!
The Doctor will see you now Dal. Please disrobe!
The Doctor will see you now Orville. If you're cute, please disrobe.
The Doctor will see you now Orville. Please disrobe!
The Doctor will see you now Taglit!
The Doctor wouldn't be caught dead with an Intel TARDIS.
The Doctor's not as big a moron as he was. Smarter? No, thinner.
The Doctor, wonderful chap. All of them. - Brig. Stewart
The Doctor? Wonderful chap. All of them. --The Brigadier.
The Doctors should have thrown Schumer out and kept the afterbirth.
The Doctors should have thrown you out and kept the afterbirth.
The Dodgers will never make it to the world series. - Ramirez
The Dog Star is a very Sirius matter.
The Dolphin, ne'er has anything been more divine - Oppian
The Dot.EXE Virus- Type in "Dotty" and you die.
The Double Cranch does not validate - Mike
The Double Cranch? - Frank on Double C Ranch sign
The Dr. That's not a good idea implodes
The Dragon Taxi Service - we will take theeanywhere.
The DragonKill war is named for what the dragons DID!
The Dread Pirate Roberts is here for your *souls*! -- Fezzig
The Dreaded Phrase: "I'm PMSing and I'm out of chocolate!"
The Dream State
The Drunk was REAL Good! - Tom
The Duluth Chamber of Commerce bids you adieu - Mike
The Dumb Don't Survive!!!!
The Dungeon Master of my life shows no mercy.
The Dungeonmaster HAS arrived - Tom Servo
The Dunny Bowl, Clitoris and Anniversaries - Why do males miss all 3 ?
The Dunny, The Clitoris and Anniversaries - Why do males miss all 3?
The Dyslexic Bard: Master-of-all-trades, jack of none.
The Dyslexic Chicken Parade, Boy I need some SPAM
The EASIEST Comm program for Win95 is a DOS Program! www.split.com
The END (and more than you wanted to know)
The END must be near!! The fat lady's SINGING
The ENERGIZER BUNNY, arrested...........charged with Battery.
The ENO? - Crow on end credits spelled with cigarettes
The ENTERPRISE is outnumbered by Three (3) Klingon ships!
The EPA is banning everything and no one will ever die.
The EXXON monster of Planet Hazelwood just ate Orville.
The Eagle is ready to dive - Crow in Deep 13
The Eagle is running! The Eagle is running - Crow panics
The Eagle is wetting his pants! - Crow in Deep 13
The Eagles are flying again.
The Earth Alliance can't go around being the galaxy's policeman.
The Earth Alliance can't go around being the galaxy's policeman. - B5
The Earth Consulate will hear of this.
The Earth Shakes at the sound of His voice!
The Earth changed.Your fathers changed.
The Earth does not belong to us, We belong to the Earth.
The Earth is 98% full. Please .ZIP yourself.
The Earth is 98% full. Please delete anyone you can!
The Earth is 98% full. Please delete anyone you can.
The Earth is flat / pi equals three / the Bible says it / so it must be
The Earth is flat, like the surface of a sphere.
The Earth is in beta test and will be upgraded by UFO's.
The Earth is like a grain of sand, but bigger.
The Earth is like a grain of sand...Only bigger.
The Earth is like a tiny grain of sand, only much bigger.
The Earth is like a tiny grain of sand, only much much heavier.
The Earth is one big Chia Pet.
The Earth is our Mother & our 9 months are up
The Earth is round. But you don't have to believe it. -- Forrest Gump
The East is lost in incense, the West is lost in footnotes.
The Easter Bunny is dead. Eaten by Santa on Thanksgiving.
The Economy is Recovering!: Knott Quite
The Economy is weird -- banks fail before toasters do.
The Effects of Alcohol: Sir Osis of Liver
The Egyptians built the pyramids in the shape of a huge triangular cube.
The Egyptians had the right idea, they worshiped cats as gods.
The Eiffel Tower is the Empire State Building after taxes.
The Eiffel Tower, the biggest lightning rod on the planet! - Duncan
The Eiffel Tower, the world's biggest lightning rod! - Duncan MacLeod
The Eiger Sanction had more Hawaiin locations - Tom
The Einstein theory is relatively simple.
The Einstein theory is relatively simple. - Robin Williams
The Elder Gods say they can make me a man! All it costs is my soul!
The Electric Chair Choice: Regular or Extra Crispy
The Electric Chair Choice: Regular or Extra Crispy?
The Electric Chair Choice: Regular or Extra Crispy
The Electric Chair Choice: Roasted or broiled.
The Electric Chair Choice: Slow or Fast.
The Electric Chair's Raw: Quickly cook on superheated seat.
The Electric Chair's Well Done: Bring chair to a slow boil.
The Electric Fox - Bringing *joy* to the American Heartland! <GETE>
The Electric Fox - Memphis, Tennessee.
The Electric Fox - Myra I Fox - Memphis, Tennessee.
The Electric Fox - Warm Glow of the Southeast.
The Electronal College only tabulates votes by email.
The Elements of Style: Strunk first, then White!
The Eleventh Commandment: Don't get caught!
The Elvis Diet: Eat anything you want, get real fat.
The Elvis hotline limits rednecks to one call per day.
The Elvis stamp is to be printed on tiny squares of crushed velvet.
The Emilio Este-Pez! - Joel
The Empath: Ophelia Sadness
The Emperor didn't die. He became a cricket.
The Emperor does not share your optimistic appraisal of the situation.
The Emperor has been expecting you. - Vader
The Emperor is coming here?...we shall double our efforts...
The Emperor is not as forgiving as I am. - Vader
The Empire is on the verge of success
The Energizer Bunny of Borg: Still assimulating!!
The Energizer Bunny was arrested! He was charged with BATTERY...
The Energizer Immortal: It keeps dying, and dying, and dying...
The English drive on the left side of the road, just like California.
The English have an extraordinary ability for flying into a great calm
The English may not like music, but they absolutely love the noise it
The English never forgive a man for being clever.
The Enterprise - Crewed entirely by Officers?
The Enterprise Princess now commanded by Capt. Stubing
The Enterprise crew actually fires shots in a fight - 2 drinks!
The Enterprise crew avoids a battle - drink!
The Enterprise crew wins 'cause Star Trek has human writers.
The Enterprise fires...but Haydon disbelieves!!!
The Enterprise has seen more action than a tribble in heat. - Picardo
The Enterprise just docked at a star base Bullitt.
The Enterprise just docked at a star base Orville.
The Enterprise runs Amiga Workbench 1701.D
The Enterprise runs OS/2 v9.1 ! (The Ferengi use Win NT)
The Enterprise runs OS/2 v9.1! (The Ferenghi use Win NT).
The Enterprise runs OS/2 v9.1! (The Ferengi use Win NT).
The Enterprise's secondary Sensory Array: Counselor Troi
The Ephebians had gods in the same way that other cities had rats.
The Errors are out there. Trust no one!
The Escape From Cthulhu Game: Just read the incantation, then escape!
The Ether Net...Today's helium supply for cyberjunkies.
The Ever-Ready Genealogist: Still tracing and tracing and tracing.
The Excitement of Trees: I. M. Board
The Excitement of Trees: I. M. Board(3)
The Extension of My Manhood Car! - Crow T. Robot
The Exxon Valdez! - Tom on drunk boat captain
The Eye of Proteus becomes you.
The F-15 Eagle: If it's up, we'll shoot it down. If it's
The F4 Phantom. Proof that bricks can fly.
The FACTS keep interfering with my theories.
The FAT table must be were the best food is!
The FBI has me under surveilance. They think I'm cute.
The FBI has me under surveillance. They think I'm cute!
The FBI has me under surviellance. They think I'm cute!
The FBI is in *REAL* trouble ...
The FL SINGLES & FRIENDS Echo is available NOW on:
The FL SINGLES echo is on Region 18 Backbone! Everyone's Welcome!!
The FOLDGERS crystals won't take much more, Captain!
The FREE GIFT of God costs just too damn much.
The Fabio Army arrives - Mike
The Falklands war was a quarrel between two bald men over a comb.
The Fall of a Watermelon: S. Platt
The Family Car Trip Sketch, ladies and gentlemen! --Tom Servo.
The Family Values crowd secretly worry about their OWN sexuality.
The Family of Shame - Mike
The Farm of Secrets & Lies - Tom
The Faster Windows Mail Reader
The Fear Monger's Shop: serving your phobia needs since 1957.
The Fear of God is second to Fear of Snakes
The Fear of SNAKES out does the Fear Of G
The Federation wins 'cause Star Trek has human writers.
The Feline Law of Obedience: As yet undiscovered.
The Feminist Express Card: don't leave HIM without it!
The Ferengi made Daddy turn off the main computer. - Riker
The Fetus Express Card: don't leave the womb without it!
The Few, The Proud, The Free - United States Citizens
The Few, the Proud, ....the Literate!
The Few, the Proud, the Politically Incorrect!
The Few, the Proud, the REGISTERED!
The Few, the Proud, the Registered
The Few. The Proud. The TagLines.
The Few. The Proud. The folks who still read books.
The Few. The Proud. Join the Space Marines!
The Few. The Proud. Those that like *ALL* of RAH's books.
The Few. The Proud. Those who think Lazarus Long is an okay kind of guy.
The Fifth Commandment is: Honor they father and mother.
The Fifth Rule: You have taken yourself too seriously.
The Fimbulwinter comes -- Windtongue, Get of Fenris
The Final Frontagline - now the job is completed, Jim.
The Final Frontier...these are the voyages...
The Final Jeopardy Answer is 42. Write your questions.
The Finnish version of Night Court - Crow
The First Church of Binary Science. (The Digitarians)
The First Commandment was when Eve told Adam to eat the apple.
The First Ever MST3000 ConventioCon Expo-Fest-A-Rama!
The First Goal of Evil : Effect a Compromise.
The First Law of War: Never get involved in a land war in Asia.
The First Law of War: Never get involved in a land war in Asia.
The First Liar Never Has A Chance
The First Myth of Management - It exists.
The First Ones went away. All but One. --Delenn.
The First Rule Of Owning A Cat: Look before you sit. Garfield
The First Rule of Program Optimization: Don't do it.
The First Rule of Program Optimization: Don't do it.
The First Share of the Kill For the Greatest in Station.
The Fischer Price Airport set. With Weebles - Tom
The Five Doctors: McCoy, Crusher, Pulaski, Bashir and the HoloDoc.
The Five Doctors: McCoy, Crusher, M'Benga, Bashir and the HoloDoc.
The Five stages of drunkness: Verbose,jocose,lachrymose,bellicose,coma
The Flies of Texas are upon you. - Ray Stevens
The Floggings Will Continue Until Morale Improves
The Florida Panthers The NHL's Real Dream Team.
The Florida Panthers: The NHL's Real Dream Team.
The Floridian is the most perfect creature on the Earth.
The Flying Fickle Finger Of Fate wants YOU!
The Flying Hamster Rides Again.
The Folgers crystals won't take much more, Captain!
The Food Channel - Targeted for people on a diet
The Force can have a strong influence on the weak-minded.
The Force has been assimilated. -- Darth Vader of Borg
The Force is irrelevant...Jedi will be assimilated.
The Force is strong with this one! - Vader
The Force is strong with this one. -- Darth Vader
The Force is the Force, of course, of course.
The Force is what gives a Jedi his power. -- Obi Wan Kenobi
The Force is what gives the Jedi his power. That and batteries.
The Force is with #TN#!
The Force is with @FN@!
The Force is with Dataman!
The Force is with Orville Bullitt!
The Force is with Orville!
The Force is with Taxi!
The Force is with YOU!
The Force will be with you... always! - Obi-Wan Kenobi
The Force? No! The Schwartz!
The Forrest plague Ewww..these Chocolates are bad
The Fortuneteller: Reid Palms
The Fortuneteller: Reid Palms*
The Founding Fathers warned us about this!
The Fountain of Youth is an OLD man's dream.
The Four Basic Food Groups: Caffeine, Chocolate, Sugar, and uh Sex!
The Four Basic Food Groups: Caffine, Chocolate, Sugar, and uh... Sex!
The Four Basic Food Groups: Caffeine, Chocolate, Sugar, and uhSex!
The Four Boxes of Freedom: Soap, Ballot, Jury & Cartridge
The Four Boxes of Freedom: Soap, Ballot, Jury & Cartridge.
The Four Food Groups: Frozen, Instant, Microwave, Takeout
The Four Food Groups: crust, sauce, toppings, cheese
The Four Food Groups: crust, sauce, toppings, cheese.
The Four Food Groups: Caffeine, Chocolate, Sugar & Sex.
The Four Food Groups: Caffeine, Chocolate, Sugar and Sex
The Four Food Groups: Caffeine, Tobacco, Chocolate, and Sex.
The Four Food Groups: Caffine, Chocolate, Sugar and Sex.
The Fourth Law of Computing: On a slow day, you can wait forever.
The Fox Network has sunk to a new low.. - Lisa
The Free State - With a $1 Billion Debt - Maryland State Motto (1995)
The Freedom Line - Where are all our POW's?
The Freight Train of Truth is coming. LIbEralS are pennies on the track.
The French Chef: Sue Flay
The French Chef: Sue Flay*
The French are wonderful. They're so, so...FRENCH.
The French defence isn't...
The French defense isn't...
The French take care of themselves - except in wartime.
The Fresh Start Club -- where Death is only the beginning!
The Friends: "We are the shock troops of reality!"
The Fugitive Part II, starring OJ Simpson.
The Future is Deep Space Nine!
The Future is but Past forgotten.
The GLAND Institute?! - Joel
The GODS may smile on you, A-Ko, but I never will! B-Ko
The GOP has a Contract With America. Clinton has one ON America
The Gamma Quadrant Dual Flush Toilet - For Founders and Solids.
The Gang And The Government Are No Different
The Garbage Disposal God demands the offering of a spoon!
The Garbage Disposal God requires the offering of a spoon
The Garden State: Ida Hoe
The Garden State: Ida Hoe*
The Garden of Eden. Just outside of Moscow. -Chekov
The Gardener's Express Card: don't leave loam without it!
The Gene Simmons boat! - Mike
The General Law: The chaos in the universe always increases.
The General Theory of Relativity is too specific.
The General may be beaten, but he can never be destroyed.. - Zelazny
The General's first name was Ulysses, Tom granted.
The Generals gave thanks as the other ranks held back the enemy tanks.
The Generation that'd change the world is still lookin for its car keys!
The Generation that'd change the world is still lookin for its keys!
The German Bank Robbery: Hans Zupp
The German army advances north in a Cadillac - Tom
The Ghetto of Pleasant Valley Acres - Crow
The Giants win the Pennant! - Tom as dorky guy gets a hit
The Gimp: "mmmfffggg!"
The Gingrich that stole xmass!
The Girls Corps, 100 Magnificently trained girls - Mike
The Glaucoma Players - Tom
The God I pray to ain't short of cash, Mister. - U2
The Goddess Eris prevails...
The Goddess Loves You! Just don't push it till she's had her coffee!
The Goddess Loves You! Just don't push it 'til She's had her coffee!
The Goddess Loves You! Just don't push it till she's had her coffee!
The Goddess created cats so that men could learn to understand women.
The Goddess is Alive, and Magick is Afoot!
The Goddess is alive, and magic is afoot.
The Goddess is alive, and magick is afoot...
The Goddess is alive, ask any flower!
The Goddess loves you ... just don't push it 'til She's had Her coffee.
The Goddess loves you, but Her coffee comes first!
The Goddess loves you...But wait until She's had her coffee
The Goddess made cats so we might kiss tigers full on the lips
The Goddess made the cat so man could pet the lion.
The Goddess said "Let there be cats!" and She was promptly ignored
The Godfather Virus: Makes you a buffer you cant reuse.
The Gods DO have a sense of humor: I'm living proof!
The Gods never close one door but they open another.
The Gods only walk with you if you're going in Their direction.
The Gold Coast: Newly-weds and nearly-deads
The Gold Latinum Card. Don't leave orbit without it.
The Gold Pressed Latinum Card. Don't leave orbit without it.
The Golden Age Of The Doughy Guy! - Mike
The Golden Age of Making Stuff up - Tom
The Golden Age of Stalking - Tom
The Golden Age will come only when men have forgotten gold
The Golden Bird is circling - Crow in Deep 13
The Golden Dog of the Sun ate my homework!
The Golden Key to this thing called life is rigorous self-honesty.
The Golden Rule: The one with the most gold makes the rules.
The Gomer Pyle-driver! Gollee! - Tom
The Good Breakfast: Hammond Deggs
The Good Breakfast: Hammond Deggs*
The Good of the Body is the Prime Directive. Landru
The Good of the Body. That is the Key. Spock
The Good, The Baud, and the Ugly!
The Good, the Borg, and the Ugly.
The Gorge: been there, done that.
The Government Is Run By Aliens
The Government and Media are lying to you!
The Government does it to EVERYONE,
The Government reserves the right to REFUSE to serve everyone.
The Government should fear the people.--Thos.Jefferson
The Government took my guns, I'm safer now, Thanks Fuhrer
The Grail is hidden in the Castle of AAAUUGGGGHHHH!
The Grand Canyon. What a..grand..canyon.. - Homer
The Grand Parade of Lifeless Packaging, all ready to use.
The Grass is Brown on BOTH sides of the Fence...
The Graveyard sequence - Tom
The Greasy Spoon: Chris Coe
The Greasy Spoon: Chris Coe*
The Great Dane parks his Land Rover in the Barking Zone.
The Great Escape: Freida Convict
The Great Flood: Noah Zark
The Great [ESC]...Now Playing At A Monitor Near You !
The Greatest Persuit of all is the Persuit of Why.
The Greatest Right is the Right 'To Fail'
The Greatest labor saving device of all time --- $Money$
The Greatest of Faults Is To Be Conscious of None
The Grim File Reaper
The Grim File Reaper.
The Grim Reaper has cashed my life savings check.
The Groovy Ghoulies in the Ghoulag Archipelago? - Tom
The Groutful Dead.
The Guide is definitive. Reality is frequently inaccurate.
The Guide is definitive. Reality is frequently inaccurate.
The Gulf War Diet Plan: Kuwait Watchers! --Simon.
The Guy With The Bubble Gum Machine Head - Satellite News
The Gypsy's Den BBS - Nothing works and nobody cares....
The HELL you say...
The Ham Radio Primer: Loudon Clear
The Ham Radio Primer: Loudon Clear*
The Hand of Tyr are perfect killing machines. -- Windtongue
The Harder you work . . . the luckier you get
The Harder you work . . . the luckier you get...
The Hardy Boys, the Barbie Twins, and the Vice Squad.
The Harper Valley Death Squad - Tom
The Hat Squad consoles her - Crow
The Hatfields and McCoys feuded to see who would get to do it.
The Hawaain disease.....lackanookie.
The He's dead, Jim! taglines are dead, Jim!
The Head of The Church of Humor is the Puntiff.
The Headlight is on! But no one is in the Cab!
The Hearbeat of America, that's todays IBM!
The Heathen run amok! - Otis Oracle
The Heaven's in their last throes of death
The Heck With Fuzzy Slippers! Just Give Me A Warm Cat On My Feet
The Hedgehog's Guide to the Galaxy
The Hidden Flaw Never Stays Hidden ...
The Hidden Surprise: Pam Perz
The Hidden Surprise: Pam Perz*
The High School bigshot! - Tom sings
The High Times corporate picnic - Tom on bikers
The Hillary Clinton IRA: In - $1000. Out - $100,000!
The Hillary Factor... Practice birth control PLEASE!
The HindenBorg - Safe Landings are Irrelevant!
The Hindenburg and Rush Limbaugh: Two explosive Nazi gasbags.
The History Of Exxon: Phil Errup
The History Of Exxon: Phil Errup*
The Hitchhiker: Juan Nalift
The Hitchhiker: Juan Nalift*
The Hittleman film empire started w/this movie - Dr. F
The Hive - Sidekick of Lord of the Pit.
The Hobby Pharm --< is now CompuPharm(tm)
The Holy Bible is "The Sporting News" of Christianity.
The Holy Roman Empire: neither holy, Roman, or an empire.
The Holy Spirit can replace our self-doubt with power.
The Holy Spirit gives us power to be better than we are.
The Holy Trinity IS a Biblically-supported concept.
The Holy Trinity of Rock: E-A-B, E-A-B-A.
The Holy Trinity: Danger mouse, Penfold, um.. Bananaman!
The Homeboy Shopping Network - Where Everything is For Sale!
The HoneyBorgers, To Wolf 359, Alice! To Wolf 359!
The Honeymoon is the time between "I do" and "You'd better!"
The Hooterville Seven - Crow on group of hicks
The Hostess will seat you now.
The Hound of Heaven is a Great Tracker
The House of the Heart Is Never Full.
The House of the Rising Pun - Tom on Chinese temple
The Housing Problem: Rufus Quick
The Housing Problem: Rufus Quick
The Hubbell works fine; all that stuff IS blurry!
The Hubble telescope is now searching for the Mars Probe.
The Hubble works fine...all that stuff IS blurry.
The Hunchback of Notre Dame's secret mantra: Oh mommy pat my hump.
The Hurrier I Go, The Behinder I Get! (PA Dutch Genealogist <G>)
The I'm not afraid of Skydiving by Hugo First.
The I, Robot Grooming/Bikini Waxing set - Dr. Forrester
The I-Way...Route RS232.
The I.R.S. must like poor people, it makes a lot of them.
The IBM PS/70: We'll keep trying until we get it right.
The IRS does it to EVERYBODY.
The IRS is proof that the Devil is Real. <=NOT when refunds come!
The IRS is to the people what pantyhose are to quick sex.
The IRS just called......They said it was urgent!
The Icarus Class starship had problems when it flew too near the sun.
The Ice Age cometh.
The Ides of March have come. Julius Caesar
The Illuminati are in turn ruled by... Barney the Dinosaur!
The Illuminati aren't out to get you. What was your name?
The Illuminati do not exist. Really. We're not kidding.
The Illuminutti are in turn ruled by... Barney the Dinosaur!
The Imperial and Rebel Alliance Sourcebooks - By West End Games
The Incompetent Bullfighter: by Gordon Bloody
The Incomplete Handbook (Class to Be Named Soon).
The Indifference conference has been cancelled due to lack of interest
The Indifference echo has been cancelled due to lack of interest....
The Industrial Revolution: Otto Mattick
The Industrial Strength BBS.
The Indy 500%: The slot through which a clerk draws your credit card.
The Insular Cases, 5 cases in the book, U.S. Supreme Court.
The Internet is the government's "Frankenstein"!
The Internet: Bring the Global Community into Reality
The Internet: Bringing the Global Community into being...
The Internet: Onramp to the Information Superhighway
The Invasion USA Orchestra - Crow
The Invid?! Where?!. . . )@*!@)!&@*#&#*&$%&#$*^$NO CARRIER
The Iraq Country Club - 18,000 hole golf course!
The Irish Heart Surgeon: Angie O'Plasty
The Irish Heart Surgeon: Angie O'Plasty*
The Irish In Israel: A Retrospective
The Irish are fair; they never speak well of one another.
The Irish ignore anything they can't drink or punch <old saying>
The Irish people do not gladly suffer common sense.
The Irish use 2 condoms to be sure, to be sure.
The Isaac Asimov Body Splash - Dr. Forrester
The Isuyu Sosumi - Drive the car lawyers love to drive.
The JABBER crisis: "But it worked in Beta testing!"
The Jabberwock, with eyes of flame
The Jack Butler tagline collection, coming soon on CD ROM.
The Jack Nicholson Courtesy Driving School - Tom/#606
The Japanese call us lazy, but at least we cook our fish!
The Japanese grow up to be small, so they can fit in their country.
The Japanese have created a word to mean vomit: Bushusuru.
The Japanese just inproved bungee jumping--CORDLESS!
The Japanese may call us lazy, but at least we cook our fish!
The Japanese say Canadians are lazy... HAH! We cook our fish!
The Japanese speak a funny language - French or something.
The Japanese speak a funny language - sounds like French or something.
The Japanese way of Death - by Harri Kari.
The Jay Leno gang! - Crow on dorky bikers
The Jayne Mansfield story - Tom as blonde's car swerves
The Jedi Knights were the guardians of peace and justice
The Jedi are extinct...their fire has gone out of the universe...
The Jem'Hadar blew up my ship and all I got was this lousy T-shirt!
The Jerull Holy Empire: You shall be converted, or crushed.
The Jester will prevail! Death to All the Tyrants!!
The John Bobbitt doll (Some assembly required)
The Joy of Sax - Jazz Music in the Late 20th Century. -SLR
The Joy of Sax: Jazz music in the Late 20th Century.
The Joy of Six - Child Prodigies.
The Joy of Sox - Boston and Chicago Baseball Players.
The Joy of Sox - Boston and Chicago Baseball Teams.
The Joy of Sux - The History of the Electric Vacuum.
The Joy of Sux - The History of the Electric Vacuum. -SLR
The Juicer - the only way Windows will ever be fluid.
The Jundland wastes are not to be traveled lightly. - Obi-Wan
The Jupitarians have landed, and they brought the kids.
The KKK is a landfill that only takes white trash.
The Kakapo is the only flightless Parrot.
The Kansas State Library burned.....both books destroyed.
The Kennedy Constant: Don't get mad -- get even.
The Kennedy Constant: Don't get mad get even.
The Kennedy Family's Favorite Sex Position - defendant.
The Kennedy family's favorite sexual position: Defendant.
The Kennedys' favorite sexual position: Defendant!
The Kentucky Cycle has more Hawaiin locations - Crow
The Kernighan & Richie Virus: "C" sickness.
The Killer Ducks are coming!!!
The Kin of the Rat deserve our respect. -- Belle, Bone Gnawer
The King is a Fink!
The King's English" was not originally meant to be complimentary.
The King, Nope not Richard Petty, Guess again!
The Klingon Empire demands a CFL franchise! - Sign at '94 Grey Cup
The Klingon Prime Directive: "Shoot it."
The Klingon Prime Directive: "Shoot it."
The Klingon that can be Romulan is not the true Klingon.
The Klingons have taken over the Romulan Empire. - Picard
The Klingons on the starboard bow, scrape them off Jim!
The Kraft Report: "first thing we do; fire all the safety inspectors.
The Kurgan, he is the strongest of the Immortals. - Ramirez
The Kzinti warrior leapt for the tlhIngan's throat; a worthy opponent!
The L.A. riots of 1992 : Shaka when the malls fell.
The L.A. riots of 1992 : Shaka ... when the malls fell.
The LA Lakers' Breakfast: Kareem O'Wheat
The LA Lakers' Breakfast: Kareem O'Wheat*
The LAN of Nod was Cain's first primitive one computer network.
The LAPD ----- Treats ya like a KING .........
The LEAST dangerous man in America!
The LEAST government is the BEST government.
The LITE F.M. And now, here's FIST - Tom
The Lab called,..... Your brain is ready!
The Lab called. Your brain is ready, Geco!
The Lab called. Your brain is ready, He!
The Lab called. Your brain is ready, Pangborn!
The Lab called. Your brain is ready, Peter!
The Lady Pirate: Peg Legg
The Lady Pirate: Peg Legg*
The Largest and the BIGGEST street gang in the World ...L.A.P.D.
The Last Borg Scout - Starring Patrick Stewart as Locutas.
The Last Borg Scout - Starring Patrick Stewart as Locutus
The Last Of The Independants...
The Last Roundup: Brandon Irons
The Last Roundup: Brandon Irons*
The Lava Boat - Tom
The Law is your friend... but watch out for the Lawyers.
The Law is your friend..but watch out for the Lawyers.
The Law of Fives is never wrong.
The Law of Selective Gravity (The Buttered Side Down Law)
The Law of Unintended Consequences carries it own penalties...
The Laws of Nature have no pity. -- Heinlein
The Lazybowl - Reclining toilet seat with foot rest.
The Leader May Not Be Challenged During Wartime.
The Leafs are on TV? Nahh...I'd rather watch hockey!
The League of Non-Aligned Worlds
The Lean, Mean, Reading Machine...
The Legacy of Bigfoot
The Legend of Boggy Creek had more depth - Tom
The Legend of Curly Joe Dorita's Gold - Mike
The Legend of Dina Shore? - Tom
The Legendary "Foul Mouth Bass" - Ren.
The Legends of Taglines Collectors Series #2: Gary Caplan.
The Legends of Taglines Collectors Series #3: Myra I Fox.
The Liberal Hot Line: 1-900-WEL-FARE ($25 per minute).
The Light at the End of the Tunnel Could be a flame thrower
The Light at the End of the Tunnel Could be a flame thrower.
The Lily, Thistle, Shamrock, Rose/ The Maple Leaf, forever!
The LimBORG have neither honor or accurate information.
The Limbaugh Zone: No thinking allowed.
The Limborg have neither honor, nor accurate information.
The Lion Attacked: Claudia Armoff
The Lion King made $200 million in 33 days, second to Jurassic Park.
The Lion King rules Canadian box office, $15.7 million -Toronto Star.
The Liquidator...liquidates with his tongue.
The Little Computer That Could..."Icon compute..Icon compute."
The Little Creatures Of Nature...They Don't Know That Their Ugly!.
The Little Engine that Could Becomes intoxicated and Kills Civillians.
The Lollypop. It's just been commissioned. It's a good ship. - Riker
The Long Walk Home. Actually it is - Tom as girl walks
The Loonie: I sheathe my long sword and kiss the ogre on the lips!
The Lord _Used_ To Work In Mysterious Ways, Now He Works In Subspace.
The Lord also will be a refuge for the oppressed-- Psalm 9:9
The Lord giveth - the government taketh away.
The Lord giveth and Clinton taketh away
The Lord giveth, the Lord taketh away. Fickle, fickle Lord.
The Lord is a great God, and a great King above all gods. - Ps. 95:3
The Lord is my helper, and I will not fear what man shall do unto me.
The Lord is my light, then why should I fear?
The Lord is my light.
The Lord is my shepard- Psalm 23:1
The Lord loves a hangin', that's why he gave us necks.
The Lord preserveth all those that love Him. - Psalm 145:20
The Lord {is} my shepherd; I shall not want. (PSA 23:1)
The Lorena Bobbitt virus: Turns your 5.25" disk into a 3.5" floppy!
The Lottery: A tax for people who don't understand statistics!
The Lottery: A tax on people who don't understand statistics!
The Lotto has ended because of an large jackpot!
The Love Trek, exploring new feelings. Come aboard...
The Lucky Stiff Funeral Home: We put the FUN back in funeral...
The Luggage said nothing, but louder this time.
The MANOS: HAM OF FATE RUBEN! - Mike on deli menu
The MERIT STONE-WHEAT CRACKERS - Frank orders lunch
The MONTI-CHRISTO-MARKHAM - Mike on deli menu
The MR. B NATURAL-DIET PLATE? - Mike on deli menu
The MS died get the DR Dr Dos 6.0!
The Macintosh! Argh...
The Mad Scientist Masculine Hygiene Mist - Dr. Forrester
The Mafia hitman is taking you for a ride: a slay ride.
The Magic of Windows 95 can be yours for only $3000!
The Magic of Windows 95: Turns a Pentium into an XT.
The Magic of Windows: Turns a 486 back into a PC/XT.
The Magic of Windows: Turns a 486 back into an XT.
The Magic of Windows: Turns a 486 into a XT.
The Magic of Windows: Turns a 486 into an XT
The Magic of Windows: Turns a P6 into an XT.
The Magic of Windows: Turns a 486 into a XT
The Magic of Windows: Turns a 486 into an XT.
The Magic of Windows: Turns a Pentium-100 into a 4MHz XT...
The Magical Mystery Tour is waiting to take you away. -Beatles
The Magical Mythstery Tour
The Maintainer's Motto: If we can't fix it, it ain't brok
The Major Kira Nerys Virus ITS HIGHLY VOLATILE!
The Major Kira Nerys Virus- It's HIGHLY Volitile!
The Major Kira Nerys Virus. ITS HIGHLY VOLATILE!
The Major Kira Nerys Virus........ITS HIGHLY UNSTABLE!
The Major Kira Virus..."IT'S HIGHLY VOLITILE!"
The Majority is never right; unless it includes me
The Male rite of passage: Writing your name in the snow.
The Man Who Sold The Moon by Robert A. Heinlein
The Man of Steel just hates industrial electromagnets.
The Man wants eleven dollar bills, 'n you only got ten.
The Management of this Establishment is not Responsible.
The Management reserves the right to serve refuse to anyone.
The Manson Family home videos - Tom on bikers
The Many, The Same, The Invid!
The Maquis: A haven for all manner of spies.
The Marine Sex Manual: IN - OUT. Repeat if necessary
The Marines are looking for a few good transexuals?
The Mars Probe was programmed with EDLIN.
The Martian canals were the Martians' last ditch effort.
The Martians are a happy people; they have no lawyers.
The Mary Jo Copechtne Memorial Bridge - Crow
The Masked Avenger Cow is eliminated - Tom
The Math of Love: 1+1= everything. 2-1= nothing.
The Matt Decker Award for over acting
The Maxx's menubar: File Edit Glower Mumble Destroy SwitchToOutback
The McDonald's has burgers, for those who buy them.
The McJagger - made from cow lips.
The Meaning of Life: Do#$%^&*#NO CARRIER
The Meek Don't Want It
The Meek Shall Inherit The Earth, The Rest Of Us Will Go To The
The Meek Shall Inherit the Earth... We're heading for the stars!
The Meek Shall Inherit the EarthWe're heading for the stars!
The Meek shall inherit the earth, after probate.
The Meek shall inherit the earth, but I'll have fun until they do.
The Meek shall inherit the earth, but the inheritance taxes will be prohibitive.
The Meek shall inherit the leftovers!.
The Men Who Hold High Places Must Be The Ones To Start..
The Method: The casting out of false prophets.
The Microsoft Network Can you hack it?
The Microsoft Network Gates of bogosity.
The Microsoft Network Not quite a Marvel.
The Microsoft Network Vaporware online!
The Military Salute now uses a much limper wrist...
The Milling About festival - Tom
The Million Eyes of Subaru - Tom
The Minbari are an intergalactic problem waiting to happen...
The Miracle Drug: Penny Cillin
The Miracle Drug: Penny Cillin*
The Miss Macross Pageant was FIXED! There is no other possible way!!
The Missionary Man, he was followin' me...
The Mississippi is the nation's sewer, and Louisiana the septic tank.
The Mob And The Government Are No Different
The Mob Squad - Crow
The Mob has many heads, but no Brains..
The Moderator gave me clearance to talk about ANYTHING!
The Moderator had a full quota of *fresh meat* _last_ week.
The Moderator has a longer attention span than my tagline file.
The Moderator hasn't placed it off topic yet. - Don Horton.
The Moderator here doesn't bother anyo.@#$% NO CARRIER
The Moderator is Dead. Long Live the Moderator.
The Moderator is God, and there is no God except the Moderator
The Moderator is NOT God! God has mercy!
The Moderator is dead. Long live the monitor.
The Moderator is the Court of No Appeal!.
The Moderator makes *toast* of those who don't *post*.
The Moderator needs a Moderator!
The Moderator's back, we'd better kill this conversation.
The Moderator's personal handbook of "on topic" discussions,of course!
The Moment of Conception: ( -> )-+
The Monkey Cage: Jim Panzee
The Monkey Cage: Jim Panzee*
The Montreal Canadiens kick ice!
The Moon. Yes, That will be my home.
The Moral Majority is NEITHER!
The Moral Majority is neither.
The Moral Majority isn't moral nor is it the majority.
The Moral is: Never EVER trust a Draft-dodger!
The More You Suffer, The More It Shows You Really Care...
The Morgors, like Death, were without art.
The Mormon Guide To Alternative Sex
The Morning Zoo: 1983-1991 R.I.P. And GOOD RIDDANCE!
The Morpork Sunshine Sanctuary for Sick/Lost Dragons
The Morris Dance is common to all inhabited worlds in the multiverse.
The Mosquitoes in Minnesota are so big they made it the state bird!
The Most Dangerous Thing: A second lieutenant with a map.
The Most Popular People Are Cooks! The Most Overworked Also!
The Mother of All Taglines
The Motorcycle Dude Wants You to Look Left then Right,Then do it Again
The Motorcycle Dude Wishes For Every One To Ride Safe And Enjoy Life
The Mule conquered Both the First & Second Foundations simultaneously
The Murphy Philosophy: Smile, tomorrow will be worse.
The Music Of Sammy Davis Jr.: Candy Mann.
The Music Of Sammy Davis Jr.: Candy Mann
The Mutants are Dead. The Mutants are History.
The Mystery Man came over and he said "You're outta sight".
The NAACP: an organization for discriminating people.
The NAZGUL are dead ringers.
The NBA's best announcers double as a warm hearty meal.
The NET...Love it - or LOG-OFF !
The NEW Doctor McCoy! He's a doctor--AND a floor wax!
The NEW Tachyon-Modem -- downloads files before you dial out!
The NEW WWF GenerationOn top of the hill, not over it.
The NEW XT EMULATOR! MicroSoft Windows NT
The NFL is suing the CFL 'cause they use yards too
The NHL: The No Hockey League!
The NRA stands for CRIME PREVENTION and FIREARMS SAFETY! JOIN US.
The NSA doesn't exist. Just ask them.
The NSA is watching y#$% NO CARRIER
The NSA is watching yj#@$(%& NO CARRIER
The Name "Mustang" on an LX is a sign of Fords stupidity!
The Names Project.....
The Nanites have *lawyers?*
The Narn are falling before us. - Londo
The Narn do seem to be a most...passionate people. - Lennier (B5)
The Narns are like the Natoth. Smelly - Centari
The National Football Conference: Winner of 10 straight Super Bowls!
The National League-Where REAL baseball is played!
The National Procrastinators Week will be rescheduled...
The National Registry of Historic Hideouts - Crow
The National Science Foundation: Grant Money
The National Science Foundation: Grant Money*
The Navel Dept. has a hand in it - Crow on girl's tummy
The Navy Seals are here - Tom on Mongols in water
The Navy! Not just a job! It's a date!
The Navy, it's not just a job...it's losing track of weekends!!
The Navy. Hundreds of years of traditions ... in really screwing up.
The Nebraska State Forest - Crow on desolate landscape
The Necronomicon must not fall into the hands of the deadites!
The Necrotelecomnicon: Book of telephone numbers's of the dead.
The Negative orgasm: "Oh no, Ohh nooo, OH NOOO !"
The Negative orgasm: "Oh no, Ohh nooo, OH NOOO !"
The Network Consultants Full Employment Act of 1990. Windows 3.x -
The New "Clinton" 104 0-EZ Form: A) Bend Over B) Insert Here
The New Age is just like the old age--only newer.
The New Chrysler Presidential Car: The Dodge Drafter.
The New Gay Slogan: 2Q2BSTR8
The New Gay Slogan: 2QT2BSTR8
The New NRA...A Granny with a GUN soon puts gun-grabbers on the run!!
The New World Order.......Now playing in your neighborhood.....
The New York Yankees: 33 Pennants, 22 World Championships. THE Team.
The Next Aussie Anthem: Waltzing with Jadzia
The Next Skull On The Necklace Is Mine
The Nightcrawler's waiting for you. - LaCroix
The Nine Billion Names Of Tom Servo: Don Servo.
The Nine Billion Names Of Tom Servo: Tolchetomethuenicazit.
The Nine Billion Names Of Tom Servo: Tom Survo.
The Nine Billion Names of Tom Servo: Bob Balaban.
The Nine Billion Names of Tom Servo: Clod Merlot.
The Nine Billion Names of Tom Servo: Com Earlobe.
The Nine Billion Names of Tom Servo: Deus Servomachina.
The Nine Billion Names of Tom Servo: Hod Velcro.
The Nine Billion Names of Tom Servo: Hop Curlew.
The Nine Billion Names of Tom Servo: Hop Sterno.
The Nine Billion Names of Tom Servo: Joe Servo.
The Nine Billion Names of Tom Servo: Knock Pearljam.
The Nine Billion Names of Tom Servo: Lob Siltloam.
The Nine Billion Names of Tom Servo: Mob Neverball.
The Nine Billion Names of Tom Servo: Mom Germwall.
The Nine Billion Names of Tom Servo: Nod Earful.
The Nine Billion Names of Tom Servo: Paul Anka.
The Nine Billion Names of Tom Servo: Ptahm Syrvault.
The Nine Billion Names of Tom Servo: Ron Purloin.
The Nine Billion Names of Tom Servo: Tawn Hermo.
The Nine Billion Names of Tom Servo: Tham Shrivo.
The Nine Billion Names of Tom Servo: Tom Cyrveaux
The Nine Billion Names of Tom Servo: Tom Serbia.
The Nine Billion Names of Tom Servo: Tom Serbol.
The Nine Billion Names of Tom Servo: Tom Service.
The Nine Billion Names of Tom Servo: Tom Sirvio.
The Nine Billion Names of Tom Servo: Tom Syble.
The Nine Billion Names of Tom Servo: Top Sirloin.
The Nine Billion Names of Tom Servo: Tum Serpico.
The Nine Billion Names of Tom Servo: Bob Balaban.
The Nine Billion Names of Tom Servo: Clod Merlot.
The Nine Billion Names of Tom Servo: Com Earlobe.
The Nine Billion Names of Tom Servo: Deus Servomachina.
The Nine Billion Names of Tom Servo: Don Servo.
The Nine Billion Names of Tom Servo: Hod Velcro.
The Nine Billion Names of Tom Servo: Hop Curlew.
The Nine Billion Names of Tom Servo: Hop Sterno.
The Nine Billion Names of Tom Servo: Joe Servo.
The Nine Billion Names of Tom Servo: Knock Pearljam.
The Nine Billion Names of Tom Servo: Lob Siltloam.
The Nine Billion Names of Tom Servo: Mob Neverball.
The Nine Billion Names of Tom Servo: Mom Germwall.
The Nine Billion Names of Tom Servo: Nod Earful.
The Nine Billion Names of Tom Servo: Paul Anka.
The Nine Billion Names of Tom Servo: Ptahm Syrvault.
The Nine Billion Names of Tom Servo: Ron Purloin.
The Nine Billion Names of Tom Servo: Tawn Hermo.
The Nine Billion Names of Tom Servo: Tham Shrivo.
The Nine Billion Names of Tom Servo: Tolchetomethuenicazit.
The Nine Billion Names of Tom Servo: Tom Cyrveaux
The Nine Billion Names of Tom Servo: Tom Serbia.
The Nine Billion Names of Tom Servo: Tom Serbol.
The Nine Billion Names of Tom Servo: Tom Service.
The Nine Billion Names of Tom Servo: Tom Sirvio.
The Nine Billion Names of Tom Servo: Tom Survo.
The Nine Billion Names of Tom Servo: Tom Syble.
The Nine Billion Names of Tom Servo: Top Sirloin.
The Nine Billion Names of Tom Servo: Tum Serpico.
The Nine Planes Cookbook.
The No-Win Tagline: ===__-+- *-=/__ *-/__ *-=/__
The No.2 pencil is mighter than the ink pen.
The Norsemen never wrote home - when Odin found out, they were Runed.
The Norsemen never wrote home, and when Odin found out, they were Runed.
The Norsemen never wrote home, and when Odin found out, they're Runed.
The Norsemen never wrote home-and when Odin found out they were Runed
The Norwegian Blue prefers kippin' on its back!
The OCA is perverse and unnatural
The OFFICIAL Recipe of the 2000 Sydney Olympics Bid!
The OFFICIAL recipe of the 1996 Olympics!
The OFFICIAL tagline of the 1992 World Series Champions!
The OFFICIAL tagline of the 1996 Olympics!
The OFFICIAL tagline of the 1996 Special Olympics!
The OFFICIAL tagline of the 2000 Olympics!
The OFFICIAL tagline of the 2000 Sydney Olympics Bid!
The ONLY good cat is a stir fried cat - Alf
The ONLY good cat is one embedded in my tire tread!
The ONLY sporting use protected by the 2nd Amendment: Tyranticide!
The ONLY thing better than being in love is loving.
The ONLY thing constant is change... Hmmm
The OR is not supposed to be some kind of coffee klatsch! - Frank
The ORB! Of *course*, what else? -- Bowler
The OTHER planets have no life!
The Ocean is/as is/as is/as the endless sigh of dreaming
The Odd couple: A Deaf man and a blind woman.
The Odo burger: It's a shake; it's a burger; it's fries.
The Official Offline Reader of The Lunatic Fringe!
The Old Republican Health Plan: PRAY YOU DON'T GET SICK!
The Olympics are for lugers.
The One Minute Mafia - Mike
The One Who Dies With The Most Women In His Harem Dies Happy.
The One with The Answer is seldom asked The Question...
The Only On-Screen Relevant ICCL Tagline : ==_-=- -=-=__
The Only Self Cleaning thing in this house is My Cat!
The Oo-Ah bird is so-called 'cause it lays square eggs. "OO! AH!"
The Oo-Ah bird is so-called because it lays square eggs.
The Operating System is mightier than the User.
The Opinion of Man is no substitute for the Word of God.
The Opinions presented are not necessarily those of Management.
The Optimist: A Mac salesman with a pager
The Oracle has pondered your question deeply.
The Origami SIG will not meet this week. It folded.
The Original Multitasker=Two PCs and a chair with wheels!
The Original dBase dGenerate
The Origional Series ...No bloody TAS, TMS, TNG, DS9, ..or..VOY..
The Orville Bullitt School of Tagline Thief--Creative Acquisition?
The Orville Channel!
The Orville School of Tagline Thief--Creative Acquisition?
The Orville that can be described is not the true Orville.
The Orville-miester, makin' copies.
The PARITY CHECK is in the E-MAIL!
The PC is down. I hope it's something serious.
The PC you *want* always costs $5,000. <g>
The PEN is mightier than the SWORD? Where's the 15 day waiting period?
The PS/2 Family: Yesterday's hardware today.
The PS/2 Mod 50 was designed on a Monday.
The PS/2 Model 30-286 was designed on a Monday
The PS/2 Model 30-286 was designed on a Monday.
The PTA reminding you to always do your homework - Crow
The Pac attack is back, jack!
The Packers back in '68...Now THERE was a team! - Tom
The Palace Roof has a Hole: Lee King
The Palukoo exploded & the Bajorans realised it was a Cardassian plot.
The Paper Route: Avery Daye
The Paper Route: Avery Daye*
The Park! in Waco - Quantum Leap HQ for Central Texas!
The Past, Present & Future of Networking.
The Path of Progress: shortcut is the longest distance between 2 points
The Paul Anka Mass - Mike as Anka sings "Ave Maria"
The Peace Mission: Olive Branch
The Peace Mission: Olive Branch*
The Pedigree of Honey / Does not concern the bee --
The Peggy Noonan gang - Mike
The Pentagon calls peace "permanent pre-hostility"
The Pentium is one hot computer - it melted my linoleum.
The Pentium's replacement chip: The Repentium!
The Perils Of Drug Addiction - by Anita Fixx
The Perils Of Drug Addiction: Anita Fixx
The Perils Of Drug Addiction: Anita Fixx*
The Phantom Spitter was here *.
The Phillipine Post Office: Imelda Letter
The Phillipine Post Office: Imelda Letter*
The Philosophy Shop -- Your source for discounted ideas
The Pig Riders Of Perm
The Pink Panther surfs the Blue Wave.
The Piper at the Gates of Dawn
The Pizza Dominatrix! - Tom on stern looking girl
The Planet of No Continuity - Crow
The Planets Collection - By West End Games
The Pledge of Allegiance does NOT end with, "Hail Satan".
The Pledge of Allegiance does not end with Hail Satan
The Pledge of Allegiance does not end with Hail Satan -Bart Simp./1F16
The Pledge of Allegiance does not end with Hail Satan -Bart Simpson/1F16
The Pledge of Allegiance does not end with Hail Satan. --Bart Simpson.
The Poles are now telling free market jokes.
The Police DO IT at Dunkin' Donuts.
The Police Station: The hot new disco - Mike
The Politically Correct John Bobbit: Genitally Challenged
The Politically Correct John Bobbitt: Genitally Challenged
The Politician's Diet: Crow, Limburger and Hogwash
The Politician's Diet: Crow, Limburger and hogwash
The Poor? The Poor? I love the Poor. Pull!
The Pop-up Book of Human Anatomy:
The Pope lives in a vacuum.
The Porn Queen: Mona Lott
The Porn Queen: Mona Lott*
The Post Office is being run like NOBODYS business.
The Post Office just gave Pavarotti a new area code.
The Post Office just gave Pavarotti a new aria code.
The Potsy Story - Mike
The Powerglide XL440 adaptor plate - Tom on robot part
The President Doll-Wind it up for four years and it does nothing
The President announced today that UFOs are&*#@ NO CARRIER
The President announced today that UFOs are...
The President cleans up his OWN house FIRST.
The President has no specific cuts in mind - Stephanopoulos
The President sucks - And boy does her husband love it!
The Presidential address is pre-empted for the OJ Simpson trial!
The Price is Right. COME-ON-DOWN and do it.
The Prime Directive is preached by Picard - drink!
The Prime Directive is preached by someone else - 2 drinks!
The Problem with Beavis and Butthead is which one is Clinton?
The Problem with Bevis & Butthead is which one is clinton
The Problem with Political Jokes is they get Elected.
The Procrastinator's Meeting has been postponed.
The Procrastinators Anonymous meeting has been postponed indefinitely.
The Procrastinators Anonymous meeting has been postponed.
The Procrastinators Anonymous meeting was postponed indefinitely ...
The Prophecies of Monikastradamus ...
The Prophets have taken over my computer!!
The Prophets tell us not to use Windows, my child. --Kai OS/2
The Psi Corp is your friend. Trust the corp.
The Psi Corps Is Your Friend. Trust The Corps.
The Psi Corps is your friend. Trust the Psi Corps.
The Psi-Corps: We're everywhere...for your convenience.
The Pullman Sleeper: Bertha Buv
The Pullman Sleeper: Bertha Buv*
The Puppet Masters by Robert A. Heinlein
The Purple Pedophile must die!
The Purple Stream : by I.P. Peculiar
The Pussy Lifesaver! Do you need Rescusitation?
The Q Continuum does it any way they want.
The Q and the Proud. Q forms a galactic military organization.
The Q entity, sir. - Data.
The QWK brown FOX jumped ver the ez dogs bnu's.
The Quebec Bra: Lifts AND Separates!
The Queen Mother could heat up a room more'n this - Crow T. Robot
The Quest for a better tagline continues.
The Quest is the Quest. --The Doctor, "Underworld"
The RCMP always get their man, it's the women they have trouble with.
The REAL computer user's ONLY icon: C:>
The REAL masterminds of Iraq;Souter&Neal Bush
The RINGWORLD isn't unstable...it's dynamically challenged!
The RINGWORLD isn't unstable...it's mathematically challenged!
The Rabbit Rule: Only newlyweds and liars make love every day.
The Raiders; the most winningest team in pro sports history....
The Rainy Day Fun Book of Cod Pieces - Crow
The Ranger isn't going to like it, Yogi.
The Ranger isn't gonna like it, Yogi.
The Rangers are on TV? Nahh...I'd rather watch hockey!
The Real Canadian DOS Prompt (per a Canadian)______EH?:\>
The Real Canadian DOS Prompt-----------------------EH?:\>
The Real Canadian DOS Prompt-----------------EH?:\<
The Real Enterprise is NCC-1701-No A,B,C,or D
The Real World - Super Computer
The Real World: A comedy for thinkers; a tragedy for feelers.
The Recipe says a pinch of spice. I thought it said a 'pound'.
The Red Zone is for Cuba & Un-Cuba only - Tom
The Redneck national anthem: "Gentlemen, start your engines."
The Reds are up to bat here, too! - Potter
The Redundancy Syndrome - Joel on repetitious effect
The Reflexive Property of Mathematics: a = a
The Religious Reich, where hatred is a Family Value!
The Religious Right are a bunch of NUTS - Barry Goldwater, 1994
The Religious Right's Health Plan...Kill a doctor!
The Religious Right's health plan: kill the doctors.
The Rennaisance Festival: we'll annoy you by sundown -Tom
The Republican Health Care Plan: Don't Get Sick!
The Republican emblem is an elephant... we never forget.
The Republican response. Sorry Mr. President, the sky is not blue.
The Republican view of America looks like the Klingon Empire.
The Republicans want to destroy Amendment 1, 4, 5, 6, 7, and 8.
The Results of your IQ test came back. They're negative.
The Resume Rule: Anyone can be made to look good on paper.
The Return of the Son of the Monster Magnet..
The Rev Smith spoke briefly, much to the delight of the congregation.
The Reverse Picard Maneuver - with a skirt.
The Right to Keep and Bear Arms is, essentially, the Right to be FREE!
The Ringworld isn't unstable, it's mathematically challenged.
The Road goes ever on and on...
The Road to Amber --- is difficult. <Florimel>
The Road to Enlightenemnt is long & difficult so bring lots of snacks.
The Road to HELL is paved with GOOD INTENTIONS!
The Road to Hell is paved with honorable intentions. [Jw]
The Road to Liberty Is Paved with the Brave... Please Lie Here.
The Roadkill Cafe presents Chicken that didn't cross the road.
The Roadkill Cafe: "You kill it...we grill it."
The Rock in Betty Lou's panty hose! - Crow
The Rockford Files: European Vacation. -- Tom Servo
The Rodney King Institute of DEFENSE! Send $20.00 for FREE Brochure.
The Rodney-us King-us verdict just came in - Crow
The Roissy International Resort Chain--with REAL chains!
The Rolling Stones by Robert A. Heinlein
The Roman Rule: The one who says it cannot be done should
The Ron and Nancy Reagan Home Computer: No colon, no period, no memory
The Roseanne Barr Diet: One meadow per day.
The Royal Canadian Mounties always get their man.
The Royal Shakespeare Company presents: "Gay Boys in Bondage"
The Ruptured Chinaman by Wun Hung Lo
The Russian Butcher, by Ivan Cutchakockoff.
The Russian Express Card: "Don't leave home!"
The Russian Lorainna Bobbit: Lorainna Cutchapeckerkoff.
The Russian is a delightful person till he tucks in his shirt.
The Russians aren't coming ! The Russians aren't coming !
The Ruth Buzzi line of leather & PVCs - Crow
The S.G. has determined that Windoze is bad for your mind
The SCA: We have archaic and eat it too!
The SCA: where they take their aristocracy SERIOUSLY! -L. Niven
The SD70MAC - this isn't your father's SD40-2!
The SDF-1 has more firepower than this bucket of bolts!
The SFB Andromedan Tagline: o O () ( ) (o ) (ooo )
The SFB Federation Tagline: ~==- _-+- __-=- ~~-=- ==_-=- ==__=-=-
The SFB ISC Eschelon Tagline: <([E- <(E- <E- <E <- :::
The SFB Klingon Tagline: =-* _=-* _=--* __==--* __==_=-*
The SFB Kzinti Tagline: => `, =D `, #=D `,`, #==D `,`, ##==[D `,
The SFB Lyran Tagline: _-- _=- _==- ~-_==- __===- ~~-_===-
The SFB Romulan Tagline (cloaked):
The SFB Tholian Tagline: <> <>> <X>> ==<> #=<> ##=<>
The SID TUNA-MELTON with MONKEY-BOY FRIES - Crow
The SONAR the better - Crow
The STEALTH CONDOM<tm> -- "They will never see you coming"
The Sage fusses over nothing and thus spoils nothing.<Lao Tzu>
The Same thing we do every night Pinky, Try to takeover the world!
The San Andreas fault,the most stable thing in California.
The San Francisco Ku Klux Klan wears topless sheets.
The Sand Man couldn't make it... I'm the Quick Drying Cement Man.
The Sandman: "Dreams of Dragonfire"
The Sandman: "Exit light, enter night..."
The Sandman: "Master of Dreams"
The Sandman: "We're off to Never-Neverland."
The Sandman: "Dreams of Dragonfire..."
The Satellite of Love is Unstable! The Satellite of Love is Unstable!
The Scantily Clad City - Mike
The Scenery continually changes for the lead dog.
The Scent Of A Man: Jim Nasium
The Scent Of A Man: Jim Nasium*
The Scent of Sensuality, by Mike Hunt
The Schizophrenic: An Unauthorized Autobiography.
The Schwartzkopf Slim-Fast diet, One Week and We'll take off Kuwait.
The Scouse SuperHighway ............ the way of all flesh ........
The Scout of today is the leader of tomorrow.
The Sean Penn Story - Crow on Starfighters title
The Second Amendment guarantees the others.
The Second Amendment is in place in case they ignore the First One.
The Second Amendment is in place in case they ignore the others.
The Second Amendment is there in case they ignore the First.
The Second Amendment was burned side by side with the Davidians.
The Second Amendment: America's last defense against tyranny.
The Second Foundationers are nothing but a bunch of Mind Monsters!
The Second Law of War: Never march on Moscow!
The Second Law of War: Never march on Moscow!
The Second Rule of Program Optimization (for experts only!): Don't do it yet.
The Secrecy of my job prevents me from knowing what I do
The Secret Council -- The Spies of the Universe.
The Secret of Life can be found on page 135 of the Yellow Pages.
The Secret of Success: "Make light around you," said the fire.
The Secret of success is survival followed by growth!
The Secret of success is survival!
The Secret to Immortality is .%&@{ CARRIER LOST
The Semi-Nude Club - Crow on guys in locker room
The Senate Ethics Committee is an oxymoron.
The Senate Ethics committee dropping by unannounced -Crow
The Senior Prom: Spike Drink
The Senior Prom: Spike Drink*
The Seven (7) Dwarfs were in the bath feeling Happy, so he got out...
The Seven Borgs: Hi ho, hi ho, it's off to assimilate we go...
The Sex Maniacs Guide - by Rippernickerszov
The Sex was so good even the neighbors lit cigarettes afterwards..
The Sex was so good... The neighbors lit a cigarette...
The Shadow *knows*, Superman just guesses.
The Shadow Lords are truly trustworthy only when they are asleep.
The Shadows Know!
The Shadows have come for us all - Lady Ladira
The Shadows have come for us all!
The Shadows were old even when the Ancients were young. --Delenn.
The Shadows will move now, before we're ready. --Delenn.
The Shadows. The Shadows are coming for him - Lady Ladira
The Sheik Battles Bigfoot
The Sheriff of Nottingham lives in the WHITE HOUSE!
The Shortest Straw has been pulled for you!
The Shrinking Society: Les Ismoor
The Shrinking Society: Les Ismoor*
The Silence of the Teenage Mutant Dancing Wolves.
The Silent Majority isn't silent. The Government is deaf.
The Silent Majority of today are the slaves of tomorrow.
The Silver Cat is back!
The Simpson's represent the American family in all its horror.
The Singapore Sling: the bottom line on crime!
The Sinister Urge is a silly urge - Mike sings
The Sinister Urge is a stupid urge - Tom sings
The Sky Is Falling, Shut Up! The Ground is Flying!
The Sleeper Has Awakened.
The Smorgasbord: Buffy Dinner
The Smorgasbord: Buffy Dinner*
The Soft Parade, an ancient rustle of silk--Jim Morrison
The Soft Serve Murders - Tom
The Solution for Multilingual Messages
The Solution to a Problem Changes the Problem
The Sons of Soong are together at last...
The Sons of Soong have joined forces... - Data
The Soong Family: Lore, Data, Rumor, Innuendo, and Quote.
The Soviet Union does not exist any more in its present format.
The Soviet Union never had gridlock, and look what it got them.
The Soviet press is useful on hot days, said Tom fantastically.
The Specter Justice Net! Where Their Crimes Come Back To Haunt Them!
The Speed Of Time is approximately 1 second per second.
The Spice must flow...
The Spirit always speaks in harmony with the Word.
The Spiritual Life: Ned Itation
The Spot On The Wall: by Mister Completely.
The Spy Who Hugged Me - Crow's spec script
The Squeaking Gate: Rusty Hinges
The Squeaking Gate: Rusty Hinges*
The Stand: King's personal Vietnam.
The Stand: Makes a great doorstop when you're done reading it.
The Stand; King's personal Vietnam.
The Stand; makes a great doorstop when you're done reading it.
The Stanley Cup is coming home baby, where it belongs - Montreal!
The Stanley Cup? It's a good bet the Bruins know we're here.
The Star Trek Express Card: Don't leave orbit without it.
The Star Trek Saga - From One Generation to the Next!
The Star Wars Adventure Journal - By West End Games
The Star Wars Movie Trilogy Sourcebook - By West End Games
The Star Wars Sourcebook - By West End Games
The Stark Bumper of Retribution
The Stark Packet of Retribution
The Stark Plasma Rifle of Retribution
The State: friend to all, enemy of each one.
The Story of Wisconsin Sausage - Tom on title 'Bloodlust'
The Story of the Film So Far...
The Strom's haven't been gone long, the modem is still warm.
The Styrofoam Express Card: don't leave foam without it!
The Sugar Bear does it with Honey.
The Sun is at the center of the Universe. Copernicus
The Sun is at the center of the Universe. - Copernicus
The Surgeon General Has Determined That Life Causes Death.
The Surgeon General offered me a cigarette!
The Surgeon General should issue a warning about playing with women.
The Swartzberg Test: The validity of a science is its abi
The Sweat Shop: Hiram Cheap
The Sweat Shop: Hiram Cheap*
The Swedish Chef has been assimilated. "Borg borg borg!"
The Swedish Moses of Soul - Mike
The Swiss are armed. The Swiss are free and at peace. Think about it.
The Symbolic Cinematic Love Scene - Crow as planes dock
The SysOp probably disagrees with this user!
The Sysop *made* me do it!
The Sysop Of MY Board Is Better Than Yours!!
The Sysop doesn't know what I'm doi#&@#%$#% NO CARRIER
The Sysop has granted you unlimited download privleeches.
The Sysop has to hold the peace on both sides.
The Sysop of MY board is better than yours!
The Sysop wears a toupee.
The Sysop's Four Food Groups: Caffine, Chocolate, Sugar and Sex.
The Sysop's on vacation.
The TELIX.FBK's here! The TELIX.FBK's here! - S. Martin
The TMBG 1987 Bring Me the Head of Kenny Rodgers tour.
The TMBG 1989 Don't Tread on the Cut-Up Snake Tour
The TMBG 1995 That Pioneer Spirit Tour
The TMBG Grumpfest '90 Tour
The TRUTH - next, on the Rush Limbaugh program!
The TRUTH will set you free!!!
The TRUTH--next, on the Rush Limbaugh program! then i woke up.
The TRUTH-next, on the Rush Limbaugh program!
The TV News Anchorman: Maury Ports
The TV News Anchorman: Maury Ports
The TWOP objects under her T-Shirt are larger than they appear.
The Tagline Addict Strikes! (And your Hard Drive file area shrinks.)
The Tagline Echo - where Taglines ARE the message.
The Tagline I had was definately not appropriate!!
The Tagline I put here was too good sysop deleted it
The Tagline Olympics: "Moderator! Can I start over? My laces broke!"
The Tagline of Tommorrow............Today!
The Tagline scheduled at this time will not be shown...
The Tagline that unfreshes.
The Tagline you save, maybe your own.
The Tao is an empty vessel; It is used but never filled..Lao tzu
The Tao is near and people seek it far away. -- Menicus
The Tao of Crash Test Dummies - looking for a few good zen.
The Tao of Crash Test Dummies-looking for a few good zen
The Tax Dept can put the screws on you quicker than an undertaker.
The Tax Man Cometh...
The Telephone Exchange ... A unique experience.
The Telltale Heart: Stefi Scope
The Ten Commandments are NOT a multiple choice quiz!
The Ten Commandments are not multiple choice.
The Terminator Said It Best.
The Terok Nor echo is supposed to be a fun, happy thing. :-)
The Texas Legislature... the best YOUR money can buy!
The Theorem Theorem: If if, then then.
The Thick Chalk Years - Mike
The Thigh-Master is now the Die-Master! --Dr. Forrester.
The Third Law of War: Never, _ever_ attack the United States.
The Thirst for Knowledge is Never Ending!
The Three Faces of Steve - Crow on lunatic
The Three Food Groups: Frozen, Instant, and Take Out.
The Three Food Groups: Frozen, Instant, and Take Out.
The Three Rules of Social Intercourse:^It's easier to bel
The Three major Food Groups: Pizza, McDonalds and beer!
The Three worst words during sex: "Honey I'm Home!"
The Thunderbirds - The show that time forgot..
The Tidy Bowl Emmisary : Sisco in a Sailer Suit
The Tiger's Revenge by......Claude Balls
The Tiger's Revenge, by Claude Bawls.
The Tigers Revenge by Claude Balls
The Time is Always Right to do What is Right -MLK Jr.
The Toddler...an instrument of destruction
The Toe that can be stubbed is not the true Toe.
The Toilet, the clitoris and anniversaries - why do males miss all 3?
The Tongue and Chocolate were meant for each other!
The Tonya Harding doll: Assault and batteries included.
The Tooth Fairy is the main stockholder in C+H Sugar Inc.
The Tooth Fairy is the main stockholder in CSR Sugar
The Tortoise won by a Hair.
The Tower of Gourds Horn Section - Tom
The Tree of Novelty Items - Mike
The Trees are all held equal by hatchet, axe and saw. -Rush
The Trial never ends.
The Tribble with some taglines is 'there not funny!'
The Trill Is Gone Dax
The Trill Is Gone B.B. Dax
The Trill of victory; the agony of de feet.
The Trinity. Clinton, Gore, Tipper.
The Triune God is the only God
The Trix are for Kids monument - Mike
The Truancy Problem: Marcus Absent
The Truancy Problem: Marcus Absent*
The Truth IS Out There...Unfortunately, so is the government!
The Truth Is A Puzzle Combined With A Problem Wrapped In An Enigma...
The Truth Is Out There (we just haven't found it yet...)
The Truth Is Out There -- The X-Files
The Truth and The Outrageous often are hard to distinguish. - J Butler
The Truth is IN there.
The Truth is Out Therebut do we really want to know it?
The Truth shall set you free! But first it shall piss you off..
The Truth was out there... until my hard drive crashed!
The Truth: There's never enough beer, sex or disk space!
The Tsongas ended, but the malady lingers on.
The Tungu Meteor sandwich - Tom
The Twelfth Month: Dee Sember
The Twelfth Month: Dee Sember
The Twit Key: Three steps faster than the Moderator.
The Two Stooges: Curly, Moe...%$#@& - NO LARRY
The Two most feared words in AmeriKa: Ditto's RUSH!
The U. S. Constitution (C) 1791 All Rights Reserved
The U.F.O. hotline limits rednecks to one call per day.
The U.N. is *NOT* worth one drop of American blood.
The U.S. Congress, the best politicians money can buy!
The U.S. Congress: Our tax dollars at work.
The U.S. Constitution (c) 1791. All Rights Reserved.
The U.S. Constitution: The only lawful contract with America!
The U.S. Constitution: Void where prohibited by law?
The U.S. needs our water...... Flush Twice!
The U.S.S. Nimitz just expLo##m#+b++| NO CARRIER
The UART's can't take this speed, Captain!
The UART's will'na take this speed cap'n
The UART's won't take this speed, Captain
The UART's won't take this speed, Captain!
The UART's won't take this speed, Captain.
The UARTs can't take much more o' this Captain!
The UARTs won't take these speeds, Captain!
The UARTs won't take this kind of speed, Captain!
The UARTs won't take this speed, Captain
The UARTs won't take this speed, Captain!
The UN is NOT our friend!!!
The UNIX environment...a programer's eternal Purgatory.
The US Congress' reality check just bounced, too!
The US has much to offer the 3rd world war. -Reagan
The USA is bordered on the south by a truly amazing nation...TEXAS!
The USA was FOUNDED by religious nuts with guns!
The USC pool player's equipment didn't arrive on time, Tom calculated.
The USS Crazy Horse is arriving >CRASH< uh.. leaving Docking Pylon One
The USS Reagan -- "To boldly um I forget..."
The USS Reagan -- "To boldly ... um ... I forget..."
The USS Reagan...To bodly um I forget...
The USS Tolstoy was destroyed at Wolf 359.. I bet Tol was upset!
The Ukranian national anthem - Crow on odd soundtrack
The Ultimate Answer is: FORTY ONE POINT NINE NINE...!! (on a pentium)
The Ultimate Modem Init String - AT FORSALECHEAP
The Ultimate Modem Init String - ATFORSALECHEAP
The Ultimate OXYMORON for the 90's: "SAFE SEX!"
The Ultimate Oxymoron - - - Conservative Democrat.
The Ultimate office automation, Networked Coffee Machines
The Ultimate put down: "You have blonde roots."
The Umbilli-pod in the Umbilli-port - TV's Frank
The Unapplicable Law: Washing your car to make it rain doesn't work.
The Unbearable Darkness of Being... Undead.
The Unbearable Whiteness of Being - Mike on pale lovers
The Uncle Fester & Keith Moon School of Party.
The Uncle Fester & Keith Moon School of Partying.
The Undertaker's gone...NO BURIER
The Unfinished Tagl
The United Servo Academy Men's Chorale director - Mike
The United Servo Academy Men's Chorus - Mike
The United States borders on the magnificent ! CANADA !!
The United States borders on the magnificent...-> Canada!
The Universe is a big place... perhaps the biggest
The Universe is a big place... perhaps the biggest.
The Universe is a figment of it's own imagination.
The Universe is a little too darned orderly to be just a big accident.
The Universe is a lot safer if you bring a towel...
The Universe is over. We can all go home now.
The Universe is queer.
The Universe is run by the complex interweaving of 3 element
The Universe is stranger then we CAN imagine! - Arthur C. Clarke.
The Universe is under no obligation to make sense.
The Universe was dark & void. Then God removed the lens cap.
The Universe was dictated but never signed.
The Unknown Rodent: A. Nonny Mouse
The Unknown Soldier...better him than me. --Bill Clinton.
The Unpleasant Profession of Jonathan Hoag by Robert A. Heinlein
The Unthinkables, starring Wesley Crusher, MacGyver and The Professor.
The Usenet Oracle: Virtual Reality's Answer to Miss Manners on Acid
The Utney Reader editorial board - Tom on scummy guys
The V-Shaped diamond encrusted mummy thing - Crow
The VINCE VAN PATTY-MELT - Crow on deli menu
The Valdez was steered by a Windows program.
The Van Patten Project! - Crow's conspiracy theory
The Vatican Express Card. Don't leave Rome without it.
The Veil Shall Not Be Lifted.
The Video Machine makes the Toaster obsolete!
The Virgin Mary in my face oil! - Tom as guy with mirror
The Vogon Constructor Fleet coasted away into the inky starry void.
The Vogon ship hung motionless in the sky...
The Vogons are NOT the worst poets in the Galaxy, and I can prove it.
The Voice of America (1990's Style)..."WHERE'S MY E-MAIL?"
The Voice of the Furries: Fox Populi...
The Volkswagen Bug- 58 years in the making, and still going strong!
The Vorlons? I don't know what can pose a threat to them - G'kar.
The Voyager is built for action, and built for speed.
The Voyager? Toilet seat. Horseshoe crab. Salamander. Heart of Gold...
The Vulcan Death Grip causes the Bajoran Death Chant.
The Vulcans ATE my homework. (Better than Ponn Farr)
The Vulcans stole my homework. Then they ate Nog. -- Jake
The WINDOWS Everready Bunny: It's still loading...
The WIZ! is -not- mad. Kerplunk, kerplunk, fizzwibbly, ferrrrrtang.
The WIZ! suggests if you cant 'fumble' it out, RTFM
The WWF is running on DIESEL POWER!
The WWF is to sports what Spam is to meat!
The WWF is to wrestling what Spam is to meat!
The Wages of Sin DOUBLES your disk space!
The Wally Succubus's over on Oak Street? - Crow
The War On Drugs is a War on our Rights!
The War On Drugs is the greatest threat EVER to the Bill of Rights.
The War On Drugs: the greatest threat the Bill of Rights has ever seen
The War On Drugs: the greatest threat the Bill of Rights has ever seen.
The War on Drugs - America's latest Vietnam.
The War on Drugs is Lost! ABBA is available on CD!
The War on Poverty is over. Poverty won.
The Watchtower plants rotten trees which bear evil fruit.
The Wave... The totally cool way to do mail!
The Way! The Truth! and The Life!
The Weather Bureau is a non-prophet organization.
The Weather is here, I wish you were Beautiful!!
The Welsh do it very sparingly.
The Welsh dw ytt wyttht ysngg vwls.
The Whalers should apply their bar fighting abilities to hockey!
The Wheel of Time turns and ages come and go...
The Wheel weaves as the Wheel wills. <many>
The Whispered Rule: People will believe anything if you whisper it.
The White House: New Home of the Whopper!
The White House: The new home of the Whopper!!!
The Whole Justice System Is Rife With Injustice
The Wild Celt: Drink Guiness It is Good for You!!!!!
The Wild Celt: Drink Guinness It is Good for You!!!!!
The Wild Child BBS - Moving to Beaverton this summer!!
The Will of God is the sanctuary of ignorance. Spinoza
The William Tell Overture - Do they call it that because of the Lone Ranger?
The Windows Energizer Bunny: It's STILL loading! And loading
The Windows Eveready Bunny: It's still loading...
The Windows Mail Reader
The Windows folks wrote EDLIN. They can't be *all* bad!
The Wizard of Oz...The First SYSOP.
The Wizard rules, OZ!
The Wizard says.. "Go Away..!"
The Wizardry Compiled by Rick Cook [Melissa Garber?]
The Woman From AUNT...Solo's antithesis.
The Wonder Bra? Yeah, I got one for my beer-gut brother-in-law.
The Woods Are Lovely, Dark And Deep ...., But I Have Promises To Keep...
The Woody Allen Story - Tom on 'Date With Your Family'
The Word Pet is Spelled Wrong--It Should Be L-O-V-E.
The World is Flat!--Class of 1491.
The World is coming to an End. Please log off properly.
The World of Susie Wong, C.P.A. - Crow
The World's Best Recipes: Gus Tatorial
The World's Deadliest Joke: Theophilus Punoval
The World's Deadliest Joke: Theophilus Punoval.
The World's Dullest Subject: Somebody else's diet.
The World's Third Dullest Subject: Special Interest Liberation.
The World, a film which men devise--Jim Morrison
The World: A comedy for thinkers; a tragedy for feelers.
The Worlds not passing me by, its running right over me
The Wright Brothers had little to do with _this_ activity!!
The Writers Must Be Borgs! -- Story Concept Integrity is Irrelevant.
The Wyld is dying. Man is killing her. -- Jalisha, Black Fury
The Wyld sings its song of Endless Dawn -- Aether-Tongue
The X Files: Deny Everything
The X Files: The Truth Is Out There
The X Files: Trust No One
The X-Files: "Deny Everything."
The X-Files: "Government Denies Knowledge."
The X-Files: "The truth is out there."
The X-Files: "Trust no one."
The X-Files: Deny Everything.
The X-Files: Government Denies Knowledge.
The X-Files: The Truth Is Out There.
The X-Files: Trust No One.
The X-Files: Apology is Policy
The X-Files: Deny Everything.
The X-Files: EL 'AANLLGOO 'AHOOT'E.
The X-Files: Government Denies Knowledge.
The X-Files: The truth is out there.
The X-Files: Trust no one.
The X-Men vs. The X-Men (Again) with special guests... The X-Men!
The X.P.S.R.L. The Immortal Still Lives!
The Yankee spies are looking for my ancestors!
The Year my country broke...
The Yellow River by I. P. Freely
The Yellow Stream, by I. P. Daley
The Young Gladys Crabbits Chronicles - Mike
The Young Millie Helper Chronicles - Mike
The Zen monk says to the hotdog vender, "Make me One with everything!"
The [DELETE] key...Electronic White-Out.
The [Repeat] key is for repeatingrepeatingrepeatingrepeatingrepeatingrepeating
The [Space Bar]: A CyberNightClub.
The [human] species is capable of much affection.
The `H' stands for horrible, right? - Lister's Confidence
The `Poor Cat in the Rain' look. It never fails. - Rita
The ability to block out the unnecessary puts the goal within reach.
The above Statement is absolutely True. - God.
The above ain't a Tagline, it's a way of life!
The above ain't a recipe, it's a way of life!
The above does not necesarily reflect common sense.
The above does not necessarily reflect common sense.
The above examples of taglines sprinkled through the 3 messages of
The above garble is brought to you by me.
The above is for humor only. Any other use will void the warranty
The above message was written with talent on loan from God.
The above noted opinions, are those of my computer!
The above opinion is worth 2 cents.
The above opinion is worth 2 cents.
The above opinions are my own. DEAL WITH IT.
The above opinions are those of the user and not those of this machine.
The above provided for the straight-line impaired....
The above statement is not true:
The above text gave six NSA cryptographers fits!
The above text has nothing to do with cows OR Texas!
The absence of Love is one of its greatest punishments
The absent are always WRONG!
The absent are always at fault.
The absent are always in the wrong.
The absent are like children, helpless to defend themselves.
The absent are never without fault. Nor the present without excuse.
The absolute definite best way to catch a fish: have somebody throw it to you.
The absolute worst pickup line: "My, your breasts look nice today!"
The abstract means nothing to me! -- Rorschach.
The abstract means nothing to me! --- Rorschach.
The accompanying 9-meg file is attached in error
The aces are crawling up and down your sleeve..
The acid test of intelligence, is ability to cope with stupidity!OJW
The actions of man are the best interpreters of their thoughts.
The actions of men are the best interpretations of their thoughts.
The actions of men are the best interpreters of their thoughts.
The actions of men are the best interpreters of thier thoughts. -- Locke
The advantage of having Alzheimers, Hide your own Easter eggs.
The advantage of having Alzheimers, You can hide your own Easter eggs.
The adverb always follows the verb.
The advertisement is the most truthful part of a newspaper. -- Thomas Jefferson
The advocate will refain from making her opponent...disappear. - Data
The agony of delete.
The air is positively magic in here. Better wear a negative armor.
The airplane of Dr. Caligari - Crow
The airspeed of an swallow is -9.8m/s^2, if you break its wings.
The aliens are watching us, and laughing their Greelangs off!
The all impulse item store! - Crow
The all new NCC-1701-D -- NOT your father's Oldsmobile!
The all-encompassing movie judo chop! - Mike
The almighty Skip asks why he must pay $50k?
The amount of common sense is fixed, but the population keeps going up
The anagram for anagram is anagram.
The angel of death has been abroad throughout the land.
The angels of mercy bless thee in the Kingdom... 'Abdu'l-Baha
The angle of dangle is proportional to the heat of meat.
The animals can't tell you, you just gotta know.
The answer is "drool slobber pant pant"
The answer is 42 - we just don't know what the question is :-)
The answer is ashdkjhasdhgsaghjadgasdsad
The answer is clear - Crow
The answer is definitely MAYBE, and that's final!
The answer is easier when the question is hypothetical.
The answer is in your shoes, I don't know why - Crow
The answer my friend is 'Blow it out your ass' - Mike
The answer to life, the universe, and everything is....SPAM!
The answer to life, the universe, and everything.
The answer to your question is FIVE TONS OF FLAX.
The answer to your qustion is FIVE TONS OF FLAX.
The answer was 3.14159, Tom said piously.
The answer, my friend, is blowin' in the bird.
The answer? No, sex is the question. The answer is YES!
The answers are there, you just have to know where to look - Fox Mulder
The answers are there, you just have to know where to look. --Mulder.
The answers to life's problems aren't in a beer bottle. They're on TV.
The answers to life's problems aren't in a beer bottle...they're on TV.
The answers to the math test: 23, 87, 94, 68 - BINGO!!!
The ants are my friends, they're blowin' in the wind....
The anvil fears no blows
The appeal of recipes lies in the fear of death
The appeal of taglines lies in the fear of death
The application "Reality" has unexpetedly quit.
The apropriate tagline can't be displayed due do it's obscene nature.
The arc of the dream descends into despair,
The archbishop has got to get back to the cathedral.
The arrogance of age must submit to be taught by youth.
The art of being imperfect is a joy to others.
The art of confusion makes no sense to me...
The art of holding 8 oz of liquid in your mouth without swallowing?
The art of teaching is the art of assisting discovery.
The asnwers are there, you just have to know where to look.
The aspiring hurdler that couldn't DO IT ... Name was Wun Hung Lo.
The atrocious crime of being a young man....
The attacker must vanquish; the defender need only surviv
The attacker must vanquish; the defender need only survive.
The attainable goal - Omitting '&'*@(!% from your vocabulary
The attention span of a computer is as long as its electrical cord.
The attention span of a computer is only as long as its e
The attention span of a computer is only as long as its electrical cord.
The attention span of a computer is only as long as its power cord.
The attorneys are again at side bar, we'll take *another* short break.
The authentication code is: The dog barks at midnight.
The author is insane. Any opinions are those of Great Cthulhu.
The author of this message is famous in another reality
The authors of the Constitution distrusted government.
The avalanche has begun It is too late for pebbles 2 vote.
The avalanche has begun. It is too late for pebbles to vote.
The avalanche has begun. It's too late for the pebbles to vote.
The avalanche has started. It is too late for the pebbles to vote.
The average American has one testicle.
The average income of the modern teenager is about 2 a.m.
The average man doesn't vote for anything but against something.
The average person thinks he isn't.
The average, healthy adult gets up at 5:30am feeling terrible.
The average, healthy adult gets up at 7:30am feeling terrible.
The away team went on a mission and all I got was this louzy T-Shirt!
The awesome distance of interstellar wossname... probably quantum.
The axe should be a free form of creative expression!
The babes won't go wild anymore - Tom w/tape on his head
The baboons are at it again! was Tom's zoophytic analysis.
The baboons are going ape. - Zazu
The baby is just beautiful!
The backbone is still a bit crazy. - Don Horton..
The background on my scenic checks is bankruptcy court.
The backup ain't over 'till the FAT table sings.
The backup ain't over until the FAT table sings
The backup ain't over until the FAT table sings.
The backup isn't over till the FAT table sings.
The backup isn't over until the FAT table sings!
The backup procedure works fine, but the restore is tricky!
The backup's not over 'til the FAT table sings!
The backup's not over 'til the FAT table sings.
The backup's not over 'till the fat table sings!
The backup's not over till the FAT table sings!
The backup's not over until the fat table sings
The bad news is that the good news was wrong.
The bad thing about windows bashing is: It's all true
The ball's in your court, Joel - Dr. Forrester
The balloons' goin' up! --Plug.
The ballot box if possible, the bullet box if necessary.
The ballot is stronger than the bullet.
The baloon's goin' up! - Plug
The banjo becomes angry at midnight - Crow
The bank doesn't even want me as a depositor, said Tom unaccountably.
The bank just called and asked would you like any money?
The banks of the beautiful LA River - Mike
The banner bore a single word: Excelsior!
The bars are temples, but the pearls ain't free.
The basilisk is nature's own way of getting stoned.
The basis of a democratic state is liberty. Aristotle
The basis of a democratic state is liberty. - <Aristotle>
The basis of optimism is sheer terror.
The battle station plans are not aboard this ship!
The battle's fought and the game is won...
The beak of Senna's chicken is pulling ahead...- M.Walker
The bear's going into rope-a-dope - Crow on fighting bear
The beatings will continue until morale has improved.
The beatings will continue until morale improves
The beatings will continue until morale improves!
The beatings will continue until the Taglines improve.
The beatings will continue until the moral improves.
The beatings will continue until the recipes improve.
The beatings will continue utill moral improves
The beauty of Taglines: You can say it here safely.
The beauty of a pun is in the "Oy!" of the beholder.
The beauty of a pun is in the Oy! of the beholder.
The beauty of a pun is in the argh of the beholder.
The beauty of recipes: You can say it here safely.
The beer across the street is always much better
The beer across the street is much better.
The beer is warm, the women are cold & I'm hot under the collar.-Groucho
The beer is warm, the women are cold and I'm hot under the collar.
The beer we bought for Xmas ran dry this afternoon ...
The beginning of his own sitcom - Crow
The beginning of wisdom is the definition of terms. - <Socrates>
The behavioral scientist pulls habits out of rats.
The believer is happy; the doubter is wise. - Hungarian proverb
The bell keeps ringin' in the pinball machine of my heart.
The bell signals a nuclear attack in these parts - Mike
The bells of Hell go tingalingaling/they ring for you not me...
The belly will not listen to advice.
The best Bible version to use is the 1 you actually READ.
The best antique is an old friend.
The best applause is money. - Heinlein
The best argument is that which seems merely an explanation.
The best arguments for gay rights are its opponents.
The best armor is to keep out of range.
The best assault weapon of all: the Rush Limbaugh show!
The best audience is intellegent, well-educated, and BULLSHITTED!
The best audience is intelligent, educated and mildly drunk.
The best audience is intelligent, well educated and mildly drunk.
The best audience is intelligent, well-educated and a little drunk.
The best audience: Intelligent, well-educated, and drunk
The best audience: Intelligent, well-educated, and drunk.
The best bang since the big one.
The best blood at times gets into fools and mosquitoes.
The best bridge between hope and despair is often a good night's sleep
The best client a lawyer ever had is a scared millionaire.
The best contraception is "Point and Laugh!"
The best cure for a short temper is a long prayer. :)
The best cure for insomnia : Monday morning.
The best cure for insomnia is a Monday morning.
The best cure for insomnia is to get a lot of sleep.
The best cure for insomnia is to get a lot of sleep. -- W. C. Fields
The best cure for pain is to stop feeling it.
The best cure for seasickness is something called "land."
The best cure for the nations economy would be economy.
The best cure for violence is more violence.
The best defense against logic is ignorance.
The best defense against logic is stupidity.
The best defense against logic is stupidity.
The best defense against logic is stuppiditee.
The best defense against treachery is treachery.
The best defense is a good offense.
The best defense is not to offend.
The best defense is to stay out of range.
The best diplomat I know is a fully charged phaser bank.
The best diplomat is a fully armed nuclear warhead
The best doctor is the one you hunt for and can't find.
The best doctor is the one you run for and can't find.
The best draftees are married men, they take orders.
The best equipment for your work is, of course, the most expensive.
The best excercise for a cat is another cat.
The best exercise for a cat is a dog.
The best exercise for a cat is another cat.
The best exercise is to bend down and help someone up.
The best food in the whole world is free pizza!
The best government is the least government.
The best government teaches us to govern ourselves.
The best gun control is a good holster.
The best humour is served on wry...with a smile!
The best insomnia cure is a good night's sleep.
The best insurance against car accidents is a Sunday afternoon nap
The best keeps getting better!
The best kind of cat toy has a person on one end.
The best knife is the unseen one. - Drow Proverb
The best laid plans of mice and men are ofttimes legislated under.
The best laid plans of mice and men are usually about equal.
The best laid plans often go a fowl. --Wile E. Coyote.
The best laid plans often go afoul - Wile E. Coyote
The best laid plans often go fowl - Wile E. Coyote
The best lingerie is demolished with one use.
The best little echo on the whole net! Full of fun, food, and frolics!
The best location for a Caps Lock key is nailed to the wall!
The best man for the job is a woman!
The best man for the job is usually a woman.
The best may err. J. Addison
The best memos are the least memos.
The best messages are caused by misprints.
The best news in centuries. AIDS = Dead Homosexuals
The best of all is, God is with us. - John Wesley
The best of blessings, a contented mind. - Horace
The best of men, after all, are but the best of men.
The best packed information most resembles random noise.
The best part of Chastity is ending it.
The best part of DOS is de-install !
The best part of him ran down his mother's legs. -- Jackie Gleason
The best part of my plan: RETREAT!! - Tom as hero
The best part of myself...that's what you are. Clifton Webb
The best part of you ran down your mothers legs.
The best place to be when you're sad is in your grandma's lap.
The best place to go with a child is in their imagination.
The best place to party is any place but yours.
The best position for a woman to take is prone.
The best proof of love is trust.
The best reality is a really weird fantasy
The best sense of humor belongs to the one who can laugh at himself.
The best source of info for genealogy is usually 6 feet underground.
The best substitute for experience is being a teenager.
The best substitute for experience is being sixteen.
The best there is, the best there was, and the best there ever will be
The best thing about New Jersey...Leaving.
The best thing about animals is that they don't talk much - Wilder
The best thing about baseball is, there's no homework.
The best thing about growing older is that it takes such a long time.
The best thing about small boys is that they are washable
The best thing about war is the end of it
The best thing to come out of Seattle was the coroner's report
The best thing to spend on children is your time.
The best things in life are ME!. <=SAYS WHO??
The best things in life are NOT free! 1 Peter 1:18,19
The best things in life are for a fee.
The best things in life are free - but kinky costs extra.
The best things in life are free - plus tax, of course.
The best things in life are free, so gimme some!
The best things in life are freeware
The best things in life are not free, but can be had if you have enough money.
The best things in life are not things.
The best things in life are on sale
The best things in life aren't things.
The best things in life... belong to someone else.
The best things on TV last night were the clock and the vase.
The best time for planning a book ...doing the dishes.<Christie>
The best time to consult a road map is earlier.
The best treasure to find is a ring of DM control.
The best vacations are spent near the budget
The best water doesn't come in fancy bottles.
The best way I knew to tick off my Mother-In-Law was to get married!
The best way out is always through.
The best way out of a difficulty is through it.
The best way out of difficulty is through it.
The best way to Accelerate a Macintosh: -9.8 m per sec2
The best way to a man's heart is a battle ax through the sternum.
The best way to a man's heart is through his stomach.
The best way to accelerate Windows 95 is at escape velocity.
The best way to accelerate Windows is at -9.8 m/s2
The best way to accelerate Windows is at escape velocity!
The best way to accelerate Windows is at escape velocity.
The best way to accelerate Windows is off a cliff.
The best way to accelerate Windows is to escape velocity.
The best way to accelerate Windows: -9.81 m/s/s
The best way to accelerate a MAC is at 9.8 Meters/Sec2!
The best way to accelerate a Mac is 9.8 m/sec^2.
The best way to accelerate a Mac is at -9.8 m/s/s
The best way to accelerate a Mac is at -9.8 m/s}
The best way to accelerate a Mac is at 32 ft/sec2
The best way to accelerate a Mac is at 9.8 m / sec^2
The best way to accelerate a Mac is at 9.8 m/s^2
The best way to accelerate a Mac is at 9.8m/sec^2.
The best way to accelerate a Mac is at ESCAPE VELOCITY.
The best way to accelerate a Macintoy is at escape velocity.
The best way to accelerate an Amiga is at -9.8 m/s/s
The best way to achieve immortality is by not dying.
The best way to avoid @FN@ is to outlive him.
The best way to avoid YOU is to outlive him.
The best way to avoid enemies is to outlive them.
The best way to avoid your enemies is to outlive them.
The best way to change my mind is to agree with me.
The best way to cheer yourself up is to try to cheer some
The best way to convince a fool he's wrong is to let him have his way.
The best way to cope with change is to create it.
The best way to destroy an enemy is to make him your friend.
The best way to drive someone crazy is to carpool.
The best way to drive your wife crazy is to smile in your sleep.
The best way to forget your own problems is to help someone solve his
The best way to get ahead is to use the one you've got.
The best way to get even is to forget
The best way to get in the last word us to apologize
The best way to get praise is to die. <Italian proverb>
The best way to get rid of temptation is to yield to it.
The best way to get stains outta' your underwear - Crow
The best way to get the last word is to apologize.
The best way to give advice is to set a good example.
The best way to have a good idea is to have a lot of ideas.
The best way to haze freshman is to make them STUDY!
The best way to hold a man is in your arms.
The best way to hold your beer is in a glass.
The best way to hold your beer is in your stomach.
The best way to inspire fresh thoughts is to seal the envelope.
The best way to keep friends is not to give them away.
The best way to keep one's word is not to give it.
The best way to keep your friends is not to give them awa
The best way to keep your friends is not to give them away.
The best way to keep your word is not to give it.
The best way to know the Dragon is to experience it. - Lummox
The best way to lose freedom is not to do anything.
The best way to love your neighbor is when your boyfriend is away.
The best way to love your neighbor is when your husband is away.
The best way to make children good is to make them happy.
The best way to meet neighbors is to play your stereo too loud at 2AM.
The best way to prepare for the future is to take care of the present.
The best way to protect your rights is to keep using them
The best way to refold a map is differently.
The best way to save face is to keep the bottom half shut.
The best way to save face is to keep the lower part UP!
The best way to save face is to keep the lower part shut.
The best way to stay outta the Army is to join the Navy.
The best way to stop smoking is to carry wet matches.
The best way to teach children the value of money is to borrow some from them.
The best way to win an argument is to be right.
The best way to win an argument is to begin by being right.
The best way to win an argument is to start by being in the right.
The best we can expect on Judgment Day is a suspended sentence.
The best words are not always found in dictionaries.
The best writing never appears.
The better a man looks, the longer a woman does.
The better a man looks...the longer I look!
The better a woman looks, the longer I look!
The better a woman looks, the longer a man does.
The better the four-wheel drive, the farther out you get stuck.
The better the wheelchair, the farther out you get stuck...
The better you look, the more you'll see.
The bible does not say, "Love thy neighbor, unless he's gay."
The bible is only effective for those that belive in it; I don't.
The bible says "love thy neighbor", doesn't it?
The big bang was when the universe re-booted.
The big shots try to hold it back, the fools try to wish it away..
The bigger a woman's breasts, the smaller the man's brain.
The bigger a woman's breasts, the smaller the woman's brain.
The bigger the amount you steal, the lighter your sentence when caught.
The bigger the bankroll, the tighter the band around it.
The bigger the crowd, the more people show up.
The bigger the cushion, the sweeter the pushin'..
The bigger the smile, the sharper the knife -- ROA #48
The bigger the smile, the sharper the knife. - 48th Rule
The bigger the smile, the sharper the knife. - Rules of Acquisition
The bigger the tagline file the more junk it contains.
The bigger the theory the better.
The bigger the theory, the better.
The bigger they are, the harder they hit you.
The bigger they are, the harder they hit.
The bigger they are, the more friends you call!
The bigger they are, the more likely they're fake.
The bigger your RAM, the better. L. Lovelace
The bigger, the better.
The biggest "men's center": San Quentin!
The biggest PK cross rip since the Tonguska blast of 1909.
The biggest ant in the world is the elephANT!
The biggest computer fraud in history: WINDows 3.x
The biggest difference between time and space is that you can't reuse time.
The biggest mistake that you can make...
The biggest oxymoron in the world: The Senate Ethics Committee.
The biggest show: The Universe!
The binging continued - Crow on repetitious dinner scene
The bird of paradise alights only upon the hand that does not grasp.
The bird of paradise alights upon the hand that does not grasp.
The bird of war is not the eagle but the stork.
The bird that can sing and won't sing must be made to sin
The biscuits and the syrup never come out even. -L. Long
The bite of the yendi can never be fully healed
The black sheep keeps the best info on the family
The black sheep knows the "best" info on the family!
The blackness would hit me, and the void would be calling...
The blacksmith and the artist reflect it in their art - Rush
The blind have been blessed with security - NIN
The blonde got her college degree in sex. She was graduated cum loudly.
The blonde was so proud of her gold medal that she had it bronzed...
The blood is the life: flies, sparrows, cats, then humans.-Renfield
The blood of Jesus Christ His Son cleanseth us from sin. - 1John 1:7
The blood of the soldier makes the glory of the general.
The blue light on your dash means your brights are ON!
The blue light was my mind.... Robert Johnson
The blue of heaven is larger than the darkness of the clouds.
The bluebird of happiness is being pecked by the chicken of depression.
The blues ain't nothin' but a good man feelin' bad.
The blues had a baby and they called it rock'n'roll.
The body of a dead enemy always smells sweet.
The bogosity meter just pegged.
The bond that links your true family is not one of blood...
The bonds of matrimony are a good investment if interest is high.
The book Understanding DBase IV is an oxymoron.
The book that is misplaced is the book you need.
The book was now a nest and the poems were eggs.
The books that help you are those which make you think.
The boredom of my life would kill you. - Duncan MacLeod
The borg assimilated me, and all I got was this lousy T-Shirt.
The boss is always right.
The boss made me what I am today : depressed.
The boss said "Leave an emergency # while on vacation." I wrote "911"
The boundary of world peace is in the heart of each human being.
The bounty hunter we ran into on Ord Mantell changed my mind. - Han Solo
The bounty says "dead OR alive," but I ain't carryin' ya.
The box should bear a warning: WARNING! LOX VOMIT!
The boy on the left: his heart is about to explode - Tom
The boy who cried terradactyl - Tom
The boys may be marching, but they know not where.
The boys' restroom smells but the girls' restroom doesn't.
The brackets are ones that were censored...
The brain is a wonderful organ; it starts working the moment you get up
The brain is as strong as its weakest think.
The brain you have reached is not in service at this time
The brain you've reached is not in service at this time...
The brass is always greener... - BJ
The breeze ruffling her skirts weakened my swordarm.
The bride and groom go naked? -- Tasha
The bridge is crossed, so stand and watch it burn.
The bridge-playing prostitute retired: she took her last trick.
The brim of my hat hides the eyes of a beast.
The buck doesn't even slow down here!
The buck doesn't even slow down here.
The buck never got here! - Bill Clinton
The buck starts here.
The buck stops at that desk right over there.
The buck stops at the desk over there.
The buck stops at the disk over there.
The buck stops at the next desk.
The buck stops here! Oops, I mean there ---------------------------->
The buck stops here, the doe just visits.
The bug starts here.
The bug stops here.
The bugs will go away when you turn off the computer!
The building burned, but the books were already checked out.
The bulge in a man's pants that all women hunger for - his wallet.
The bumper sticker is America's book of proverbs.
The burden which is well borne becomes light. - Ovid
The bureaucracy expands to meet the needs of an expanding bureaucracy.
The bureaucracy is expanding to meet the needs of an expanding bureaucracy.
The buried are not lost, but gone before. E. Elliot
The bus is always late, unless you are.
The bus is leaving, Hillary - get under it!
The bushes mock me! - Mike
The butler did it!
The butler is serving tea wearing a shirt without any sleeves.
The buttered side of the toast always lands on the carpet.
The buzz from the bees is that the leopard is in a bit of a spot. - Zazu
The cafeteria deep fryer is not a toy
The cafeteria deep fryer is not a toy - Bart Simpson's lines
The cafeteria deep fryer is not a toy -Bart Simp./Epis. 9F22
The cafeteria deep fryer is not a toy -Bart Simpson/Episode 9F22
The cafeteria deep fryer is not a toy. --Bart Simpson.
The cake and the cookies and the underwear were all delicious.-Radar
The cake was chocolate! - Worf Don't I wish! - Troi
The calf & lion shall lie down together, but the calf won't sleep.
The calf & the lion shall lie down together, but the calf won't sleep.
The callous sophisticates laughed at Judy's tiny head.
The came for the ventriloquists, who set up a puppet government.
The camera lost interest in him right quick! -- Crow T. Robot
The cameraman must not have expected this - Tom
The can't fire me, slaves have to be sold!!!
The captain.... has one of these. I have no idea what it is.
The car turned from a Ford into a Plymouth! - Mike
The careful application of terror is also a form of communication.
The careful use of terror is also a form of communication
The carpet crawlers heed their callers.
The carriage held but just ourselves - And immortality
The castle of aaaaaaaargh
The cat Rule 756: Bite virgins and they always work
The cat ate my mouse; now the dog has ate my cat!
The cat ate my universal translator
The cat came in on little fog feet.
The cat crept into the crypt, crapped, and crept out again.
The cat did WHAT?
The cat is a creature of absolute convictions.
The cat is a dilettante in fur.
The cat is always on the wrong side of the door.
The cat is domestic only as far as it suits its own ends.
The cat is domesticated only as far as it suits its own ends.
The cat is eating my mouse! No, No Kitty.
The cat is eating my mouse! No,No Kitty...
The cat is mighty dignified until the dog comes by.
The cat is never vulgar.
The cat just ate my mouse!!!
The cat keeps it's spare fur under the refrigerator.
The cat lets me live here.
The cat seldom interferes with other people's rights.
The cat that ate the ball of yarn had MITTENS!
The cat thinks she can type better than I can.
The cat was created when the lion sneezed. -Arab Mythology
The cat was created when the lion sneezed. - Arab Myth
The cat was half alive and half dead.
The cat wasn't broke, but I had him fixed anyway.
The cat who isn't finicky soon loses control of her owner.
The cat who isn't finicky soon loses control of his owner.
The cat would eat fish, and would not wet her feet.
The cat's a dog and the dog's a cat. CONFUSED family!
The cat's crawling in the printer now--hair raising!
The cat's eaten it." "Has he?" "She, sir."
The cat's out of the bag. -jena Spot?! -Data
The cat's out of the bag. Quick, stuff it back in!
The cat's out of the bag." - Jenna
The cat's the only cat who knows where it's at!
The cats chasing the dog and the mouse is pissed.
The cats let us live here.
The cause of problems are solutions!
The cautious seldom err.
The cavalry is late
The censors took all the dirty bits out of my show, said Tom deludedly.
The census taker in the land of Nod invented the Nodlist.
The centers of golf balls are filled with honey.
The centipedes are coming...
The cesspool is so lovely this time of day. - Hawkeye
The chances are very much against it.
The chances of survival are seven hundred seventy-five - to one.
The change that you've gone through, it shouldn't matter. - Lennier
The character will be good if the purpose is good. - Aristotle
The characteristic of coquettes is affectation governed by whim.
The characters are confused, the motivations obscure...US GOVT.
The characters in this message are recyclable
The chariots of the Gods race upon the winds of Time...
The check is in the mail - Accounts Deceivable
The check is in the mail...
The check's in the mail, Martin. Really.
The check's in the mail... Trust me!
The checks in the mail and Trust Me.
The cheese slid off his cracker.
The cherry bomb is lit. Quick, hand me that cat!
The chicken coop blew up! Tom exploded with egg on his face.
The chicken crosses the road when you're not looking
The chicken did not cross the road!
The chicken was the egg's idea for getting more eggs. - Samuel Butler
The chief cause of divorce is matrimony.
The chief cause of problems is solutions.
The child had every toy his father wanted.
The children can't be raised headhunters - Crow
The children come through us. They are not of us.<Kahlil Gibran>
The children of Baskin-Robbins are ice cream clones.
The children of all Klingons will know of this day! - Kor
The children of rock'n'roll never grow old--they just fade away.
The chip's canna' take much more o'this, Captain!
The chip's canna' take much more o'this, Captain.
The choice is yours: be a Limbaugh fan or learn to think for yourself.
The choice of a new generation.
The choice: Roll over or stand up to be counted.
The choice: Roll over or stand up to the challenge.
The chores! The stores! Fresh air! Times Square!
The church hates a thinker like a robber hates a cop.
The churches must learn humility as well as teach it.
The cigarette company sponsored the tennis matches.
The cinema is not a slice of life but a piece of cake.
The circle is now complete - now on to the triangle theorems
The circle is now complete. - Darth Vader
The circle is now complete...now on to the triangle theorems...
The circus is in town.
The cities a flood and our love turns to rust --U2
The citric acid gives her gas - Frank on Dr. F's mom
The city is not a concrete jungle, it is a human zoo.
The city is not a concrete jungle, it's a human zoo..
The city is not a concrete jungle. It is a human zoo.
The city put the country back in me.
The clash of ideas is the sound of freedom.
The class in school I hate the most is the one I learn the most from.
The clever man solves a problem; the wise man avoids it. - A. Einstein
The client who pays the least always complains the most.
The cliffs around the crashing sea, unsolved and endless, wait for me.
The climactic library chase scene comes to a close - Tom Servo
The climactic library chase scene comes to a close -Tom
The clone sat alone, and the monk he just monkeyed around.
The close ups really save on sets - Mike
The closest he'd come to a brainstorm is a drizzle.
The closest helping hand is at the end of your arm.
The closest library doesn't have the material you need.
The closest library never has the material you need.
The clown looks out from the computer screen for help- TEC
The clown looks out from the computer screen for help...
The clown who thought up the 70 character limit for taglines can kiss
The co-moderator types softly and carries a big ..er, Tagline! - MI Fox
The co-moderator types softly and carries a big ..er, Tagline! - MIF
The coal industry is being run by men with dirty mines.
The coast was clear.
The cockroaches are revolting.
The college I went to was so small the debate team was a schizophrenic
The color of gold is gold, that's why it's called gold.
The color of truth is grey.
The colors felt sooo good in TheDraw.
The colour of people shouldn't matter.
The combination is, 1,2,3,4,5.
The combination wall-safe & radio - Crow
The coming together of two to make one - Dr. Forrester
The commander of men is the command to protect.
The common denominator is blood. It's all red. - Hawkeye
The common denominator produces divide overflow
The commotion provokes a bullsnake - Crow on kid in hay
The company of just and righteous men is best. Euripides
The company sent me here to show you a friendly face. <B2>
The components you have will expand to fill the available space.
The computer did it by itself!
The computer did it! Honest!
The computer is down!
The computer is fine. It's me that has technical difficulties.
The computer is fine; *I* am experiencing technical difficulties.
The computer is fine; I'm experiencing technical difficulties...
The computer is incredibly fast, accurate ... and stupid!
The computer is incredibly fast, accurate, and stupid.
The computer is incredibly fast, accurate, and stupid....
The computer is mightier than the pen, the sword, and usually, the programmer.
The computer is the Proteus of machines. - Seymour Papert
The computer laughs at you when you're not looking.
The computer made me do it! Honest!
The computer made me do it; HONEST!
The computer revolution is over. They won.
The computer said my perfect match became extinct 4 million years ago!
The computer says ITS intelligence is real and OURS is artificial!
The computer will cut your work in half and leave you 2 bloody stubs.
The computer wore platform shoes - Joel
The computer you bought today, became obsolete yesterday.
The computing field is always in need of new cliches. - Alan Perlis
The computing field is always in need of new cliches. -- Alan Perlis
The conclusions of most good operations research studies are obvious.
The condensed version...
The conference rules do NOT resemble Calvin-ball!
The confusion of a staff member is measured by the length of his memos.
The conquest of fear lies in the moment of it's acceptance.
The conscience of the King doesn't matter.
The conspiracy you've uncovered is just a front for the REAL conspiracy.
The consumer is not a moron, it is your spouse.
The continuance of anger is hatred.
The continuum didn't think you had it in you. - Q
The cooing stops with the honeymoon; the billing goes on forever!
The cook book is definitive. Reality is often innacurate.
The cool green pills of Earth
The coolest thing about Don is I never doubt he loves me. Christy
The coroner gave you a clean bill of health.
The coroner? Ah, I'm so SICK of that guy.. - Dr. Nick Riviera
The corps is mother, the corps is father. - Talia Winters
The cost of feathers has risen - now even down is up.
The cost of feathers has risen. Now even down is up.
The cost of feathers has risen. Even DOWN is up!
The cost of feathers has risen... Now even DOWN is up!
The cost of feathers has risen.... Now even DOWN is up!
The cost of feathers has risen.... Now even down is up!
The cost of living has just gone up another dollar a quart.
The cost of living hasn't affected its popularity.
The cost of living is going up, and the chance of living is going down.
The council is very wise. - Lennier Yes. - Delenn
The counsil will stop at nothing to take control.
The country is a mess and people keep voting for lawyers.
The courage to put your fantasies onscreen - Mike
The course of progress: Most things get steadily worse.
The course of true anything never does run smooth.
The course of true anything never does run smoothly.
The covers of some books are too far apart.
The covers of this book are too far apart.
The cow ate bluegrass and mooed indigo.
The cow chips are about to strike the windmill.
The cow is a machine which makes grass fit for us people to eat.
The cow is a machine with makes grass fit for people to eat.
The cow is nothing but a machine which makes grass fit for human use.
The cow is nothing but a machine with makes grass fit for
The cow is nothing but a machine with makes grass fit for human use.
The cow is nothing but a machine with makes grass fit for us people to eat.
The cow is now a widow, because you shot the bull.
The cowards never started - and the weak died along the way.
The cowards will turn back and the weaklings die.
The cows all ate Bluegrass and mooed Indigo.
The cpu is intel and it is a 8086....I have two batteri
The crabgrass is in bloom and the cat had puppies. - Frank Burns
The cream rises to the top. So does the scum...
The created world is but a small parenthesis in eternity. Browne
The creationists are correct... They HAVEN'T evolved!.
The creature appears hostile! - Calvin to a moderator.
The creature appears hostile! -- Calvin
The creature appears hostile!, Gregg De to Moderator.
The credit belongs to those who are actually in the arena.
The credit belongs to those who spend themselves in a worthy cause.
The credit belongs to those who strive valliantly.
The creditability of the UN isn't worth American lives. - Rush
The credits should be exploding pretty soon...
The creeping part is apt but the terror part isn't - Mike
The crime rate is up again? Now THAT'S job security!
The crisis of today is the joke of tomorrow.
The critical period in matrimony is breakfast time.
The cross did not "happen" to Jesus, He came on purpose for it.
The cross has been carried forward on the hilt of the sword.
The cross is carried forth on the hilt of the sword.
The crossbow seemed perfectly natural - Tom
The crowd's enthusiasm is quickly dimmed - Mike
The crows are calling my name, thought Caw.
The crows seemed to be calling his name, thought Caw.
The cruelest lies are often told in silence. - Stevenson
The cruelest lies are told in silence.
The cruellest lies are often told in silence. - Stevenson
The cruellest lies are often told in silence. R.L. Stevenson
The crulest lies are often told in silence
The crusty, but benign airport attendant - Crow
The crux of the biscuit is the apostrophe. - FZ
The cuckoo shouts all day at nothing/In leafy dells alone. A.E.Housman
The cure for Writer's Cramp is Writer's Block.
The cure for admiring the house of lords is to go and look at it.
The cure for cancer is $^#g!l&NO CARRIER
The cure for love at first sight is to take another look.
The cure for writer's cramp is writer's block.
The current cost of taxes = your penalty for voting for BILL & HILLARY
The current death rate? One per person, of course!
The current death rate? One per person, of course.
The current death rate? 1 per person, of course.
The current death rate? One per person, of course.
The curse of a prince of Amber, pronounced in a fullness of fury...
The customer takes out a gun and shoots the owner.
The cuter the pet, the lower the heart rate - Dr. F
The cycle will repeat itself.
The cynic says: the pessimist is a realist who isn't afraid to admit it.
The cynics are right nine times out of ten.
The daily beatings will continue until morale improves!
The dam is back to front, said the builder madly.
The damned use that word in hell.
The dance never ends, just changes.
The dark matter they found out there must be chocolate liqueur? - csj
The darkness must flow, down the river of night's dreaming.
The darn thing works better if you plug it in
The darned living sacrifices keep crawling off the altar!
The date from Hell: Tonya Rodham Bobbitt
The dawn's gonna break, and I'll meet you on the Edge Of The Century!
The dawning of a brighter day majestic rises on the world.
The day I stopped learning is the day I died....
The day after Christmas is worse than the day before.
The day after tomorrow is the third day of the rest of your life.
The day begs the night for mercy --U2
The day divides the nights. Nightime devours the day.
The day hums sweetly when you have enough bees working for you.
The day my ship comes in, I'll be at the airport...<sigh>
The day pigs fly is the day I heavily invest in umbrellas
The day you stop learning is the day you are buried. -unknown
The days are justed PACKED -Calvin
The days of good English had went.
The days of our youth are the days of our glory
The days of the digital watch are numbered
The dead are a burden to no one.
The dead do not speak.
The dead don't die. They look on and help. D.H. Lawrence
The dead have peace. We have Bill Clinton.
The dead have risen and they're voting Republican! -Bart Simpson.
The dead outnumber the living by more than 30 to 1.
The dead outnumber the living more than 30 to 1.
The dead really do live, just ask the groom.
The dead zone is for loading & unloading only - Tom
The deadliest bull*h*t is odorless and transparent.
The deadly yello snow crystals deprived him of his sight
The deal was made in Denmark, on a dark and stormy day..
The death knights don't attack? I sit on the throne.
The death of dogma is the birth of reality.
The death rate on Earth is: .... (computing) .... One per person.
The death ray would be good for Hollywood premiers. - Crow
The debate continues over who smells worse...a wet dog or a wet baby.
The debate rages on: Is PL/I Bachtrian or Dromedary?
The deceased was cremated; He took an urn for the hearse.
The decision doesn't have to be logical, it was unanimous.
The decision doesn't have to be logical, it was unanimous. - Jerry Burchfiel
The decision is maybe, and that's final
The decontamination unit called. You're socks are clean.
The decontamination unit called. Your socks are clean.
The deeds of men never deceive the Gods. Ovid
The deeper I die, the more I sweat - Course of Empire
The deeper the sorrow the less tongue it hath. - The Talmud
The deeper the sorrow, the less tongue hath it.
The deficit is a spending problem, not a revenue problem!
The deficit is caused by big spending, Democrats are the big Spenders!
The definition of horse sense: Stable behavior.
The deil's bairns hae ay deil's luck.- Old Scot Sayin
The deil's no ay the ill chiel he's ca'd.- Old Scot Sayin
The delicate application of TNT - Crow
The dental instrument please! <plays note on trumpet> Flat. - Yakko
The dentist said my wisdom teeth were retarded.
The depression in a cat's skull makes the perfect tee. FOUR! Thwack.
The deputy and his 'siren' - Crow on deputy's wife
The descent to Hades is the same from every place.
The desert environment is enhanced by bombing - Crow
The desire accomplished is sweet to the soul. - Proverbs 13:19
The desire of knowledge increases ever...
The desire to seem clever often keeps us from being so.
The desire to work is confined to classified ads.
The desk had just got fundamentally fed up with being where it was.
The destination is unknown at the start of many journeys.
The determined programmer can write a FORTRAN program in any language.
The devil can cite Scripture for his purpose.
The devil damn thee black, thou cream-faced loon!
The devil didn't make me do it, but he had the best idea.
The devil didn't make me do it... His was just the best idea.
The devil finds work for idle circuits to do.
The devil finds work for idle glands.
The devil in a button-dowm shirt.
The devil in a button-down shirt
The devil is not afraid of a BIBLE with dust on it.
The devil made me do it and I wanna do it again!
The devil made me do it, and I liked it!
The devil want's to f*** me in the back of his car - NIN
The devils of truth steal the souls of the free - NIN
The dew of compassion is a tear.
The diamonds shone like broken glass upon the midnight street --JM
The die is cast. (proverb quoted by Julius Caesar).
The die is cast. --Julius Caesar.
The differance between genius and stupidity is that geni.
The difference between 'parasite' and 'pet' is Marketing.
The difference between Inlaws and Outlaws: Outlaws are wanted!
The difference between LIKE and LOVE...SPIT or SWALLOW!
The difference between LIKE and LOVE...SPIT or SWALLOW...
The difference between OS/2 and a virus? Virus is free!
The difference between Viruses and Windows? Viruses work!
The difference between Windows & a virus? A virus does something!
The difference between Windows and a virus - a virus works
The difference between Windows and a virus$495.00 retail!
The difference between Windows and a virus? A virus is free.
The difference between Windows and a virus? A virus DOES something!
The difference between Windows and a virus? Virus is free
The difference between Windows and a virus? Virus is free.
The difference between Windows and viruses? Viruses work!
The difference between a Trekkie and a Trekker? Trekkers like B5.
The difference between a cat's relaxation and exercise can be subtle.
The difference between a dog and a fox? About three drinks.
The difference between a dog and a fox?..about six drinks.
The difference between a successful person and others is lack of will.
The difference between a virus and Windows, viruses work!
The difference between a virus and Windows? Viruses work!
The difference between a virus and windows is that a virus works.
The difference between an oral & anal thermometer? The taste.
The difference between cockroaches and lawyers? Is there one?
The difference between communism and democracy is plenty.
The difference between doing it and not doing it is doing it
The difference between genius and ignorance...genius has it's limits!
The difference between genius and stupidity is genius has its limits.
The difference between genius and stupidity is that genius has limits.
The difference between gossip and truth is whether you hear or tell it
The difference between ideas and results is a good manager.
The difference between love and hate: We hate more passionately.
The difference between ordinary and extraordinary is that little extra
The difference between ordinary and extraordinary is the little extra.
The difference between outlaws and inlaws is outlaws are wanted.
The difference between snowmen and snowwomen? Snowballs!
The difference between spoiled milk & yogurt? Marketing!
The difficult I do immediately -- The impossible I sub-contract.
The difficult we do today; the impossible takes a little
The dilithium UARTs won't take this baud rate much longer
The dime is entirely worthless, it's a fairly efficient screwdriver.
The direct approach is the best approach. Garfield
The director attempted an arty sort of shot - Mike
The director of photography went for a drive - Crow
The director's beginning to lose control of the film -Tom
The director's brother-in-law, ladies and gentlemen! --Servo.
The disciples nevereverbaptized in the trinity.
The discontented man finds no easy chair.
The disk ain't braggin' if I can back it up.
The disks are getting full; purge a file today.
The dispensing of injustice is always in the right hands.
The districts swimmingpool over here is named Blauwe Golf; I swim
The diversion you are ignoring is the main attack. 'Murphy
The doctor gave me a clean bill of health. . . and an expensive one!
The doctor is in. Notice that I am not.
The doctor is not in. - Joe Dawson
The doctor said I could have a breakdown if I liked.
The doctor says he has to amputate all of me.
The doctor will see you now @FN@. Please disrobe!
The doctor will see you now YOU. Please disrobe!
The doctor will see you now. Come on, just say "Ahh." - Picardo
The doctors had to remove a bone from my arm, said Tom humorlessly.
The doctors had to remove a bone from my arm, said Tom humorously.
The doctors have discharged me, said Tom impatiently.
The doctors have done everything, but I'm still alive.
The dog ate my .REP packet!
The dog ate my .REP packet.
The dog ate my Bluewave packet.
The dog ate my flight plan packet.
The dog ate my hard drive.
The dog ate my reply packet.
The dog ate my tagline.
The dog hasn't made a sound all day. Maybe he needs new bark plugs.
The dog told me to do it. --Son of Sam.
The dog won't move, honey. Show him the vacuum cleaner!
The dog's best friend is a full food bowl.
The dog's housebroken, but he still needs to go outside.
The dog's law of life: If you can't eat it or <*censored*>, on it!
The dog's law of life: If you can't eat it or f*ck it, piss on it!
The dog's not begging for my food...wonder what she's up to?
The dogs bark, but the caravan moves on.
The door is Baroque. Please wiggle Handel or call Bach
The door is the key.
The door says "EXIT", baby - TAKE THAT!
The door's ajar, said Tom openly.
The doors of Truth are guarded by Paradox and Confusion.
The dorm mother affectionately known as Horse Face -Joel
The dough NEVER stops here.
The dough always stops over there.
The dough stops here.
The down side of realignment: no more finishing ahead of the Dodgers.
The dragon is coming or I am a fool! CUT THE BRIDGES! - Lake-Town Guard
The dragon made me do it.
The dragon wing of night o'erspreads the earth.
The dragon? I bet that old goat can't even hear -- GULP
The dragon? I bet that stupid, old goat can't even hear - OH SH|T!!!
The drama! The suspense! The phone bills!
The dramatic potential of a rectal thermometer - Mike
The dreadful burden of having nothing to do
The dreadful burden of having nothing to do.
The dream is peaceful. Reality is the nightmare. - Freedman
The dream's gone stale, but still, let hope prevail. -Rush
The dreams in which I'm dying are the best I've ever had.
The dreams of the future are better than the history of the past.
The dreams the wolves what's going on? -- Evan, Wendigo
The dresses aren't gettin' me out...just whistles. - Klinger
The drink of Warriors! ...whadaya mean, no bathrooms?!
The drive ate the tape but that's OK, I brought my screwdriver.
The drug war is a government money making scheme.
The drugs kicked in, now other voices stopped talking.
The drummer is level when he drools out both sides of his mouth.
The drunker I sit here, The longer I get.
The drunker I sit here, the longer I get.
The dryer, Point of No Return for every other sock.
The dumplings in a dream are not dumplings, only dreams.
The dustpan that the dirt can be swept into is not the true dustpan.
The dutch government's universal solution: increase taxes on petrol.
The dylithium crystals cannae handle it,Cap'n!
The dynamite can now explode, Tom added defusingly.
The dyslexic policeman kept giving out tickets for I.U.D.'s.
The earlier you set your alarm, the longer you can oversleep.
The earliest Chinese takeout food in America was Plymouth Wok.
The early bird catches the worm. Call me after lunch.
The early bird catches the wormThe early worm ..wellll
The early bird gets eaten by the night owl!
The early bird gets the worm, but you can order pizza till midnight.
The early bird gets the worm, the second mouse gets the cheese.
The early bird gets the worm.
The early bird still has to eat worms.
The early bird suffers from insomnia.
The early morning call to voodoo - Crow
The early worm deserves the bird
The early worm deserves the bird.
The early worm gets the bird.
The early worm has a death wish
The early worm has a death wish.
The early worm is for the birds.
The earth has music for those who listen.
The earth is 98% full. Please delete anyone you can.
The earth is 98% full. Delete lawyers.
The earth is 98% full. Please .ZIP yourself...
The earth is 98% full. Please delete anyone you can.
The earth is a hollow shell and we live on the inside.
The earth is flat. All the carbonation has escaped.
The earth is full of the goodness of the Lord. - Psalm 33:5
The earth is like a tiny grain of sand, except bigger and heavier.
The earth is like a tiny grain of sand, only heavier
The earth is like a tiny grain of sand, only heavier.
The earth is like a tiny grain of sand, only much bigger.
The earth is like a tiny grain of sand, only much heavier
The earth is like a tiny grain of sand, only much, much h
The earth is like a tiny grain of sand, only much, much heavier.
The earth is quiet when we make jokes about California earthquakes.
The earth is the Lord's, and the fulness thereof. - 1 Cor. 10:26
The earth, a purple blaze of sapphire haze
The earthling has stolen the space modulator! - The Martian
The ease of Windows, Multitasking while you wait.
The easier it is to do, the harder it is to change.
The easiest way of making money is to stop losing it.
The easiest way to fold a road map is differently.
The easiest way to make ends meet is to get off your own.
The easiest way to solve a problem is to deny that it exists.
The easy question gets the most answers ...
The easy way is always mined.
The easy way is always mined. 'Murphy
The easy way is always mined...with taglines.
The easy way is always the hardest way.
The eclipse is starting, said Tom darkly.
The economy is irrelevant. --Bush Borg.
The economy is weird - my bank failed before the toaster did.
The economy is weird -- my bank failed before the toaster did.
The economy's dead Bill, tax it if you don't believe me.
The effectiveness of the moderation depends on the moderator.
The eighties were a bad year for me.
The elder gods went to Suggoth and all I got was this lousy T-shirt.
The election proves one thing. God is in control and answers prayer
The elegancy of honesty needs no adornment.<Merry Browne>
The elements! The elements! Their names just don't make any sense.
The embrace of love held too tightly can destroy.<The Iron Circle>
The emptier the head,the harder it is to fill
The emptier the pot, the quicker it boils.
The end is coming! Party while you can!
The end is near... but wait for the sequel!
The end is what usually justifies the diet.
The end move in politics is always to pick up a gun.
The end move in politics is always to pick up a gun. R. B. Fuller
The end move in politics is always to pick up a gun.\BUCKMINSTER FULLER
The end must justify the means.
The end of a battle is not the same thing as peace! Stay prepared!
The end of the human race will be that it will eventually die of civilization.
The ends justify the jeans.
The enemy diversion you are ignoring is the main attack.
The enemy diversion you are ignoring is the main tagline.
The enemy diversion you have been ignoring will be the main attack.
The enemy has taken stronghold F, said Tom effortlessly.
The enemy heard we were having fun so they attacked. - Hawkeye
The enemy is fear. We think it is hate; but, it is fear.<Gandhi>
The enemy never watches you until you make a mistake ....
The enemy never watches, until you make a mistake..
The enemy of my enemy is my friend.
The energy of your whole being in one tight space.
The enraged pantomime goose fires!
The entire history of Ferengi foreplay fits in this line!
The entire map collection has been stolen! said Tom xerographically.
The entire physical universe, including this product, may collapse.
The entire series of books makes for good tagline material.
The entire window was filled with an oncoming Lockheed TriStar jet.
The envious praise me unknowingly.
The episode was "Ex Post Facto".
The escaped prisoner is camping out in the woods, said Tom contentedly.
The essence of knowledge is, having it, to use it. - Confucius
The eternal God is thy refuge- Deuteronomy 33:27
The eventual supremacy of reason should be accepted.
The evidence before the court is incontrovertible...
The evidence before the court is...INCONTROVERTIBLE!
The evidence we planted reinforces their beliefs. - Diana, V
The evil duct tape monster - Tom on stupid looking alien
The excrement has hit the whirling blades.
The excrement is about to hit the electric rotary ventilator.
The excremental matter hit the air circulation system!
The executioner has received the tool, said Tom with a heavy accent.
The expressed opinions here are just opinions (:^P
The eye of the tiger; the ear of the Ferengi.
The eyes are open, the mouth moves, but Mr. Brain has long departed.
The eyes of Texas are upon you (o ) ( o ) ( o)
The eyes of the Lord are in every place- Proverbs 15:3
The eyes of wolves are flowers fertilized in evil brains.
The fabric of space-time continuum isn't merely curved, it's bent.
The face of a child can say it all, especially the mouth part of the face.
The face of a child can say it all, especially the mouth part.
The faces of those you've wronged - Crow on near death
The fact that it works is immaterial.
The fact that it works is immaterial. -- L. Ogborn
The facts will make you paranoid.
The facts, although interesting, are irrelevant!
The facts, although interesting, are irrelevant.
The facts, while interesting, are irrelevant.
The falsely dramatic obscures the truly dull.
The families of one's friends are always a disappointment.
The family that computes together needs a network.
The family that drools together, doesn't rhyme at all.
The family that lays together, stays together.
The family that modems together...seldom talks...
The family that shoots together shouldn't be messed with!
The family that sticks together should bathe more often.
The family tree burned down when Social Services torched the forest...
The famous politician was trying to save both his faces.
The fan is working but the freon's leaked out.
The farther away you are, the more fun I have
The faster I codes, the behinder I gets!
The faster I get behind, the more time I have to catch up...
The faster I go the behinder I get!
The faster I go, the behinder I get.
The faster we go, the rounder we get. -- The Grateful Dead
The faster you get behind, the longer you have to catch up
The faster you go, the shorter you are-- Einstein
The fastest ewes and slowest rams produce the virgin wool
The fastest tagline bandit in the west!
The fastest way to a mans heart is by tearing a hole in his rib cage
The fastest way to light a man's heart is with a redhead.
The fat lady has left the building.
The fat lady has sung.
The fat lady's chances were slim.
The fatality of good resolutions is that they're always too late - Wil
The fate is upon you..
The fate of all mankind I see is in the hands of fools.
The fate of all mankind, I see, is in...the hands of fools.
The favorite drink of a alcoholic is the next one.
The fax machine is nothin' but a waffle iron with a phone attached!
The fear of God keeps men in obedience. --Burton.
The fear of death is the beginning of slavery.
The fear of death is the greatest compliment we pay to life.
The fear of death keeps us from living, not from dying.
The fear of isolation can make a person choose not to make art.
The fear of sponge-cats is the beginning of wisdom.
The fear of the Lord is the beginning of intolerance.
The fear of the Lord is the beginning of wisdom.
The fearless Spaceman Spiff sets off to explore a new planet!
The fearless Spaceman Spiff sets off to explore a new planet! -Calvin
The features of the next version are, as yet, unannounced.
The feel good mineral of 1999 -Joel on atmosphere element
The feeling is mucus, I'm sure
The feeling of chaps with no pants - Tom
The feeling of mistrust is always the last which a great mind acquires
The feeling of mistrust is always the last which a great mind aquires.
The feeling you are experiencing is called the Quickening...
The female can change her mind at any given time...
The female is a domestic animal that can be trained.
The female of the species is more deadly than the male.
The few! The proud! The extras!
The few! The proud! The extras! -- Crow
The few, the proud . . . the politicaly incorrect
The few, the proud, the C=64 & VIC 20 owners.
The few, the proud, the Force sensative...Star Wars RPG
The few, the proud, the Windows 3.0 & SX owners.
The few, the proud; the Windows 3.1 & Stacker owners.
The few. The proud. The registered.
The few. The proud. The decent recipes.
The few. The proud. The decent taglines.
The few; the proud; the well endowed.
The fewer keystrokes it takes the better!!!
The fewer our wants, the more we resemble the gods.
The fewer the facts, the greater the magic
The fewer the facts, the louder the shouting.
The fewer the facts, the stronger the opinion.
The fifteenth chapter: The Earth is dubbed the SDF-15 and transforms!
The fifth dentist caved! Now they ALL recommend Colgate!
The file, and the information, is bogus.
The filename is MUF15.ZIP
The film on the lake is better that THIS film! - Tom
The film on this lake is better than the film we're watching!
The film's in black face now. Mammy! - Crow on dark scene
The final DOS version of Borg ... ClintonBorg!
The final DOS version of Borg...ClintonBorg!
The final solution: echo y | del *.*
The final test of fame is to have a crazy man imagine he is you.
The fine thread of sanity
The fire at midnight burns out by daybreak.
The fire is going out, Tom bellowed. -Roy Bongartz
The firework you save til the end is a big disappointment
The first 10,000 times don't count.
The first 2 computers: Eve had the Apple, Adam had a Wang.
The first Fossil driver -- Fred Flinstone
The first Herd shot round the world? 300 TEXAS Cattle in Orbit!
The first Myth of Management: It exists.
The first Post Office in the American colonies was in a tavern!
The first Russian Doo-Wop group - Mike
The first `puter I had use of was a dual floppy Wang, during 1983.
The first blonde is the cheapest.
The first condition of immortality is death. --Stanislaw Lec.
The first convenience store! ..This isn't very convenient.
The first duty in Star Fleet is the truth -Picard
The first duty of a Starfleet officer is to the truth.
The first duty of a revolutionary is to get away with i
The first duty of a revolutionary is to get away with it.
The first duty of a revolutionary is to get away with it. - Abbie Hoffman
The first duty of a revolutionary is to get away with it. -- Abbie Hoffman
The first duty of love is to listen.
The first ingredient in any recipe is "Wash your hands."
The first mention of baseball in the Bible was "In the Big Inning..."
The first movie filmed entirely with flashlights - Crow
The first multitasker - Two XT's and a chair with wheels
The first myth of management is that it exists.
The first myth of management is that management exists.
The first obligation of a prisoner is to escape. - Sheridan
The first part of food digested is the color.
The first piece of luggage out of the chute does not belong to anyone,
The first piece of luggage out of the chute does not belong to anyone, ever.
The first qualification for a historian is the inability to invent.
The first rule of Dabo: Watch the wheel, not the girl.
The first rule of air combat is to see the other guy first.
The first rule of holes: when you're in one, stop digging.
The first rule of intelligent programming is to save all the files.
The first rule of intelligent tinkering is save all parts
The first rule of intelligent tinkering is save all parts!
The first rule of intelligent tinkering is to save all the parts.
The first rule of intelligent tinkering: Save all the parts!
The first rule of lovemaking: Don't point and laugh.
The first rule of not being seen is...not to post! - Monty Python
The first rule of smart tinkering is to save all parts.
The first rule of tinkering is to save all the parts.
The first sigh of love is the last gasp of wisdom.
The first sigh of love is the last of wisdom.
The first sign of love, is the last sign of wisdom!!
The first sport was baseball. "In the Big Inning"
The first stage of immortality is being remembered.
The first step binds one to the second. Fr. Proverb
The first step in world peace is to kill all the christians.
The first step is the two step, then we'll talk.
The first step is the two-step, and then we'll talk.
The first step to people control is gun control.
The first step towards philosophy is incredulity.
The first stereophonic BBS.
The first ten million years were the worst.
The first test of a really great man is his humility. Ruskin
The first thing I do in the morning is brush my teeth and
The first thing a man learns is that morality is his enemy.
The first thing that strikes a stranger in New York is a car.
The first thing we do, let's kill all the lawyers. - Shakespeare
The first thing you learn as captain is how to cheat death. --Kirk.
The first thing you lose on a diet is your sense of humor.
The first time in my life, I keep the lights on to ease my soul.
The first wealth is health.
The first wearer of your fur coat died while wearing it.
The first woman Byte Brother
The fish elected a new pope - Tom
The fish in the sea are as good as the fish removed.
The fish that escaped is the big one.
The fisherman says to the magician, "Take a cod, any cod."
The fishing today is lousy, Tom carped.
The flames of Hades burning strong, your soul shall never rest!
The flimsier the product, the higher the price.
The flogging will continue until morale improves...
The flogging will continue until the morale improves.
The floggings shall continue until morale improves.
The floggings will continue until morale improves!
The floggings will continue until morale improves.
The floggings will continue until the morale improves!
The flood has arrived, may we interest you in an ark?
The flower, with the petals of velvet, at Tanagra, when the walls fell
The flush toilet is the basis of Western civilisation.
The flush toilet is the basis of Western civilization.
The flute is a skinny-high shape-sounded instrument.
The flying saucer has bad gas - Crow as apes cover face
The fog moved in on little cat feet. --Carl Sandberg
The folks at Smith-Barney do it the old fashioned way.
The following statement is false. The previous statement was true.
The following tagline is written in invisible ink :
The following were all recorded at a Champions game:
The food here is terrible, and the portions are too small
The food here should not be taken internally. - Hawkeye
The fool hath said in his heart: there is no God - Psalm 14:1
The fool wanders; the wise man travels.
The foolish and the dead alone never change their opinion.
The foolish and unwary find waiting death. - Drow Proverb
The foolishness of fools is folly. - Proverbs 14:24
The fools who follow
The footprint of the owner is the best manure.
The forcast for tonight: Dark
The force can have a strong influence on the weak minded. - Obi Wan
The force will be with you....always. - Obi Wan
The force will be with you...always.
The forecast is partially cool-Butthead
The foregoing does not necessarily reflect the views of the *Tagline
The foregoing is free of obscenity, and has my *STOMP* of approval!
The foregoing reflects my COLLECTION, not my OPINION! <BG>
The foremost art of kings is the power to endure hatred. - Seneca
The forest would be silent if no birds sang except the best.
The form doesn't matter. It's what you bring to the table. - jms
The formula for failure - try to please everybody. - Swope
The founding fathers were part of the illuminati.
The four boxes of freedom: Soap, Ballot, Jury, Ammo.
The four food groups are: spam, spam, eggs and spam.
The four food groups coffee, wine, beer and pizza!
The four food groups: Coffee, Chocolate, Sugar, and Sex.
The four food groups: Fast, Frozen, Instant and Chocolate.
The four food groups: coffee, ice cream, beer and pizza.
The four food groups: coffee, ice cream, vodka and pizza.
The four food groups: fast, frozen, instant and microwave.
The four food groups: Caffiene, Chocolate, Sugar, and Sex
The four food groups: Coffee, Chocolate, Pizza, and Sex.
The four food groups: Coffee, Chocolate, Sugar, and Sex.
The four food groups: Coffee, Cholesterol, Caffine and Chocolate.
The four food groups: Coffee, ice cream, beer and pizza.
The four food groups: Fast, Frozen, Instant and Chocolate.
The four food groups: Fast, Frozen, Instant, Microwave.
The four food groups: Fast, Frozen, Instant, and Microwave.
The four food groups: coffee, ice cream, beer and pizza.
The four food groups: coffee, ice cream, vodka and pizza.
The four food groups: soda, ice cream, tacos, and pizza.
The four food groups: spam, spam, eggs and spam.
The four food groups:Fast, Frozen, Instant and Chocolate.
The four good groups: Fast, Frozen, Instant, and Microwave.
The four major food groups: Chocolate, Pizza, Caffienne, Sleep.
The four seasons are salt, pepper, mustard, and vinegar.
The fourth law of thermodynamics: The perversity of the u
The fowl stench of death is upon us...mmm..hamburgers.. - Homer
The free education provided by Limbaugh is worth every penny.
The freedom of poetic license. Cicero (43 BC)
The friend who understands you, creates you. - Rolland
The friendliest thing in the world? Why, a hungry dragon, of course!
The friendly undertaker signs his letters "Eventually yours".
The friendship tha can cease has never been real. St. Jerome
The frog's dead. He Kermitted suicide.
The fruit of the Spirit is love. - Gal. 5:22
The fruits of impatience are bitter.
The full moon doesn't bother me! Aaahhhhhooooooooo!!!!
The fully interchangeable BBS.
The fun part is to get her to purrrr!
The fundy approach: if it ain't broke, fuck with it until it IS broke!
The fungus can destroy even the notebook
The fungus can destroy even the notebook.
The further I go, the behinder I get.
The further away from home you are the harder your pecker gets.
The further we go back the more we go ahead.
The future ain't what it used to be." -- Yogi Berra
The future belongs to those who believe in the beauty of their dreams.
The future comes March, 1992.
The future comes in 256 bitmapped colors!
The future exists first in imagination, then on Will, then Reality.
The future has a bad attitude.
The future is a convienient place for dreams- A. France
The future is a myth created by insurance salesmen and hi
The future is as bright as the promises of God.
The future is but a question mark.
The future is here...Platinum Xpress!!
The future is just not what it use to be.
The future is like the present - only longer.
The future is like the present, only longer.
The future is littered with prizes... - Scar
The future is much like the present, only longer!
The future is much more difficult to predict than the past.
The future is not set. There is no fate but what we make.
The future is not what it used to be.
The future is not what it used to be. --G'Kar.
The future is purchased by the present.
The future is sort of like the present... only longer.
The future is when you'll wish you'd done what you aren't doing now.
The future isn't what it used to be.
The future isn't what it used to be. G'kar
The future isn't what it used to be. It never was.
The future isn't what it used to be. - G'Kar
The future isn't what it used to be...
The future just isn't what it used to be!
The future lies ahead. The past lies, lies, lies,
The future may be here now, but you are gonna *PAY* for it.
The future sucks, change it - Beavis.
The future sucks, change it Orville! huh huh huh
The future sucks... change it... -Beavis
The future sure ain't what it used to be.
The future sure looks bright. -- Brisco
The future was yesterday.
The future will be like the past, only more expensive
The future will be like the past, only more expensive.
The future's so bright, I gotta wear shades!
The future's so bright, I've got to wear shades...
The future's so bright,I gotta wear shades. B-)
The future's uncertain and the end is always near.
The future's uncertain and the end is always near...
The future; it's coming, but there's medication for it.
The game is afoot (all six of them) - SimAnt
The game is difficult when an opponent changes the rules.
The game is electronic mail, 4-star taglines or better to open
The game of hockey is never called off on account of lost blood.
The game of hockey is never called off on account of missing teeth.
The game of love is never called off on account of darkness.
The game they play is called God.
The game's a little bit wide open again.
The game's afoot. Henry V 3.1.32
The gap between the rich & poor didn't grow in the '80s. -LIMBAUGH
The gap between the rich & poor grew in the '80s X 2.5. - CBO
The garbage chute was a wonderful idea!
The garbage disposal gods may demand an offering of a spoon.
The garbage disposal gods sometimes demand an offering of a spoon.
The gates of hell shall not prevail against them. (3 Nephi 11:39)
The gates of pearl have turned to gold it seems you've lost your way!
The gauntlet has been cast.
The gauntlet has been thrown down!
The gene pool could use a little chlorine!
The gene pool could use a little chlorine.
The gene pool has no lifeguard
The gene pool has no lifeguard.
The gene pool needs a lifeguard.
The generation of ramdom numbers is too important to be left to chance
The generation of random numbers is too important to be l
The generation of random numbers is too important to be left to chance.
The generation of random numbers is too important to be left to chance.
The generation that change the world is still looking for its car keys!
The genius of women... intuitive in function, spiritual in tendency.
The gent who wakes up and finds himself a success hasn't been asleep.
The gentlemen looked one another over with microscopic ca
The gentlemen looked one another over with microscopic carelessness.
The ghost of a chicken is a poultrygiest
The ghost of chicken is a poultrygeist.
The ghost of things to be avoided.
The ghosts of love stand clear to see.
The gift of happiness belongs to those who unwraps it.
The giraffe you thought you offended last week is willing to be nuzzled today.
The girl came in and he freaked. - Richie Ryan
The girl of your dreams exists only as a GIF file.
The girl of your dreams is unavailable except in GIF.
The girl of your dreams is unavailable except in print.
The girl of your dreams is unavailable except in print.
The girl turned ripe and the pickers came today!
The girl was writing the way you speak in the dark..
The girl who was so bashful she went into a closet to change her mind.
The girl's half-wit. She shouldn't be out here!
The girlfriend in THE CRYING GAME is actually a guy.
The girls appreciate a *slo-o-o-w* hand!
The girls in the corner are waiting to do their number.
The giving hand ... receives
The glass is half full--and what's in it has gone rancid.
The gleam in your eye is from the sun hitting your bifocals.
The glorious failures and the glorious victories...
The glory of God is intelligence. - D&C 93:36
The glory of creation is in its infinite diversity.
The glory of the Lord shone round about them. - Luke 2:9
The goal of Computing Science is to build something that
The goal of evolution is self-conquest.
The god you don't believe in, I don't believe in either
The gods are not crazy, they're higher than kites!
The gods favor those with the big spells.
The gods gave me a brain, not a Bible.
The gods play games with men as balls. <Titus Maccius Platus>
The going got weird and Ross Perot turned pro.
The going got weird and he turned pro.
The going got weird, and he turned pro.
The golden rule: He who has the gold makes the rules.
The golden years suck
The good have no need of an advocate. Phocion (317 BC)
The good is that to which all things aim. - Aristotle
The good is the enemy of the best. (Bill W, p107 AACA)
The good lord willing and the board don't crash.
The good news is that I don't need it anymore.
The good news is that the bad news is not much worse than usual.
The good news is that the bad news was wrong
The good news is that the bad news was wrong...
The good news is there is plenty of lithium.
The good news is you're not dead. The bad news is you're still burning
The good of the people is the chief law.
The good old days are good and gone now.
The good old days: Beer foamed and dishwater didn't.
The good people of the world are washing their cars.
The good shepherd doth call you. (Alma 5:38)
The good shepherd giveth his life for the sheep. - John 10:11
The good thing about the movie was that it was short! - Joel
The good things in life cost too much?
The gorilla smiled at me! -- Zachary Butler
The governement want to put toll gates on the Info-super-hiway
The government UGORE car? Expect 50 million cost overrun.
The government hates Christians who believe in self-preservation.
The government is a much bigger threat than any militia. - J. Brown.
The government is an experiment in Artificial Stupidity.
The government is expanding to meet the needs of an expanding government.
The government is supposed to PROMOTE the General Welfare, not TAX it!
The government just rezoned my body, I'm now a public waste area.
The government makes us miserable and we PAY them for it.
The government must like poor people. It makes so many of them.
The government repossessed Old McDonald's farm.
The government that governs best, governs least!
The government that governs least governs best.
The government's problem is it's full of politicians!
The governments gone, the only hope left is Jesus.
The governor's car is not far behind / He's not the one I have in mind
The grace of the Lord Jesus be with God's people. Amen.
The grandmother didn't want to go to Florida.
The grass ain't always greener on the other side.
The grass is always greener on the other side of your sunglasses.
The grass is always greener...until you mow the lawn.
The grave opens up before me like a ...... big hole in the ground.
The graveyards are full of indispensable men -- Roger Zelazny.
The graveyards are full of indispensable men.
The graveyards are full of indispensable men. - Charles de Gaulle
The graveyards are full of indispensable people.
The great Crow speaks? - Tom w/sarcasm sequencer on high
The great Prince Randy will now listen to your pleas.
The great Princess Chrissy will now listen to your pleas.
The great black cosmic muffin mistress is quite peeved at you.
The great charm of cats is their rampant egotism.
The great god Pan is dead!
The great man is he who does not lose his child's-heart.
The great object is that every man be armed. - Patrick Henry
The great object is that every man be armed. -- Patrick Henry
The great open spaces where cats are cats. - Marquis
The great sucking sound you hear is a tagline pulled into my computer.
The greater the ignorance the greater the dogmatism.
The greater the man, the greater the crime.
The greatest ability is dependability.
The greatest awards in life are those you bestow.
The greatest battles to be won are the battles you fight with yourself
The greatest cunning is to have none at all.
The greatest day in sports...the Indy 500!.
The greatest fault is to be conscious of none.
The greatest gift we can give is rapt attention to another.
The greatest griefs are those we cause ourselves.
The greatest griefs are those we cause ourselves.<Sophocles>
The greatest headaches are those we cause ourselves.
The greatest liberator of the 20th Century was ... a Communist!
The greatest man in history was the poorest.
The greatest need a person has is to know Jesus Christ.
The greatest nightmare of our time is waiting for you. - Delenn
The greatest of all arts is the art of living together.
The greatest of all faults is to imagine you have none
The greatest of faults is to be conscious of none.
The greatest people in the world baud thru this Modem.
The greatest pleasure in life is doing what people say you cannot do.
The greatest pleasure--doing what they said couldn't be d
The greatest productive force is human selfishness -- Heinlein
The greatest productive force is human selfishness.
The greatest productive force is selfishness!
The greatest remedy for anger is delay.
The greatest sword in all the holodeck. * Riker
The greatest talents are shrouded in obscurity. - Plautus
The greatest test of courage is to bear defeat without losing heart.
The greatest tool of all is Imagination.
The greener grass next door is just as hard to cut.
The gripping luggage sequence - Tom Servo
The grocery stores in hell don't carry garlic or chocolate.
The groundwork to all happiness is health.
The gruesome grue grew some.
The guidance counselor is steering her towards smut - Tom
The guilty are dead! Hang the living innocent!
The gull sees farthest who flies highest......Richard Bach
The gun Clinton went duck hunting with would be banned.
The gun is aimed at you. We're the Cowboys from Hell.
The guy sure looks like plant food to me!
The guy was all over the road. I had to swerve several times to hit'em
The guy who holds you down & pummels you w/music - Dr. F
The guy with the least Taglines killed the guy with the most Taglines.
The guy's average income was around midnight.
The guys from Deep 13 go walking - Dr. F & Frank sing
The hair is the richest ornament of a woman.
The half a brain Rush ties behind his back is his truthful half.
The hand that gives, gathers. English proverb
The hand that rocks the cradle rules the world.
The hand that turneth the knob, opens the door.
The handlers don't become so attached to the lawyers.
The hands aquire shaking, the shaking is a warning.
The hands that help are better than the lips that pray..
The handwriting on the wall may be a forgery.
The hangman let us down.
The happiness of your life depends on the quality of your thoughts.
The happy and the powerful never willingly go into exile.
The hard disk you save may be your own
The hard disk you save may be your own.
The hard drive is down and the sexdrive is operational!.
The harder the conflict, the more glorious the triumph.
The harder you fall the higher you bounce.
The harder you fall, the higher you bounce.
The harder you work for something the more you appreciate it.
The harder you work, the luckier you get
The hardest part of eating a vegetable is the wheelchair.
The hardest thing about time travel is the grammar.
The hardest thing in life to learn/is which bridge to cross and which to burn.
The hardest thing in the world to understand is the income tax. Einste
The hardest thing to get out of kid's undies? M. Jackson's makeup.
The hardest thing to learn in life is which bridge to cross and which to burn.
The hardest tumble a man can make is to fall over his own bluff.
The hardest work is to go idle. Yiddish Proverb
The hardest years are between 10 and 70.
The hardest years in life are between 10 and 70. Helen Hayes
The harp, indeed, the harp.
The hash brownies look good! - Mike
The hate is swelling in you. Take your Jedi weapon. Use it. - Emperor
The hate is swelling in you. Take your Jedi weapon. Use it.
The haves and have-nots come from the dos and do-nots.
The hawk swooped overhead. And so did the vulture.
The head is the best part.
The head learns new things, but the heart practices old experiences.
The head which at this time has no name. Kurgan "I know his name"...
The heart has eyes that the brain knows nothing of.
The heart has eyes which the brain knows nothing of.
The heart has reasons that reason does not know.
The heart has reasons that reason does not understand.
The heart has reasons that reason knows nothing of.
The heart is forever making the head its fool.
The heart is not a logical organ.
The heart is wiser than the intellect.
The heart is wiser than the intellect...
The heart of a cow can never be put down my throat.
The heart of many a fair maiden has been won with the ring of steel.
The heart seldom feels what the mouth expresses.
The heart that loves is always young!
The heat is blowing up my skirt - Mike
The heater's plugged in but the rheostat's shot.
The height of injustice is having to pay for justice.
The heir to the family fortune might drive a Legacy.
The hell with it. That's how I feel. - Trapper
The hell with the Prime Directive - Let's kill something.
The hell with the fee, FIND THAT DAMN BUG !
The hell with the prime directive, let's kill something.
The hell with the prime directive; let's kill something!
The hell with your mountains ! Drink Bud.(G)
The hemoglobin protein breaks down and - SPUNG! - you're dead.
The herd instinct among economists makes sheep look like independent thinkers.
The hidden flaw never remains hidden.
The hidden message in this tagline can only be perceived clairvoyantly
The high cost of living hasn't affected its popularity.
The high price of bigamy.TWO mothers-in-law!
The higher the ape climbs the more he shows his bald haunches.
The higher the buildings, the lower the morals.
The higher you climb the flagpole, the more people see your rear end.
The highest Trill surcharge on office machines: The Max Dax Fax Tax.
The highest bidder catches the most politicians.
The highest praise in cyberspace is having your tags stolen
The hightest mountain in the land is oftenest covered with mist.
The hills are alive with the sound of bandicoots....
The hills are alive...and they're hungry.
The hills are in flames - Tom sings
The hills were worn down by eroticism
The hind that would be mated with the lion must die of love.
The history of Ferrengi foreplay fits on this line!
The history of Liberty is the history of resistance.
The history of every country begins in the heart of a man or woman.
The holder of this name is two people...people
The hole and the patch should be commensurate.
The holodeck becomes caught in loop: ship is overcome by 10,000 care bea
The holodecks; have all you'll ever need. - Wesley
The holy cross, symbol of lies;intimidate the lives of Christian born
The homeless make good road bumps.
The homosexuals will go away once we invent the phaser... <G>
The honest way to money is through aardvark.
The honeymoon is a period between dating and debating.
The honeymoon is that period of doting between dating and debting.
The honeymoon is that short period of doting between dati
The honeymoon is that short period of doting between dating and debting.
The honour is to serve - Worf
The hookworm larvae enters the human body through the soul.
The horns kicked in And my shoes started to squeak
The horrible tin-foil man from outer space - Tom
The horse is dead. - Martin Pollard
The horta was so startled, it lost its marbles.
The hot dog is the homeless eagle of free enterprise.
The hotel of your mind has many vacancies. <frowns> - Yakko
The hottest Garfield episode EVER - Mike on Kitten W/Whip
The hours became heavier and weighted,
The house extended me a $100,000 line of credit - Servo
The house is haunted -- Ned
The house next door is on fire. D'you wanna watch?
The human adventure is just beginning.
The human heart opens only to the heart that opens in return.
The human mind ordinarily operates at only ten percent of its capacity -
The human race has only one effective weapon, and that is laughter.
The human race is still in Beta Testing.
The human race is still in beta test...
The human soul needs actual beauty more than bread. D.H. Lawrence
The human spirit is a hard thing to kill, even with a chain saw
The human spirit is a very hard thing to kill. Even with a chainsaw.
The human who posted this is jointly owned by 2 kittens and 3 dogs.
The human who posted this is jointly owned by four cats!
The human who posted this is jointly owned by two kittens
The hunted hippopotamus doesn't think a lot of us.
The hurrieder I go, the behinder I get!
The hurrier I go the behinder I get.
The hurrier I go, the behinder I get.
The hurt gets worse and the heart gets harder..
The hydroelectric plant's beautiful! said Tom fainting with dam praise.
The hypochondriac's epitaph: "NOW will you believe me?"
The hypocrites are slandering the sacred halls of truth..... -RUSH
The hypocrits are slandering the sacred halls of truth. -Rush
The ice cream truck in my neighborhood plays "Helter, Skelter."
The ice cream truck in my neighborhood plays `Helter, Skelter.' - s.w.
The idea is to die young as late as possible.
The idea is to die young as late as possible. -- Ashley Montague
The idea is to make the enemy die for HIS country, not vice-versa.
The idea of Christ is much older than Christianity.
The idea of calm exists in a sitting cat.
The idea of male and female are universal constants.
The idea of male and female are universal constants. - Kirk
The ideal nuclear family? Post nuclear more like!
The ideal wife is the woman with the ideal husband.
The ill-tempered cannot teach. Hillel
The illegal we do immediately, the unconstitutional takes longer. - HK
The illuminati aren't out to get you. What was your name again?
The imagination gallops while judgement goes on foot!
The immoratal words of Socrates -- "I drank what?"
The important thing is never to stop questioning.
The important thing is not when you die, but how you live.
The important things are always simple.
The important things are always simple. 'Murphy
The impossible I can do at once, miracles take a little longer!
The impossible anytime, miracles take a little longer.
The impossible is often the untried.
The in-flight magazines will act as a sedative. - Lister
The incomprehensible thing about the world is that it is.
The incredible power of Mom! - Mike
The incumbents are crooks, vote them out
The incumbents are crooks, vote them out!
The infantry DOES IT in fox holes.
The influence of a beautiful, helpful, hopeful character is contagious.
The info you get is only as good as the info you give.
The information provided has not been cited to protect the innocent.
The information super highway has turned out to be a TOLL road.
The information superhighway is DOOMed.
The inmates have taken over the asylum.
The innocent-sounding ones are always the killers.
The insect in William's hand is wearing a yarmulka! said Tom jubilantly.
The instrument please! - Yakko
The instruments of darkness tell us truths. (MacBeth)
The intent of a question is sometimes as important as the answer.
The intention amounts to nothing unless the effect follow.
The international signal for NO DRAGONS - Tom
The invincible weapon against the evils of earth is the caring heart.
The invincible winner and you know your are born to be..
The invisible smiley
The invisible smilie
The irony of life is that no one gets out alive
The irony of life is that no one gets out alive!!
The irony of life is that no one gets out alive.
The irony of this is just sickening. -Calvin
The is abuse. Arguments are down the hall.
The jawbone of an ass is just as dangerous today. Look at Clinton!
The jelly is 50% set, Tom affirmed.
The joy of the Lord is my strength.
The joy of the hypocrite but for a moment. - Job 20:5
The judge wiped her tears with my checkbook.
The jugged fish *is* 'alibut!
The jugged fish _is_ `alibut!
The jury is to disregard the last comment.
The jury will disregard that last statement.
The jury's purpose is to decide which side had the best lawyer.
The just shall live by faith. - Romans 1:17
The key is kind of central to this piece-- Crow T. Robot
The key to being a Moderator is MODERATION.
The key to success is selling my mom's chocolate chip cookies.
The key to success: forgetting you screwed up before.
The key! The end! The answer! Stripped of their disguise! -Rush
The keyboard .how quaint. - Scotty STIV-TVH
The keyboard cannae take it, cap'n.
The keyboard is mightier than the Moderator.
The keyboard is the tongue of the mind.
The keyboard... how quaint. -- Scotty
The keyboardhow quaint.
The kids did all their own stunts - Joel
The kids feign interest so as not to rile Uncle Jim -Crow
The kids seem to like the Lisa Loeb - Mike
The killer awoke before dawn. He put his boots on....
The kilt is an unrivalled garment for fornication and diarrhea.
The king must kneel to let his kingdom rise. -Bastille Day, Rush
The king? Nope, not Elvis, guess again....
The kingdom of God is within you. <Luke 17:21>
The kingswood! You're not takin' the kingswood! - Ted Bullpit
The kitchen's on fire again.
The knack of flying is learning how to throw yourself at the ground and miss.
The knights who say "Ni" demand....a sacrifice!
The knights who say 'Ni' demand...A sacrifice!
The knights who say Nee demanda sacrifice!
The lab called ... Orville's brain is ready.
The lab called. Your brain is ready.
The lab called...Martin Pollard's brain is ready.
The lab called...Orville Bullitt's brain is ready.
The lab called...Orville's brain is ready.
The lab called: your brain is ready.
The lab called; your brain's ready.
The lab just called. Your brain is ready.
The laborer is worthy of his hire, only if his labor is.
The ladder of success is always missing a few rungs.
The ladder to success has broken steps.
The lads in town were all me kin and me father was the cause!
The lady doth protest too much, methinks.
The lake comes right up to the shore.
The lake it is said, never gives up its dead.
The lame dog may miss the hunt, but not the meal.
The land of Nod had Nodocs, as the hospitals were all elsewhere.
The land of Nod moderator's name was Noderator.
The land's primary function is to provide fishing stores...
The large print giveth and the small print taketh away.
The laser is broken, said Tom incoherently.
The last 5 minutes of any TV show will explain the entire plot.
The last Apple that had any power was given to Adam by Eve.
The last Christian died on the cross. --Anonymous.
The last I heard, being alive isn't a crime - Morton
The last Moderator on the left.
The last day does not bring extinction, but a change of place. Cicero
The last enemy that shall be destroyed is death. - 1 Cor. 15:26
The last enemy that shall be destroyed is death. - Saint Paul
The last maintenance crew in this area wouldn't come back - Ivanova
The last one
The last person who said that, God rest his soul, lived t
The last sound that it made was "ZAP!"
The last sound that it made was "Zap" .
The last thing GAY means is to be happy!
The last thing I saw was Warp!
The last thing I saw was this Big Blue Wave!
The last thing I saw was this blindfold cumming down over my eyes!!!!
The last thing you want your DM to say: "Everybody save vs. breath!"
The last time I went, I never came back.
The last time around, I didn't believe in reincarnation either.....
The last time we had a President Buchanan, we got the Civil War
The last words of Jesus: "Hey Mary! I can see the house from up here!"
The last words of Jesus: "I love a parade!"
The late 50s and booze is there! - Crow
The late start is due to the time.
The latest drink craze: The Tonya Bobbitt - club soda with a slice.
The latest thing to put up with on Fight-o net...
The law disregards trifles, has it spoken to you recently
The law disregards trifles, what is this dessert called?
The law hath not been dead, though it hath slept. --Shake.
The law neither does nor requires idle acts, wake up.
The law neither does nor requires idle acts.
The law of intelligent tinkering: save all the parts.
The law of self-preservation is surer policy than any legislation.
The law of the bayonet says the man with the bullet wins.
The law says the building must go here, Tom cited.
The law says you can have only one spouse. This is called monotony.
The laws consist not in being read, but in being understood.
The lawyer got his client a suspended sentence. From a tree.
The lawyer hit the fan.
The lawyers want a word with you out in the limo.
The leader of a safari might drive an Impala.
The leading cause of divorce is marriage.
The leading cause of statistics is smoking.
The lectures on time travel will be held yesterday, and an hour ago.
The leg, she is fracture, Tom said in broken English. -usenet oracle
The legal limit to post of your blood-alcohol level is 26.5%
The legs of Men will lag on a rough roZ%Vhile a Dwarf goes on!-Gimli
The legs of Men will lag on a rough road, while a Dwarf goes on!-Gimli
The length of a meeting rises with the square of people present.
The length of a minute depends on your side of the bathroom door.
The length of the war depends on how long it might be.
The less a statesman amounts to the more he loves a flag.
The less a statesman amounts to, the more he loves the flag.
The less effort, the faster and more powerful you will be. <Bruce Lee>
The less our government gives us, the more it charges us.
The less they pay you the more they want for it. Metzger's law.
The less things change, the more they remain the same.
The less things change, the more they stay the same.
The less time planning, the more time programming.
The less we know, the more we suspect.
The less you bet, the more you lose when you win.
The less you bother me, the sooner you'll get results.
The less you know about computers, the more you want MicroSoft Windows
The less you open your heart to others, the more your heart suffers
The less you say, the less you have to take back.
The lesson. --Kosh.
The lessons extend well beyond the medical domain.
The letter H, A, L are alphabetically adjacent to the letters I, B, M.
The letter `n' could be a vowel if someone stood up for it.
The letters H, A, L are alphabetically adjacent to the letters I, B, M.
The liberal ideology of the 50's sure ain't the one from the 90's.
The liberal ideology of the 60's sure ain't the one from the 90's.
The library is no place to sleep.
The life and times of Lulu, Mrs. O'Leary's ill-fated cow.--G Larson
The life he leads - he'd rather die than give it up.
The life of a prisoner by I. Ben Framed.
The life-span of a one dollar bill is about eighteen months.
The light at the end of the tunnel .... IS A TRAIN!
The light at the end of the tunnel had 52 freight cars!
The light at the end of the tunnel has 52 freight cars.
The light at the end of the tunnel has 52 frieght cars.
The light at the end of the tunnel is a muzzle flash.
The light at the end of the tunnel is a train coming this way.
The light at the end of the tunnel is at the wrong end.
The light at the end of the tunnel is the headlight of a train
The light at the end of the tunnel is the headlight of an approaching train.
The light at the end of the tunnel is the headlight of the oncoming train.
The light at the end of the tunnel is usually a "No Exit" sign.
The light at the end of the tunnel just died.
The light at the end of the tunnel just might be an on coming train.
The light at the end of the tunnel may be a Red Dragon.
The light at the end of the tunnel may be an inbound fireball.
The light at the end of the tunnel may be an oncoming dragon
The light at the end of the tunnel may be an oncoming dragon.
The light at the end of the tunnel might be an oncoming train.
The light at the end of the tunnel was an oncoming train.
The light is red unless there's an election - Crow sings
The light of a hundred stars does not equal the light of the moon.
The light seen at an end of a tunnel is at the wrong end.
The light that burns twice as bright burns half as long
The light that burns twice as bright burns half as long.
The lighter side of wholesale bread delivery - Crow
The lights are on, but you're not home.
The lights are out, Tom said gloomily.
The lights on, but nobodies home!
The line forms on the floor, and works its way up.
The lion and the calf shall lie down together but the calf won't get much sleep.
The lion and the calf will lie down together. The calf won't sleep.
The lion ate the dog, now why oh why did she swallow the fly?
The lion has its head caught in the skylight, said Tom uproariously.
The lion sleeps tonight... - Timone
The little DOS user who could: "I think Icon, I think Icon."
The little I know I owe to my ignorance - Sacha Guitry
The little I know I owe to my ignorance. -Sacha Guitry
The little demon was deceitful, Tom implied.
The little engine that could would've done it sooner as
The little engineer that could
The little gray bits are non-stick frying pan.
The little nothings. It shouldn't bother me, but it does.
The little queen, all golden, flew hissing at the sea.
The little things are most worthwhile - a quiet word, a look, a smile.
The living are the dead on holiday. -- Maeterlinck
The living dead don't need to do word problems.
The living dead don't need to solve word problems - Calvin
The living dead don't need to solve word problems.
The living need charity more than the dead. -- Arnold
The living need charity more than the dead. George Arnold
The living world is a continuum in each and every aspect.
The lizard said he's a brontosaurus on his mother's side.
The local diner doesn't give out doggie bags. The SPCA won't let `em.
The location scout had his hands full - Tom
The loftier your goals, the higher your risk, the greater your glory.
The longer a man is wrong, the surer he is that he's right.
The longer the title, the less important the job.
The longer you're married the more you dream about CHOCOLATE!
The longest journey is the journey within. Dag Hammarskjold
The longest list has a final item.
The longest list of errors ever.
The lonliness of the long distance dweeb - Mike
The lonliness of the long distance greaser - Mike
The lost generation is the one you forgot when computing your age.
The lottery is a tax on those who can't do math!
The lottery? You mean I can finally register my shareware?
The louder the music, the better the code.
The loudest boos often come from those given the free seats-Ed Parker
The love at journey's end speaks only to those quiet enough to listen.
The love child of Jim Backus & Sally Field - Tom
The love of a husky is a precious thing.
The love of liberty is the love of others. -- Hazlitt
The love of money is the root of all evil. For more info, send $20.
The love of money is the root of all evil. - 1 Tim. 6:10
The love of money is the root of all politics.
The love that moves the sun and the other stars -- Dante's Paradiso.
The love we give away is the only love we keep.
The low key, laid back type - Mike
The luck of the Irish.
The luck ordained for you will be coveted by others.
The luck that is ordained for you will be coveted by others.
The luckiest man was Adam - he had no mother-in-law.
The lunatic is in my head .. - Pink Floyd
The lunatic is on the grass..
The lunatic types on . . .
The lunatics are in my hall.
The lunch counter at Tom & Rosie's diner - Tom on pigs
The lure of the clambake proved to be their undoing -Mike
The machine that goes...BING!
The mad are all in God's keeping. -- Kipling
The mad quoter!
The mad scientists are calling. -- Crow T. Robot
The magic of Windows - turn a 486-50 into a 4MHz XT
The magic of Windows: Turns a Pentium into an XT, instantly.
The magic of Windows: turns a 486/50 into a TRaSh-80.
The magic of Windoze: Turning a 486 into an XT.
The magic of Windoze: Turning your 486 into an XT.
The magic of the tongue is the most dangerous of all spells.
The magic that you feel will work a lifetime.
The maiden be thine! - Sheriff of Dodge City
The maiden names don't ring bells.
The mail man will surprise you some day.
The mail must go through.
The mailman bringeth.. The trashmen taketh away!
The mailman bringethThe trashmen taketh away!
The main purpose of water is to make oceans.
The main trouble with a French horn is it's too tangled up.
The major cause of lawyer deaths is Ambulances, backing up!
The major food groups: Chocolate, Pizza, Caffeine, Sex
The majority is never right - unless it includes me.
The majority is never right. -L. Long
The majority isn't silent - the government ignores us.
The majority isn't silent - the government is DEAF!
The majority isn't silent -- the government ignores us.
The majority isn't silent, it's just that the ruling class is deaf.
The majority isn't silent- the government is deaf!
The majority isn't silent--the government is deaf!
The majority isn't silent. The government just won't listen.
The male body needs sex at all times it's a living hell.
The male body needs sex at all timesit must be a living hell!
The male body needs sex at all timesit's a living hel
The male is a domestic animal that can be trained to do most things.
The male libido can be a very fragile thing. - Hawkeye
The male sheep was badly cut, Tom rambled.
The male witches of Salem were well-hung!
The man drives a starship, so somebody thinks he'd make a good medic.
The man in the moon is smiling at the girls in the world.
The man is no different from the boy; only moreso.
The man is tainted in's wits. Twelfth Night 3.4.13
The man of God loves the Scriptures. -- Psalm 119:97
The man on television told me to say tuned.
The man on top walks a lonely street.
The man should be hung from his TagLines!
The man should be hung from his recipes!
The man who begins many things finishes few.
The man who dies with the most toys is dead.
The man who dies with the most toys is dead..
The man who dies with the most toys is still dead.
The man who dies with the most toys....still dies.
The man who dies with the most toyshas too many kids.
The man who does not look at his change is no true poet.
The man who does not value himself, cannot value anything or anyone.
The man who fell into the upholstery machine is now fully recovered.
The man who has accomplished all he thinks worthwhile has begun to die
The man who has everything should be quarantined.
The man who has never been flogged has never been taught.
The man who has never made a mistake, has never made anything.
The man who invented spaghetti really used his noodle.
The man who invented the eraser had the human race pretty well sized up.
The man who invented the eraser pretty well sized up the human race.
The man who is poor becomes disposable.
The man who loses his opportunity loses himself. George Moore
The man who makes no mistakes does not normally make anything. Phelps
The man who makes no mistakes does not usually make anyth
The man who marries for money will suffer for it... but in comfort!
The man who misses an anniversary catches it later...
The man who removes a mountain begins by carrying away small stones.
The man who values himself will not risk death on the front line.
The man with talent on loan from God. Rush Limbaugh.
The man with the toothache fears the dentist's chair.
The management is not responsible for taglines left unattended.
The mangrove swamps are there for a reason, you Yankee dickweed!
The manner in which it is given is worth more than the gift.
The mans too big, the mans too strong.
The manual is definitive. Reality is often innacurate.
The manual is kind of unclear on this.
The manual only makes sense AFTER you learn the program.
The manufacturer may claim that this product is ten-dimensional^.
The manure is sure to impact the rotary ventilator...
The map is not the territory!
The map is not the territory. <Alfred Korzbyski>
The marcher said "I have overcome" when his wife had triplets.
The margin is very marginal.
The mark of a true MBA : often wrong, but seldom in doubt
The mark of a true professional is giving more than you get.
The martini faucet is in the back - Crow as drunk
The mass detector failed once again and once again he died.
The master is not married, nor do I think he ever will be.
The master of dreams, my soul will keep...-Elm St. Children
The master's tools will never dismantl the master's house
The maxi-strength bbs.
The me that you know doesn't come around much - NIN
The me that you know had some second thoughts - NIN
The me that you know is now made up of wires - NIN
The me that you know, he used to have feelings.
The mean streets of Appleton - Crow
The meaning of life is *%@#(# NO CARRIER
The meaning of life is this: It stops.
The meaning of life is: NO CARRIER
The meaning of life is: "How now brown cow."
The meaning of life is: "What is the meaning of life?"
The meaning of life is: NO CARRIER
The meaning of life is: lesbianism! <= Hey! I just *collect* these :-)
The meaning of life, the universe and everything: 42
The means of the one out weigh the means of the many!!!!
The media & the O.J. story: feeding frenzy in a tank of baracudas.
The media lies! I read it in the paper.
The media. It sounds like a convention of spiritualists. -Stoppard
The meek SHALL inherit the Earth. The rest are leaving.
The meek are contesting the will.
The meek are getting ready
The meek are going to contest the will.
The meek can have the Earth, give me _the stars_.
The meek inherit dirt; the bold get mineral rights.
The meek may inherit earth. Those who dare, the stars.
The meek may inherit, but for now they'd better lay low.
The meek really do inherit the Earth - in small plots, 6 x 6 x 3.
The meek shall inherit the Earth ... anyone else would refuse.
The meek shall inherit the Earth We shall inherit the Stars!
The meek shall inherit the Earth after we're done with it.
The meek shall inherit the Earth, but not the mineral rights.
The meek shall inherit the Earth...We shall inherit the Stars
The meek shall inherit the Earth..err,umm..If it's okay with you guys?
The meek shall inherit the earth (if that's okay with you).
The meek shall inherit the earth - in 6' x 2' plots. - L. Long
The meek shall inherit the earth -- they are too weak to refuse.
The meek shall inherit the earth, but no mineral rights.
The meek shall inherit the earth, but not its mineral rig
The meek shall inherit the earth, but not its mineral rights. - J. Paul Getty
The meek shall inherit the earth, if that's OK with you
The meek shall inherit the earth. In 6' x 2' x 6' plots.
The meek shall inherit the earth. The rest of us will go
The meek shall inherit the earth. They are too weak to r
The meek shall inherit the earth...anyone else would refuse
The meek shall inherit the earth...unless you have any objections ?
The meek shall inherit the earth; the rest of us shall go to the stars
The meek shall inhibit the earth.
The meek shall internet the earth
The meek will inherit the Earth, the rest of us will go to the stars.
The meek will inherit the Earth..... The rest of us will go to the stars.
The meek will inherit the earth - the rest will inherit the STARS!
The melancholia of everything completed! - Nietzsche
The memory is the first thing to go, I forget what comes next
The men don't know but the little girls understand
The men of Liverpool are the most perfidious in England.
The men you love you hate the most --U2
The mental image of a body carries with it... a dream.
The merciful man doeth good to his own soul - 11:17
The mere thought of you makes me blush. ;-)
The message bird got loose*&^%$#@NO CARRIER PIGEON
The message bird got loose...@^#&n&e... NO CARRIER PIGEON
The message is hot, steaming love, Texas style. - Joel
The message is up above, why are you reading this?
The message is up above. What are you reading THIS for?
The message you have just read is true. Would I lie to you... Again?
The metalic years, silver hair, gold teeth, lead botom.
The mice may have the right but the cat has the claws
The mice voted to bell the cat.
The mice will see you now.
The microwave gods sometimes demand an offering of tin-foil.
The microwave movie: "Daddy, I Blew Up the Cat."
The middle aged suspect everything
The middle class has been taxed enough! APRIL FOOLS! -- Bill Clinton.
The middle of the road holds yellow lines and dead skunks
The middle of the road is just yellow lines and dead armadillos.
The mighty oak was once a little nut that stood it's ground
The mighty oak was once a nut who stood his ground!
The mildly harsh slave hunters - Mike
The military intelligence, two words combined that can't make sense.
The military loathes you, too, Bill.
The military mouthwash: Enlistermint.
The military without gays is like a fish without a bicycle ...
The mills of the gods grind very slow but exceedingly fine.
The minbari are an intergalactic accident waiting to happen -Twolan-
The mind boggles...the taste buds shudder.
The mind goes first, but I can't remember what goes next!
The mind grows by what it feeds upon.
The mind is a funny place. I do not even trust my own.
The mind is a terrible thing to taste (Ministry)
The mind is a terrible thing to taste.
The mind is a terrible thing when wasted.
The mind is a terrible thing, and must be stopped.
The mind is like a parachute - it works only when ope\S
The mind is like a parachute - it works only when open.
The mind is like a parachute...It works best when open...
The mind is no match with the heart in persuasion.
The mind is not a vessel to be filled but a fire to be kindled. -- Plutarch
The mind is only as vivid as the eye can see.
The mind is the 2nd thing to go! I forget what's first.
The mind is the 2nd thing to go, don't remember what's 1s
The mind is the 2nd thing to go, don't remember what's 1st
The mind is the place great adventures start.
The mind is what the brain does.
The mind of a liberal politician is open at both ends.
The mind of each man is a Savage Garden-Marius-
The mind opens, and in creeps wisdom.-Lwaxana Troi
The mind wobbles. --Kelly Bundy
The mind works in mysterious ways. When it works.
The minumum daily requirement for hugs is 4.
The minute a man is convinced he's interesting, he isnt'.
The minute a man is convinced that he is interesting, he isn't.
The miracle of Windows 3.1: Turns a 486 into an XT.
The miracle of life is waking up in the morning.
The misery's optional.
The misfortunes hardest to bear are those which never came.
The mission of the military is to kill people and break things.
The mistake you made is in trying to figure it out.
The mistake you made, was in trying to figure it out!
The mistake you make is in trying to figure it out.
The mistake you make is in trying to figure it out. - Tenessee Willams
The mistake you make is trying to figure it out.
The mixed up werewolf mooned at the bay.
The moderator doesn't know what I'm doi.@#%$#% NO CARRIER
The moderator has banned this tagline from the echo.
The moderator is *not* God; God has mercy!
The moderator is ALWAYS right, opposing viewpoints are not welcome.
The moderator is a stupid, idiotic, good for no#@^%$@&#%# <NO CARRIER>
The moderator is always in the wrong.
The moderator is corrupt, please reboot FidoNet.
The moderator who irritates users moderates best! NOT!
The moderator's back, and we're gonna be in trouble...
The moderator's back, we'd better stop this conversation.
The moderator's ban is mighter than the tagline! --
The moderator's everywhere, he'll quickly stop a flame.
The moderator's moderation is triply off-topic.
The mome rath hasn't been born that can outgrabe me.
The mome rath isn't born that could outgrabe me.
The mome rath isn't born that could outgrabe me. -- Nicol Williamson
The moment you're born, you're done for.
The money comes from taxes, obviously.
The monitor lizard looks delicious - Crow
The monkey speaks his mind.
The monkey's dead. The message is over.
The monkeys seem willing to strike up the tune.
The monster in the lake has eaten my cake, said Tom necessarily.
The monster needs Cruex for her face -Joel on fuzzy alien
The monsters haven't turned blue yet, and I have to eat more dots.
The moon came out & it was like Jerry WILLED it! - Gypsy
The moon is a planet just like the Earth, only it is even deader.
The moon is blue and I'm not to happy either.
The moon is blue and I'm not too happy either.
The moon is made of a green cheese. J.Heywood (1497-1580)
The moon is made of green cheese.
The moon is to a falling star.
The moon isn't waxing, it's dusting and vacuuming rugs.
The moon may be smaller than Earth, but it's further away
The moon may be smaller than Earth, but it's further away.
The moon only rises once a day?
The moon seems smaller than earth, but it's farther away.
The moon was rocking back and forth in the sky.
The moral is: Never try to teach your parents anything.
The moral majority is neither.
The moral of today's story is irrelevant. - Yakko Warner of Borg
The more I know about WINDOWS, the more I like DesqView!
The more I know about religion, the more I like video games.
The more I know men, the better I like my cat.
The more I know men, the better I like my dog.
The more I know women, the better I like my cat.
The more I learn about civilized society, the more I love my cats.
The more I learn about men, the more I like my dog.
The more I learn about myself, the more I become a different self.
The more I learn, the less I find I know.
The more I learn, the less I know.
The more I learn, the more I have to learn.
The more I learn, the more I learn I need to learn more.
The more I learn, the more I realize how much more there is to learn!
The more I see of men, the more I like dogs.
The more I see the more I know. The more I know, the less I undedrtand.
The more I understand women, the more I appreciate my dog.
The more I understand women, the more I like being single.
The more RAM you have, the better, M. Chambers
The more RAM you have, the better. -Marilyn Chambers
The more a cat runs over your car, the more pawprints it gets.
The more a cat runs over your car, the more pawprints you get.
The more a weapon costs, the futher and longer it takes to repair it.
The more absolute death seems, the more authentic life becomes.
The more arguments you win, the fewer friends you'll have.
The more conservatives I hear, the more liberal I get.
The more corrupt the state, the more numerous the laws.
The more corrupt the state, the more numerous the laws. -- Tacitus
The more delicate it is, the harder you have to hit it.
The more detailed the map, the more lost you get
The more feminizts I know, the more I love my dog.
The more free time you try to have, the more work you get.
The more general the title of a course, the less you learn from it.
The more hair I lose, the more head I get <G>
The more hair I lose, the more head I get!
The more hair I lose, the more head I get.
The more impediments to legislation, the better. -- Heinlein
The more impediments to legislation, the better. - RAH
The more impediments to legislation, the better. -- Heinlein
The more joy we have, the more nearly perfect we are. Spinoza
The more known about people, the more to admire in cats
The more known about people, the more to admire in dogs.
The more laws there are, the more crime there is --Chaung Tzu
The more laws, the more offenders.
The more liberals I hear, the more conservative I get.
The more liberals I meet...the more I like my dog.
The more mistakes I make the smarter I get.
The more nice people we know... the more we get sick. :) -Vhujunka
The more of these messages I read, the more I like the taglines.
The more people I meet, the more I like my cat!
The more people I meet, the more I like my dog.
The more people I meet, the more I like my dragon
The more people I meet, the more I love my cats....
The more people I meet; the more I like my cat!
The more seriously I took things, the harder the rules became...
The more seriously one takes an amusement, the more amusing it becomes
The more sure you are, the more wrong you can be.
The more the words, the less the meaning...
The more they are in the fog, the more boats toot their horn.
The more things a man is ashamed of, the more respectable he is. - Shaw
The more things change the more they suck. --Beavis.
The more things change, the more my salary stays the same.
The more things change, the more they stay insane.
The more things change, the more they stay the same.
The more things change, the more they stay the same. -La Rochefoucauld
The more things change, the more they'll never be the sam
The more things change, the more they'll never be the same again.
The more things change, the more you need alterations.
The more things you own, the more you are owned by things.
The more we disagree, the more chance there is that at least one of us is right.
The more we do; the more we can do...
The more we learn, the more we realize we don't know a damned thing.
The more we sweat in peace, the less we bleed in war.
The more you complain, the longer God lets you live.
The more you complain, the longer God makes you live!
The more you drive, the less intelligent you are.
The more you explain it, the less I understand it. - Twain
The more you invest in hardware, the faster you can reboot.
The more you know, the easier some vet's job is.
The more you know, the less you think you know. - Anon
The more you know, the more confusing everything becomes.
The more you know, the more you know you don't know
The more you know.... The luckier you get
The more you love someone the more he wants from you.
The more you love the more you can love. No limits.
The more you love, the more you can love.
The more you over-eat, the tougher it is to get close to the table.
The more you rub it, the bigger it gets!
The more you run over @FN@, the flatter he gets.
The more you run over YOU, the flatter he gets.
The more you run over a cat the flatter it gets
The more you run over a cat, the flatter is gets.
The more you run over a cat, the flatter it gets!
The more you run over a cat, the flatter it gets.
The more you run over a dead cat, the flatter it gets
The more you run over a dead cat, the flatter it gets.
The more you run over a skunk, the stupider you are...
The more you say, the less people remember
The more you say, the less people remember.
The more you sweat in peace, the less you bleed in war.
The more you think, the less you know.
The more you tried to refuse, the more I wanted you! - Lestat
The more you try to change things, the more they stay the same.
The more you understand yourself, the better you appreciate others.
The more, the merrier.
The morning breaks, the shadows flee; Lo, Zion's standard is unfurled!
The mosquito is the state bird of New Jersey. -- Andy Warhol
The mosquitos here are so big they rape the ducks!
The most abundant items 1) Hydrogen 2) Stupidity.
The most affable thugs ever - Crow
The most affectionate creature in the world? A wet & dirty dog
The most affectionate creature is the wet dog.
The most anxious man in a prison is the governor.
The most common bra size in Sun City, AZ: 34 long
The most common element in crime is CRIMINALS. Not guns.
The most common show of an incompetency is the need to controll everyt
The most cooperative man in this world is a dead man.
The most cooperative man in this world is a dead man. - Bela Oxmyx
The most dangerous animal in all history walks on two legs.
The most dangerous food is wedding cake.
The most dangerous four-wh--------------------------------
The most dangerous four-wheeled vehicle: the dessert cart
The most dangerous man is the man that does not appear dangerous.
The most dangerous part about playing cymbals is near the nose.
The most dangerous part of a car is @N@ at the steering wheel.
The most dangerous part of a car is HIS at the steering wheel.
The most dangerous part of a car is Orville at the steering wheel.
The most dangerous thing in a combat zone is an officer with a map.
The most dangerous thing in the combat zone is an officer with a map.
The most dangerous thing is a new Lt. with a map and a compass.
The most dangerous weapons in homes? The TV sets!
The most dangerous woman in the world - Tonya Rodham, Bobbit...of Borg.
The most decent thing a politician can do? SHUT.UP
The most delicate component will drop.
The most delicate part will be the one dropped.
The most dense thing next to a black hole--a Bagel
The most dependable hand is the one at the end of your wrist
The most depressing event of my entire life - Mike
The most difficult thing about Time, I have learned, is doing it.
The most difficult thing to open is a closed mind!
The most difficult years are between ages 10 and 70!
The most elusive knowledge of all is self-knowledge.
The most enjoyable form of sex education is the Braille method.
The most exciting place to discover talent is within yourself.
The most exhausting thing in my life is being insincere.<Lindbergh>
The most expensive component always breaks first.
The most expensive component is the one that breaks.
The most feared geography teacher of Central High - Crow
The most frightening horror tales are those told by bathroom scales.
The most fun you can have with your clothes on.
The most fundamental particles in this product are held by "gluing".
The most harmful error has not yet been discovered in you
The most humiliating thing I've ever done - Tom
The most important information is on the fold.
The most incomprehensible thing about the world is that i
The most insidious and dangerous form of sexism comes from women.
The most insidious computer virus is named Gates.
The most insidious threat to Traditional Values: education.
The most intelligent people we know are those who ask advice.
The most know the least.
The most labor-saving device today is still a husband with money.
The most marvelous fugue was the one between the Hatfields and McCoys.
The most perfect day to do *ANY* job is tomorrow!!
The most popular form of birth control: The Headache
The most popular labor-saving device is still money.
The most popular sport at Antioch College: "20 Questions"
The most toys {on credit} at the end wins
The most unAmerican thing you can say is "He/she makes too much money."
The most unnatural of the perversions is chastity.
The most useless computer tasks are the most fun to do
The most valuable gift you can give someone is a good example
The most valuable gift you can give your family is a good example.
The most you can say is stimulating? ...It was very stimulating.
The mother of all idiots is always pregnant.
The mother of all recipes.
The mother of all taglines.
The mother of idiots is always pregnant.
The motor will rotate in the wrong direction.
The mouse dreams dreams that would terrify the cat.
The mouse dreams that would terrify the cat.
The mouse dreams, dreams that would terrify the cat.
The mouse has dreams that would terrify the cat.
The mouse is mightier than the sword.
The mouse with a single hole is quickly caught by the cat
The mouth of the righteous is a well of life.
The mouth of the wicked devoureth iniquity. - Proverb 19:28
The moving cat sheds, and having shed, moves on
The moving cat sheds, and having shed, moves on...
The moving cursor prints, and having printed, blinks on.
The moving cursor writes, and having written, blinks on,off & on,off..
The moving cursor writes, and having written, blinks on.
The mummy's a lame styrofoam headed alien! - Joel
The music is excellent. My compliments to the Clef.
The music is your only friend until the end. -Morrison
The music of the Dance goes on forever.
The music really matches the action - Mike on dull music
The music rocks me down the motor way.
The music that rocked America. To sleep! - Tom
The music there: it was hauntingly familiar.
The music's kinda nice. My compliments to the clef.
The music's kinda nice. My compliments to the clef
The music's terrible, but at least it's drowning out the dialogue.
The naked and the deadly duck.
The naked truth of it is, I have no shirt.
The nakedness of woman is the work of god.
The name has been spelled many various ways!!!!!
The name is Bond -- James Bond
The name is Borg, James Borg. Vodka martini, dry. Gin is irrelevant.
The name is Borg, James Borg. Vodka martini, dry. Gin is irrelevant
The name is Borg. James Borg.
The name of the place is BABYLON 5
The name of the place is Babylon 4. <BOOM!!> Five! Five!
The name of the place..............DS9!
The name of the place...is Terok Nor!
The name will be: PENTIUM, The price will be: PLENTIUM.
The name will be: PENTIUM, The price will be:ZvVTIUM.
The name will be: Pentium. The price will be: Plentium.
The narrower the mind, the broader the statement.
The nation is no better than its charlatans.
The national shrub of Congress is the hedge.
The nature of the communication is the attached response!
The nearer the Church the further from Deity.
The necessity of government is weighed between costs and benefits.
The need for government depends upon the pull of order and anarchy.
The needs of my computer out-weigh the needs of my bills!
The needs of the many outweight the needs of the one.
The neighbor's kid is learning metric...he owns a 9mm.
The neon lights are bright on Winnipeg - Tom sings
The net of the sleeper catches fish.
The new "Noddy" movie will star Quark as 'Big Ears" & Odo as 'Mr Plod'
The new 1st couple: Hill and Billy, from Arkansas.
The new Air Force Kooky Bomb by Whammo - Tom
The new Chrysler Presidential Limo: The Dodge Drafter.
The new Clinton Watch: $5.95, plus $44.75 sales tax
The new Clinton Watch? Only $5.95. $54.95 with tax.
The new Congressmen say they're going to turn the government around.
The new Doctor Who will be played by Warren Kreick.
The new P5 from Intel... since we already P'd on the first 4
The new Pagan Barbie: Wand, sword, & pentacle sold seperately.
The new Star Search category - Tom Servo on girl wrestlers
The new Star Search category - Tom on girl wrestlers
The new Vietnam: Somalia? Bosnia? Rwanda? No, the War on Drugs.
The new Windows 95 theme: "I Can't Get No Satisfaction"
The new american way: dodge draft, smoke dope, cheat on wife.
The new baby is like royalty, he's the prince of wails.
The new non-violent Star Trek- "Set phasers on tickle!"
The new nuclear family: woman, government, and child.
The new right is fundamentally wrong.
The new thing is to care passionately and be right wing.
The new, non-violent Star Trek: "Set phasers on tickle."
The new,inexperienced new kid on the block
The newest books are those that never grow old.
The newest newsgroup on UseNET! alt.sex.aluminum.baseball-bats (j/k!)
The news may be bad, but it soon becomes old and is easily forgotten.
The next best thing to being witty is to quote another's wit.
The next generation of computers will have a "Warranty Expired" interrupt.
The next meeting of the time travel club is two weeks ago.
The next recipe is recommended for mature readers only.
The next sentence is true. The previous sentence was false.
The next sentence is true. The last sentence was false.
The next six days are dangerous.
The next tagline is recommended for mature readers only.
The next tagline ought to be censored!
The next thing I know,there's a hissing ball of fur coming at my face
The next thing they'll legislate will be reading helmets !
The next thing you know, BAM! THEY'RE bouncing up and down on the bed.
The next thrilling chapter in the amazing saga of Robotech!
The next time I run into you, I hope I'm in my car. - Janier
The next time I run into you...I hope I'm in my car!
The next time I see you will be the last. - Duncan MacLeod
The next time I send a dope, I'll go myself.
The next time people call you lazy, tell them you were sick a year.
The next time there's a next time there won't *be* a next time. -SLR
The next time you wash your neck, be sure to wring it!
The nice men in the clean white coats are coming to take me away.
The nice thing about a kitten is that it becomes a cat.
The nice thing about wearing a smile is that one size fits everybody.
The nicer I am the more they think I'm lying.
The nicer an airplane looks, the better it flies.
The nicest sound a cat can make: *Vrooom!* *bump!* *bump!* *vrooom!*
The nicest sound a cat makes: Bump Bump.
The nicest sound a cat makes: Vroommm bump bump vrooomm
The nicest sound a cat makes: Vroommm bump bump vrooomm.
The nicest thing about growing older is that it takes such a long time
The nicest winter I have ever seen was last summer.
The night fell, and the music of the lutes was stilled.
The night has its price. <Mae>
The night is a tunnel, a hole into tomorrow. - Jessica <Dune
The night is bleeding like a cut --U2
The night is my companion, and solitude my guide. -Sarah McLachlan
The night is young.. and we have umbrellas in our drinks! - The Tick
The nightlife is the right life for me.
The nightly news is more violent than anything I've seen in the movies
The nipples! - Crow blurts out
The no-good-niks rule this school! - Principal Skinner
The no-mind not-thinks no-thoughts about no-things.
The no. 1 way to be killed: Put a tribble up a Klingon's @$$!
The no. 1 way to have fun: Put a tribble up a Klingon's nose.
The nob on the end is to stop your hand falling off
The nob on the end is to stop your hand from falling off.
The noiseless foot of time steals swiftly by. -Juvenal
The non attendees today bother me, said the professor absent-mindedly.
The non-violent Star Trek: Set phasers on tickle.
The nonsensical ravings of a lunatic mind.
The number of UNIX installations has grown to 10, with more expected. (6/72)
The number of licorice gumballs you get out of a gumball
The number of malefactors authorizes not the crime. - Thomas Fuller
The number on the matchbook is old and faded.......
The number one computer bug is mankind!
The number one enemy of progress is questions!
The number watching you is proportional to the stupidity of your action.
The number you call from has been disconnected.
The number you have dialed is imaginary. Please divide by 0 and try again.
The number you have dialed: 9-1-1, has been changed, the..
The number you have reached -911- has been disconnected.
The number you have reached is not in service !
The number you have reached, 911, has been disconnected
The number you have reached--911--is not in service.
The number? Just dial randomly..You'll get us eventually.
The object is to win the game.
The object of oratory is not truth but persuasion. -Thomas Macaulay
The object of power is power.
The object of war is to allow them die for their country.
The obscure we see eventually; the completely apparant takes longer.
The observation lounge has been turned into a swamp - Riker
The obvious is often overshadowed by the less obvious.-Ed Parker
The occipital area of my head seems to have impacted...
The ocean is the ultimate solution.
The ocean would be much deeper... if it didn't have all those sponges...
The odds are against you, O'Brien -- Quark
The odds are, this is NOT the person you are looking for.
The officers busted a picture over a man's head. He was framed.
The official BBS of Nothing.
The official Canadian DOS prompt..........EH:\<
The official Canadian DOS prompt.EH:\>
The official EchoMornFanClub Morn Smiley: { :=)
The offspring of a Tribble and Ross Perot: @*@ <--{ROFL!!}
The offspring of a tribble and Ross Perot: #*@
The oil oozes out, into the veins and out of the mouth
The oil tanker crashed, mom. - Calvin
The old Clayton Forrester wasn't like this - TV's Frank
The old believe everything
The old guy couldn't seperate sex & death - Crow
The old know more about being young than the young know about being old.
The old make the rules, the young make the exceptions.
The old make the rules, the young make up the exceptions.
The old south had character...... acually it had LOTS of characters!
The olddays:Wine, Women & Song; Nowadays: Cola, Computers, CD's.
The older I get the better I used to be.
The older I get, it seems the better I used to be.
The older I get, the better I used to be. - Bard
The older I get, the better I was.
The older a man gets, the farther he had to walk to school as a boy.
The older a man gets, the further he had to walk to school as a kid.
The older generation are leading this country to galloping ruin.
The older the cat, the longer the claws!
The older the whine, the more sour the grapes.
The older you are, the more fun a snowball fight can be.
The older you get the greater you were!
The older you get the harder your parents try to keep you little.
The older you get, the harder it is to find replacement parts.
The older you get, the less stupid your parents become.
The oldest and strongest emotion of mankind is fear.
The oldest hath borne most.
The oldest one in the book -- Make like a tree and leave.
The one day you have the exact fare is the day it goes up.
The one day you'd sell you soul for something, souls are a glut.
The one day you'd sell your soul for something, souls are a glut.
The one good thing about pain: it proves you're alive.
The one good thing about repeating your mistakes is that you know when to cringe
The one item you need is allways in short supply.
The one item you need is always in short supply.
The one minute pornographer - Tom
The one on the right must be Shinola, Clinton's on the "left."
The one thing you can never be sure of is uncertainty.
The one way sure to conciliate a tiger to allow oneself to be devoured
The one who dies with the most TOYS wins!
The one who dies with the most taglines is dead, Jim.
The one who dies with the most taglines wins!
The one who dies with the most toys is dead.
The one who dies with the most toys is still DEAD!
The one who dies with the most toys wins.
The one who does the least work gets the most credit.
The one who says it can't be done should never interrupt the one doing it.
The one with the Eddie Munster page boy look? - Tom
The one with the cancer stick? We call him STANKY.
The one with the eel-skin skull cap? No way, ugh! - Crow
The one with the most names when they die wins!
The one with the most typefaces when he dies, WINS!
The one, the only, the inimitable...(ta da)...COYOTE!
The only "Barney" I want MY kids playing with is Rubble.
The only "good rap" I know of comes on a birthday gift.
The only *Good* cat is a *Stir-Fried* Cat!
The only *anything* you get is what I give you! - LaCroix
The only 3 honest lawyers include 2 fictional and 1 dead one.
The only ANYTHING you get is what I give you - LaCroix
The only BBS with its number scrawled on bathroom walls.
The only GOOD Club in my bag is Canadian Club.....
The only GOOD Topic Cop is a DEAD one!
The only GOOD nakalene, is a DEAD nakalene! - Londo
The only GOOD topic WHIMP is a whining one!
The only O.J. I want to hear about is Florida orange juice.
The only TRULY consistent people are DEAD!
The only _complete_ woman is a Redhead!
The only abnormality is the incapacity to love. -A. Nin
The only acceptable intelligence substitute is silence.
The only acceptable substitute for intelligence is silence.
The only advantage of old age is that you can sing while you brush your teeth.
The only argument with the wind is to put on a coat.
The only bar that I'm a member of is Panama Hattie's ...
The only boardgame I play is PCboard !!
The only brain-dead 286 chips are made by Intel...
The only bugs I have in my PC are sucked in by the cooling-fan...
The only certainty is that nothing is certain.
The only chance I get to talk is while my wife inhales.
The only change involved with Clinton is at McDonald's.
The only charm you have is a rabbit's foot.
The only complete bug-fix: DEL C:\TRADEWAR\*.*
The only completely consistent people are the dead. -- Huxley
The only completely uncensored thinking I do is dreaming.
The only consolation is that they're all dead now. --Crow.
The only constant is change.
The only culture some people have is at the back of the refrigerator.
The only cure for good sex is more sex.
The only cure for sex is.... more sex!
The only difference between a rut and a grave is the depth.
The only difference between a rut and a grave is their di
The only difference between a rut and a grave is their dimensions.
The only difference between her and it is the lipstick.
The only difference between me and a madman is that I am not mad. -- Dali
The only difference between you and a bucket of shit is the bucket.
The only difference between your tag and mine is: I THOUGHT IT UP FIRST!
The only diplomat I trust is a fully armed phaser bank.
The only disadvantage of an honest heart is credulity.
The only distance between lovers is time.
The only drawback of total nuclear war is $#@#%^NO CARRIER
The only dual standard I embrace comes from US Robotics.
The only dumb question is one you haven't asked yet.
The only dumb question is the one that is not asked.
The only ethical lawyer is a dead lawyer.
The only evidence that the Devil is real= Jesse Helms & Newt Gringrich.
The only excuse for God is that he doesn't exist.
The only exercise I get is pushing my luck.
The only fair tax is a Flat Tax.
The only gift I have is fear - Course of Empire
The only good Barney is a dead Barney.
The only good Democrat, is an unemployed democrat!!
The only good Indian I ever saw was dead. --W. T. Sherman.
The only good Limbaugh is a DEAD Limbaugh!
The only good Mac is a Big Mac!
The only good Mac is a big Mac!
The only good NAFTA supporter is a DEAD NAFTA supporter.
The only good Tagline is a stolen Tagline!
The only good Tribble is one served with onions.
The only good Tribble is visiting Klingons.
The only good Wesley is a dead Wesley...
The only good bunny is a dead bunny.
The only good caps locks key is a broken caps locks key!
The only good cat is a dead cat.
The only good cat is one imbedded in my tire tread.
The only good cat is stir fried - ALF
The only good cat is stir fried.
The only good criminal is a dead criminal.
The only good feminizt is terminally inconvenienced.
The only good fnord is a dead fnord. --Ignotius.
The only good fossil is a deal fossil.
The only good gargoyle is one decorating the top of a church.
The only good hobbit is a dead hobbit. Especially served with rice.
The only good hockey players are the ones with no teeth!
The only good is knowledge and the only evil is ignorance.<Socrates>
The only good lawyer is a dead naw, not even then.
The only good lawyer is a - naw, not even then.
The only good lawyer is a dead one.
The only good lawyer is a deceased lawyer.
The only good leech is a Dead LEEEEEEEECH!
The only good leech is a dead leeeeeeeeeech!
The only good nakaleen feeder is a dead nakaleen feeder - Londo
The only good politician is a DEAD politician.
The only good tagline is a dead one.
The only good thing about growing older - it beats the alternative
The only good thing about growing older - it beats the alternative
The only good tribble is served with onions.
The only good troll is a fireballed troll!
The only grounds for divorce in California are marriage.
The only guts liberals have is tripe.
The only heavy breathing @FN@ ever hears is after aerobics.
The only heavy breathing I ever hear is after aerobics.
The only heavy breathing YOU ever hears is after aerobics.
The only honest lawyer is a deceased lawyer.
The only idiots I know use computers!
The only imperfect thing in nature is the human race.
The only intelligent Catholics have become Protestants!
The only kind of seizures we want from cops are epileptic ones.
The only league where half the players earn less than its reporters.
The only legitimate reason for abortion is SEX SELECTION!
The only man who can change his mind is the man who's got one.
The only minority I oppose is the one that elected Clinton.
The only mistake I made was thinking I made a mistake.
The only notice we get is `Mind that bus-what bus-SPLAT!'
The only one who got everything done by Friday was Robinson Crusoe.
The only one who is wiser than anyone is everyone.
The only ones whose troubles are behind them are school bus drivers.
The only parts that don't hurt, are those that don't work!
The only people I hate are Krauts, Frogs and bigots!
The only people who never fail are those who never try.
The only perfect science is hind-sight.
The only perfect science is hindsight.
The only personal messages =I= get are addressed to Occupant.
The only place I want data loss is on my credit card!
The only place to find a GOOD lawyer is under a tombstone!
The only point you made was the one on your head.
The only positive thing about pain: It proves you're alive.
The only power worth having is power taken by force. -- The Get
The only problem with women is men. - Kathie Sarachild.
The only race worth winning is the human race.
The only real equality is in the cemetery.
The only real winner of the War of 1812 was Tchaikovsky.
The only realities are the atoms and empty space.
The only really decent thing to do behind a person's back is pat it.
The only reason for time is so that everything doesn't happen at once!
The only reason people get lost in thought is because it's unfamiliar territory.
The only reason you won't die is because I took an oath to do no harm.
The only red menace in America is the sunburn.
The only religion Christians want to give freedoms is Christianity.
The only respected lawyers include two fictional and a dead one.
The only road to success is always under construction.
The only rose without thorns is friendship.
The only roses without thorns are love and friendship.
The only second chance I have is the one I gave myself.- Nick Knight
The only self-cleaning thing around here is the cat!
The only sound is water drops. I wonder where the hell I am.
The only student to change history started World War I.
The only stupid question is the one not asked!
The only stupid question is the one you don't ask. |-)
The only substitute for good manners is *faster* reflexes. ;^)
The only sure thing about luck is that it will change - Bret Harte
The only thing God didn't do to Job was give him a computer. I.F. Ston
The only thing I agree on with Rush Limbaugh is Snapple!
The only thing I am sure of is I don't need you. - Henry to Frank
The only thing I don't like about taglines is that I never have enough room to
The only thing I enjoy is tormenting you. -- Odo (to Quark)
The only thing I gave up at Lent were my New Year's resolutions.
The only thing I like about fools is that I'm not one of them.
The only thing I passed in college was gas.
The only thing a Beer tells you is when it's time to go to the bathroom.
The only thing a Beer tells you is when it's time to go.
The only thing as bad as a black racist is a female sexist.
The only thing as good as your Crispy Crunch... is an O'Henry.
The only thing better than a cat--is TWO cats!
The only thing digestible about a donut is the hole.
The only thing ever lost by politeness is a seat on a crowded bus.
The only thing faster than the computer is the weekend.
The only thing funnier than how things don't work out, is
The only thing funnier than how things don't work out, is how they do.
The only thing gassed up in that jeep was *us*. - BJ to Hawkeye
The only thing have to burp is beer itself.
The only thing higher than God in a user's world, The Almighty SysOp.
The only thing just as good the second time is chocolate.
The only thing keeping us out of an Ice Age is the Global Warming.
The only thing left to tax is the wolf at the door.
The only thing more accurate than incoming enemy fire is friendly.
The only thing more complicated than computers is TAXES.
The only thing more crooked than politics is insurance.
The only thing more reliable than magic is one's friends.
The only thing more reliable than magik is one's friends! MACBETH
The only thing necessary for the triumph of evil is for good men to do nothing.
The only thing shorter than a weekend is a vacation.
The only thing shorter than a weekend is a vacation. 08 May 95 ...
The only thing some people do is grow older.
The only thing stupider then a bird is the buyer.
The only thing that didn't happen to Job was Windows.
The only thing that has been filled is the palm of your hand
The only thing that is faithful is a beer... --Cliff and Norm.
The only thing that is faithful is a beer....
The only thing that ought to be virgin are forests.
The only thing that would shock her is a cattle prod.
The only thing the BORG left was this Macintosh
The only thing the Borg left was Barney & the Clintons
The only thing the Borg left was Barney!
The only thing the Borg left was Barney.
The only thing the Borg left was Bob
The only thing the Borg left was this Macintosh - Commander Shelby
The only thing the Borg left was this Macintosh!
The only thing the Borg left was this copy of Windows.
The only thing the Borg left were liberal Democrats.
The only thing the Borg left were these copies of Windows
The only thing the Democrats have to offer is Fear it's self.
The only thing the Democrats have to offer is Fear itself - Dick Armey
The only thing to know is how to use your Amoeba.
The only thing we don't have to LEARN is *sex*!
The only thing we have to fear is no more beer
The only thing we have to fear is no more beer.
The only thing we have to fear, is an invasion by the Visitors!
The only thing we learn from history is that we do not learn.
The only thing we've got plenty of is wounded. - Radar
The only thing weirder than fantasy is reality.
The only thing weirder than me is reality.
The only thing worse than a dumb bigot is a smart bigot.
The only thing worse than a sorcerer is his apprentice.
The only thing worse than raining cats and dogs is hailing taxis.
The only thing you can get in a hurry is trouble.
The only time I get a chance to speak is when Rasta inhales.
The only time I open my mouth is to change feet!
The only time I refused a drink, I didn't understand the question.
The only time having a good memory counts is when you've told a lie.
The only time it is OK to beat your kids is at checkers.
The only time you start at the top is to dig a hole.
The only time you're pronounced something is "man and wife" and "dead".
The only tool diplomacy has is language.
The only true answer to the internet is long distance.
The only true devils on this earth are the ones quoting scriptures.
The only truth in war is that people die. -- Sinclair, Babylon 5
The only tyrant I accept...is the still voice within. Mahatma Ghandi
The only uncomplicated screw has a phillips head
The only unusual thing about my childhood was that it lasted 49 years.
The only urine test you'll get from me is a taste test.
The only valuable thing to pass through a politican's mind is a Bullet
The only victory over love is flight. Napoleon
The only way that you can please God is through faith. Rom. 14
The only way to Rush Limbaugh is to shoot at him!
The only way to amuse some people is to slip and fall on
The only way to amuse some people is to slip and fall on icy pavement.
The only way to catch a train is to miss the one before it.
The only way to combat criminals is by not voting for them.
The only way to get rid of a temptation is to yield to it
The only way to get rid of a temptation is to yield to it. - Wilde
The only way to get rid of temptation is to yield to it.
The only way to get rid of temptation, yeild to it!
The only way to have a friend is to be one.
The only way to judge the future is by knowing the past.
The only way to predict the future is to create it.
The only way to stop smoking is to just stop - no if's, and's or butts
The only way women could have equal rights would be to surrender some.
The only winner in the War of 1812 was Tchaikowsky.
The only winner of the War of 1812 was Tchaikovsky
The only winner of the War of 1812 was Tchaikovsky.
The only wormhole I've seen went through an apple.
The only worthwhile feminist movement involves negligee.
The only worthwhile feminist movement should involve negligee.
The open hand of desire wants everything.
The opera ain't over till the Last Heterosexual is asleep
The operation is working perfectly. - Steven, V
The operative word, Mr. Spock, is death--Harcourt Fenton Mudd.
The opiate of the masses.
The opinion I express is mine alone, (sometimes) ?
The opinions above belongs to me, only me, me, me, me, me, MEEEE !
The opinions expressed above are not necessarily mine.
The opinions expressed are not necessarily those of the management.
The opinions expressed here are neither mine nor anyone elses
The opinions expressed here are not necessarily shared by my wife.
The opinions expressed in this message belong to nobody.
The opinions here are strictly my own (or those of my machine)
The opposite of Pro-life is Pro-death...!
The opposite of RIGHT is not only LEFT, it's also WRONG
The opposite of present is (a)past (b)future (c)absent
The opposite of pro-life is anti-choice
The oppulently appointed San Francisco airport - Crow
The optimum committee has no members. -- Norman Augustine
The option to override automatic detonation expires in T - 5 minutes.
The option to override destruct procedure has expired!
The option to override self-destruct expir@^%i@&$#NO CARRIER
The oral sex, the oral sex!!! Well, I could stay a *bit* longer- MP
The oral sex, the oral sex!!! Well, I could stay a *bit* longer...
The orator, with a flood of words a his drop of reason.
The organization and definition of knowledge is critical.
The origin of war was not men, it was survival.
The original Mickey Mouse cartoon was in Mouse, with English subtitles
The original multitasker: 2 PCs and a chair with wheels
The ornamental butterfly expands his wings to flutter by.
The other day I No, waitaminit, that wasn't me - s.w.
The other day I saw a show about mounting cats - on the wall.
The other day I was -- No wait! That wasn't me...
The other day I was--No wait! That wasn't me...
The other day I was... No wait! That wasn't me...
The other day I was... No wait! That wasn't me...
The other day I was......No wait...that wasn't me...
The other day I went to the stationery store, but it had moved.
The other day I... No, waitaminit, that wasn't me... - S.W.
The other end of the Galaxy? What could it mean? A circle has no end?
The other guy's tagline is always funnier.
The other line always moves faster.
The other line moves faster.
The other members of the flying circus: Mothra and Rodan.
The other person has another point of view. Read carefully.
The other planets are laughing at us.
The out-patients are out in force tonight!
The owls are not what they seem.
The owner of a dating service might drive an Escort.
The owner of a now defunct department store might drive a Corvette.
The owner today will be partly dippy with a chance of stupid.
The oxen are slow, but the Earth is patient.
The oxen are slow, but the earth is patient.
The pH of this solution is just 3.5, said Tom acidly.
The pH of this solution is just 3.5, said Tom half-assed-ly.
The pain in Spain falls mainly with the cane!
The pain in brain stays mainly insane!
The palaces now stand where the coffins all were laid.
The palaces of kings are built on the ruins of Paradise. -- Paine
The pale deaths that men miscall their lives.
The palest ink is better than the best memory. - Anon
The palest ink is better than the sharpest memory.
The palindrome of 'tagline' would be 'enilgat'!
The pall bearers are gone... NO CARRIERS
The pancake house was robbed. How waffle.
The pancake house was robbed. How waffle.
The pants were very sad, they were depressed.
The pants, bring him to the pants." "Liar, Liar! Pants on Fire!"
The paper boy wants money, said Tom collectively.
The paper is always strongest at the perforations.
The paperwork's a pain in the butt - Garibaldi
The paranoids are conspiring against me
The park service has declared the man they shot a suicide
The park service was trained by the Rodney King Task Force
The parrot isn't dead, Jim! It was just resting!
The parrot isn't dead, Jim! It's just resting!
The part with my pet! - Dot
The particle adhesive "gluing" power cannot be permanently guaranteed.
The parts of the brain, performed by.. The Brain! - Pinky
The passage says "He who reads these words of wit- " -Tom
The passion of youth. - Methos
The past always looks better than it was when it was here
The past does not repeat itself, but it rhymes.
The past hour & a half was just ending - Tom on movie
The past is a foreign country, they do things differently there.
The past is a springboard, not a hammock.
The past is fixed; the future may be bent. The present's already bent.
The past is just Prolog.
The past is not what it will be.
The past is the only dead thing that smells sweet.
The past is what you use to distort the present.
The past should be a mental springboard - not a hammock.
The past should be a springboard, not a hammock.
The path of least resistance makes men and rivers crooked.
The path of my life is strewn with cow pats from the devil's own SATANIC
The path to hell is paved with governm't subsidies
The path to hell is paved with government subsidies.
The path to hell is paved with government subsidies..
The patient's taken a turn for the nurse.
The peach assailant should be attacked with a crocodile.
The pen is mightier than sword.
The pen is mightier than the pencil.
The pen is mightier than the sword, but swords are more fun!
The pen is mightier than the sword, until it runs out of ink.
The pen is the interpreter of the heart.
The pen is the tongue of the mind.
The pen may be mightier, but the sword is more fun!
The penalty for bigamy is 2 mother-in-laws.
The penalty for bigamy is 2 mothers-in-law.
The penalty for bigamy is TWO mothers-in-law.
The penalty for bigamy is having two mothers-in-law.
The penalty for bigamy is having two mothers-in-law..
The penalty for bigamy is two mothers-in-law
The penalty for not keeping in touch is having less to feel.
The penalty for stealing taglines is that you have to steal more tagli
The pendulum has gone full circle.
The penguin is mightier than the swordfish.
The penguin on top of your TV will now explode.
The penis mightier than the sword!
The penis mightier than the sword.
The pentagon would pay $600 for part # ||X||||X||X||X||
The people all know, Everyone's doin'that rag
The people of Instanbul reject you - Mike on K.Ireland
The people responsible for this tagline have been sacked.
The people rule.
The people will sleep throught the screaming again - Course of Empire
The perception of truth is the detection of analogy.
The perfect 3-some: Blue Wave, OMX and Qedit! :-)
The perfect dog: Hotdog. Garfield
The perfect gift: The Bill Clinton Bath Towel Set - His and Next.
The perfect guest is one who makes his host feel at home.
The perfect job for a deaf person: The complaint department.
The perfect lover turns into a pizza at 4:00 A.M.
The perfect morning: Coffee, echomail, and cold pizza.
The perfect morning: Coffee, echomail, and doughnuts.
The perfect odd couple: A deaf man and a blind woman.
The perfect woman: A nymphomaniac who owns a liquor store.
The performance was equal to the music, said Tom noteworthily.
The period ain't over until the Zamboni comes out.
The persistent single-minded fixation on one idea.
The person that posted the message has been sacked. - Monty Python
The person who brought you the beer milkshake.
The person who dies with the largest hard drive, still dies.
The person who invented the eraser pretty well sized up humanity.
The person who is all wrapped up in himself is overdresse
The person who knows everything has a lot to learn.
The person who knows what is going on must be fired.
The person who rocks the boat is never the one at the oars.
The person who said talk is cheap never hired a lawyer.
The person who snores loudest will fall asleep first.
The person with the least experience has the most opinions.
The person you rejected yesterday could make you happy, if you say yes
The person you rejected yesterday could make you happy, if you say yes.
The persons responsible for the tagline problems have been sacked.
The pets eat better than I do!
The philosophy of one century is the common sense of the next. - Beecher
The phone cops are after us, man! - Johnny Fever
The phone is baroque, please call bach later.
The phone never rings when you have nothing to do.
The phone's tapped anyway.
The phonebooks are here, the phonebooks are here.
The phosphorescent wave on a tropical sea is a cold fire
The phrase "honor one's promises" is not in the Clinton lexicon.
The physically fit can enjoy their vices. - Lloyd Percival
The picture I have doesn't really include her face- TEC
The picture I have doesn't really include her face...
The picture of health requires a happy frame of mind.
The piercing scream of a freshman - Mike
The pigs have won tonight - NIN
The pilot is always the 1st at an aircraft accident.
The pilot is always the first person at the scene of a crash.
The pilot light is always on under my disease.
The pilot was insane...he thought Bill would be in *His* bedroom.
The pilot's union is TOUGH - Mike
The piper's calling you to join him... --Led Zep
The place has all the atmosphere of a ground round - Mike
The place where YOU can make a difference. Sort of. Maybe. Nahh...
The planet killer eats your ship. You're all dead; go home.
The planetkiller eats your ship. You're all dead; go home.
The plant in the math teacher's room? It grew square roots.
The plastic butt - TV's Frank on odd junk drawer item
The plastic surgery failed, Tom's doctor said defacingly.
The plastic surgery failed, the doctor said defacingly.
The platapus was created right after marijuana.
The platypus was created right after marijuana.
The play's the thing wherein I'll catch the conscience of the king.
The please you get from life is equal to the attitude you pit into it.
The pleasure's been all yours, I'm sure. -- Slappy Squirrel
The plot is furthered by a good parking space. - Crow T. Robot
The plot will self destruct in Five Minutes - Tom
The plumage don't enter into it. It's stone dead.
The plumage don't enter into it. It's stone dead!
The plural of half is whole.
The plural of louse is........lice.
The plural of mouse is........mice.
The plural of spouse is spice.
The pocket-sized Machine That Goes Ping - Tom
The poet and the painter, casting shadows on the water...
The poetry of earth is ceasing never..Keats
The poetry of earth is never dead.
The poignant laundry shot - Mike
The point is I am now a perfectly safe penguin! - Ford Prefect
The point of departure is not to return.
The point of view of Helen Keller -Crow on total darkness
The point, sirs, is BREASTS! - Crow on Mr. B/Natural
The poison of love so pure, it's decieving
The poison of love so pure, it's decieving. - Qyr
The police are fully able to meet and compete with all criminals.
The police immediately STROLL to the scene - Tom
The police towed away the car, so I bought another one.
The police, pfff... They couldn't even catch a Cold. - Bart Simpson
The police. They couldn't catch a cold. --Bart Simpson.
The polish gets you high - Tom as guy shines shoes
The political jokes we all laughed at have now been elected.
The political jokes you laughed at 2 months ago just got elected!
The politician's promises of yesterday are the taxes of today.
The polls show 8 out of 5 schizophrenics agree!
The polls show that 10 out of 5 schizophrenics agree...
The ponies! A crack! THIEVES! - Bilbo Baggins
The poodle bites, the poodle chews it
The poor cat in the rain look. It never fails.
The poor cat in the rain look. It never fails.
The poor cat, it's gotten dumber as it's evolved.
The poor little guy is just scared - Mike on dragon
The poor man. He's completely unspoiled by failure.
The pope stops by for a snap inspection - Mike
The pope-mobile: proof prayer doesn't work.
The population explosion started with a bang.
The population is growing.
The porcelain God's name is Ralph.
The porcelain god's name, is 'Ralph.'
The pork bellies are up - Mike on chart in airport
The porn industry seems laid back & inviting - Crow
The positronic matrix I created for her was unstable. - Data
The poster is not necessarily in agreement with the above statements.
The postman always rings twice....%$#@& - NO MAIL CARRIER
The pot at the end of the rainbow is NOT Acapulco Gold.
The pot calling the kettle `cookware of colour'...
The pounding never disappears, the pnly gift I have is fear
The power of accurate observation is called cynicism by ppl who don't have it.
The power of imagination makes us infinite.
The power of love is a curious thing... (Huey Lewis & The News)
The power of love is only as mighty as the heart.
The power of the Macintosh - same day service, guaranteed.
The power of the PS/2 - same day service, guaranteed.
The power to Tax, once conceded, has NO limits. - Robert A. Heinlein
The power to Tax, once conceded, has NO limits. - RAH
The power to Tax, once conceded, has NO limits. -- Heinlein
The power to tax is the power to destroy.
The prairies are vast plains covered by treeless forests.
The prayer was Why Me; The Lord answered Why Not?
The prayer, "Why me?" The Lord answers, "Why not?"
The preacher talks as on a phone where the line is dead.
The preceding discussion by Bob has been OFF TOPIC
The preceding discussion by Kevin has been OFF TOPIC
The preceding discussion by Ricky has been OFF TOPIC..
The preceding discussion by him has been OFF TOPIC
The preceding has been brought to you from "Lurkers R Us"
The preceding message arrived the day *following* the NetMailed
The preceding message has been nuked for your convenience.
The preceding was written tongue in cheek, for the humor impaired!
The preceeding was my personal yet absolutely correct opinion.
The present is great with the future. - Gottfried Leibnitz
The presidents head is full with beautiful glorious golden caramelcorn
The previous tenant didn't flush - Tom
The price for these lemons is ridiculous! Tom said sourly.
The price for these lemons is ridiculous! she said sourly.
The price of Freedom is eternal vigilance!
The price of being an Amberite is that you cannot even trust yourself.
The price of greatness is responsibility.
The price of hating others is loving oneself less. Cleaver
The price of justice is freedom. -- Judge Dredd
The price of liberty is eternal vigilance
The price of liberty is eternal vigilance...
The price of purity is purists.
The price of success is hard work and dedication to the job at hand.
The price of your hat is not the measure of your brains.
The priceless finds its price in the greed of man.
The prices are unreasonably high, for such plain ornaments.
The primary cause of maleness is damage to one of the X chromosomes.
The primary function of dogs, as a species, is to throw up on rugs.
The primary particles in this product may decay within 400 million yr.
The prime requisite for immortality is death.
The principal's toupee is not a Frisbee
The principal's toupee is not a Frisbee - Bart Simpson's lines
The principal's toupee is not a Frisbee -Bart Simp./Epis. 9F12
The principal's toupee is not a Frisbee -Bart Simpson/Episode 9F12
The principal's toupee is not a Frisbee. --Bart Simpson.
The principal's toupee is not a frisbee.
The principle export of the U.S. is money.
The principle mark of genius is not perfection, but originality.
The printed word is no guarantee of truth.
The prisoner escaped by climbing down a rope, said Tom condescendingly.
The prisoner goes downstairs, said Tom condescendingly.
The prisoners set up a corporation, the warden confirmed.
The prisoners will not be harmed...until they are found guilty.
The privilege of fools is to laugh at persons of sense!
The probability of success if not almost 1 is usually 0.
The problem can't be mine. I am a sysop.
The problem can't be mine. I am the Sysop.
The problem can't be mine. I am the sysop.
The problem can't be mine. I'm the CoSysOp!
The problem drinker is the one who never buys.
The problem is between the chair and the Keyboard.
The problem is not if machines think, but if people do!
The problem isn't ignorance but the illusion of knowledge
The problem isn't repeating rifles, it's repeat offenders!
The problem isn't repeating rifles, it's repeating offenders
The problem isn't the police; it's the LAWS the politicians write!
The problem isn't the wages of sin; it's the witholding.
The problem with Windows is, they break!
The problem with a compact is that you don't know it when you hit them!
The problem with depending on government is that you can't!
The problem with depending on government: you can't do it
The problem with dying is you never know who cried over your death.
The problem with lawyers is that they grow up to be judges!
The problem with lawyers is that they grow up to be senators.
The problem with live sacrifices is they keep crawling off the altar...
The problem with majority is that you can't outvote it!
The problem with my life is that you're in it.
The problem with new experiences is they're rarely the ones you choose
The problem with people is that they're only human. Hobbes
The problem with political jokes is that they get elected
The problem with political jokes is they get elected.
The problem with porn on TV is you can't forward to the good parts.
The problem with reality is there's no background music.
The problem with reality is, there is no background music!
The problem with taglines is that you always run out of r
The problem with taglines.. is there is never enough spa
The problem with the American Automotive Industry is Congress.
The problem with the future is it turns into the present, then past.
The problem with the future is it turns into the present.
The problem with the gene pool is that there is no lifegu
The problem with the gene pool is that there is no lifeguard.
The problem with the gene pool is there's no life guard
The problem with the gene pool is there's no lifeguard
The problem with the human race is it has very low admission standards
The problem with the rat race is that the rats are winning.
The problem with troubleshooting -- it shoots back.
The problem with troubleshooting is that real trouble shoots back.
The problem with troubleshooting is that trouble shoots back.
The proceeding opinions are not those of the author.
The procrastinators annymous meeting was delayed.
The proctologist called ... Your head has been removed!
The proctologist called ... Your head is ready.
The proctologist called, and your head is ready.
The program comforts the disturbed and disturbs the comfortable.
The program is absolutely right; so the computer must be wrong.
The program is absolutely right; therefore the computer must be wrong.
The program is absolutely right; therefore, the computer must be wrong.
The program with the most unreadable code? "Windows"
The programmer's crisis: "But it worked in Beta testing!"
The programmer's national anthem is 'AAAAAAAAHHHHHHHH'. -Weinberg, p.152
The programmer's national anthem is 'AAAAAAAAHHHHHHHH'. -- Weinberg, p.152
The promotion of hate against a group of people diminishes *everyone*.
The proof is in the posting.
The proof is the phylogeny of plant-animal interactions.
The proof of a moderator's value is her existance
The proof of a moderator's value is his existance
The proof of a moderator's value is the very fact that she exists.
The proof of a system's value is its existence.
The proof of the pudding is in the eating, said Tom nonjudgmentally.
The proof of the pudding's when it comes to the crunch.
The prop master shops at Spencers - Joel on cheesy UFO
The proper way to accelerate an Amiga 500 is at 9.80655 m/s/s...
The prophecy is upon is. -- Amara Windcrusher
The prostitution rests. huh huh Change it! Change it quick!
The prostitution rests. huh huh huh Change it! Change it...quick!
The prototype of all guns was a bow and bullet.
The proud owner of a Pro-43 handheld scanner!
The proud owner of a USRobotics Sportster FaxModem (14.4k/14.4k)!
The proverbial proprietor provides practical proverbs.
The prudish amputee: Goody One Shoe.
The prudish amputee: Goody One Shoe.
The public enemy's the man that goes and acts blind -Anthrax
The public has the right to be told whatever lies it enjoys hearing.
The puck sneaks past a stunned Bullitt!
The puck sneaks past a stunned Orville!
The pucks stops here, and boy does it hurt!
The pure and simple truth is rarely ever pure and simple.
The pure and simple truth is rarely pure and never simple
The pure and simple truth is rarely pure and never simple. -O. Wilde
The pure and the simple truth is rarely pure and never simple.-J Butler
The purification of politics is an iridescent dream.
The purification of politics is an iridescent dream.
The purple cows just left! And they took my sanity!
The purpose of computing is insight, not numbers.
The purpose of computing is insight, not numbers. - Hamming
The purpose of life is a life of purpose.
The purpose of life is life with a purpose...
The purpose of sex is for woman to obtain orgasm and man not to.
The quality goes in before the recipe goes on.
The quality goes in before the tagline goes on.
The quality of life is determined by its activities. Aristotle
The quartermaster has only two sizes, too large and too small.
The quartermaster only has two sizes, too large and too small.
The queen says no to pot-smoking FBI members.
The quest for enlightenment is dangerous to the caterpillar,
The quest for knowledge is the longest one, for it never ends.
The quest for knowledge will not end until I breath my last breath.
The quest for youth, Number One, is so futile. -Picard
The question I'm asked most often is.. Huh?
The question is "What is 6 times 9?" Explains a lot, eh?
The question is NOT "What time is it" but "Is it too LATE?"
The question is do you have the courage to back it up? - G'Kar
The question is: "(2 * B!) OR NOT(2 * B!)"
The question isn't "are you paranoid," but "are you paranoid enough?"
The quick HST modem jumped over the lazy 2400 baud one.
The quick basic fox jumped over the elderly fortran dog.
The quick brown fox jumped over the lazy dog's back 1234567890 times.
The quick brown fox jumped over the lazy dogs.
The quick brown fox jumps over the lazy dog!
The quickest way to a lawyer's heart is with a broadsword.
The quickest way to a man's heart is through his COCK!
The quickest way to a man's heart is through his chest, with an axe.
The quickest way to a man's heart is with a broadsword.
The quickest way to a woman's heart is through her ribcage.
The quickest way to get a doctor is to turn on the TV set
The rabbit choked to death on cereal. I guess Trix *ARE* just for kids.
The rabbit did WHAT??????
The rabid dog says,"Moooooo!"
The race for QUALITY has no finish line.
The race from stupidity is to the driven, not the swift.
The race is not always to the swift but to those who keep on running.
The race is not always to the swift, but to those who keep on running.
The race is over. The rats won!
The radar goes inop just before you crash..
The radio craze will die out in time.
The rain in Spain falls mainly ... down.
The rain it raineth on the just/ -Charles, Baron Bowen
The randiest of the gastropods is the limpet.
The rat race is over - the rats won!
The rat race is over; the rats won.
The ratchet wheel of politics is self-destructive greed.
The raw power of a casual slap! - Tom on fight scene
The reader this message encounters not failing to understand is cursed.
The real character of a man is found out by his amusements.
The real discrimination against women is "free feeding."
The real in us is silent; the acquired is talkative. <Gibran>
The real man is the one that walks away...standing
The real measure of a mans wealth is what he has invested in eternity.
The real money is in starting your own religion. --L. Ron Hubbard
The real penalty for bigamy is having two mothers-in-law!
The real thing doesn't advertise.
The real trauma of Vietnam is the lack of appreciation.
The real trick to carrying on is not getting carried away.
The real winner is the American public - Tom on debate
The real world is NOT user friendly!
The real world is a special case
The real world is a special case -- Richard Feynman
The real world is a special case.
The real world is only a special case
The real world is only an illusion.
The reality check is in the mail.
The reality is: I still have a Nehru jacket in the closet.
The reality of a place is what people remember of it.
The realization hit her only moments before the pavement did.
The really big-time crooks don't break laws; they make them.
The reason cars are better than women is their higher resale value
The reason computer chips are so small is computers don't eat much.
The reason computer chips are so small is that computers don't eat much.
The reason talk is cheap is because supply exceeds demand.
The reason the government thinks you're just a
The reason we're all here is because we're dead-every living one of us.
The reason you have a inferiority complex is because you are inferior.
The rebels are routed sir...they're fleeing into the woods...
The recipe Echo where recipes ARE the message.
The recipe of Tommorrow............Today!
The red blindfold would be lovely, Your Excellency.
The reels are changing. Kiss her! - Crow
The referee penalised the team for unnecessary roughage
The refrigerator light DOES go off. Now let me out of here.
The refrigerator light DOES go out, now get me out!
The refrigerator light DOES go out. NOW LET ME OUT!!
The refrigerator light DOES go out. Now let me out of here!
The refrigerator light DOES go out. Now let me the hell out of here.
The refrigerator light DOES go out. Let me out of here.
The refrigerator light DOES go out. Now let me out of here. I'm cold!
The refrigerator light DOES go out. Now let me out!
The refs are always in the wrong.
The religion of one seems madness unto another.
The religious never ascribe common sense to God...
The religious right isn't.
The rent is cheap, the pay is decent, and I get to make my own hours.
The repairman will never have seen a model quite like yours before.
The replicators on decks 4 thru 9 are producing nothing but cat food.
The report of my death was an exaggeration. -- Twain
The reports of OS/2s death are greatly exaggerated.
The reports of my death are greatly exaggerated.
The reports of my death have been greatly exaggerated.
The reports of my death have been greatly exaggerated. - Twain
The rest is classified. I could tell you but then I'd have to kill you
The rest of this tagline is encryp*&l#1E0+=|>fcd}85^7@jowxz*7"[=-
The restaurants in hell only serve tofu.
The result of shielding men from folly is to fill the world with fools
The result of years of progra@I_. '?SYNTAX ERROR
The results of Anesthesia's IQ test were negative..
The results of gov't efficiency report to be published in 2007
The results of my I.Q. test came back. They're negative!
The results of my IQ test came back. They were negative.
The results of your IQ test are back--they are negative.
The results of your IQ test are back. They're negative.
The results of your IQ test came back negative.
The results of your IQ test have come back. They are negative.
The results of your IQ test were negative.
The return of the Outbound Flight Project!
The reverse side also has a reverse side <Japanese proverb>
The revolution will NOT be televised!
The revolution will not be televised.
The reward for a good deed is to have done it.
The reward for a job well done is more work.
The reward for work well done is the opportunity to do more.
The reward of a thing well done is to have done it. -- Emerson
The reward of a thing well done is to have it done.
The reward of energy, enterprise and thrift - is taxes.
The reward of one duty is the power to fulfill another.
The rich aren't like us; they pay less taxes.
The rich get lawyers, the rest get ammunition.
The rich get richer; the poor get babies.
The rich should pay more...and the poor should hire more!
The rich will do anything for the poor but get off their backs. - Karl Marx
The richest rewards come from helping others with no thought for reward.
The right face, the wrong time for love.
The right of election is the very essence of the constitution.
The right selection! Protect your erection
The right selection, check your erection
The right selection, protect your erection.
The right selection. Check your erection.
The right selection: Check your erection.
The right side of the wrong side of the tracks - Crow
The right to be left alone is indeed the beginning of all freedom.
The right to be left alone is the root of all freedom
The right to buy weapons is the right to be free.
The right tools can make any rental car a convertible.
The rings of Saturn are actually composed of lost airline luggage...
The rings of Saturn are composed of lost airline baggage
The rings of Saturn are made up entirely of lost airline luggage.
The rings of Saturn are made up of lost airline luggage
The ripest fruit falls first.
The ripest fruit falls first..
The rising people, hot and out of breath,
The riskier the road, the greater the profit -- ROA #62
The riskier the road, the greater the profit. - 62nd Rule
The river has gotten rough, Tom said rapidly.
The rivers are full of crocodile nasties
The riveting horse-mounting scene - Crow
The road is my dinner plate. -- Ratbat
The road to Bell is paved with good inventions.
The road to Liberal Utopia is paved with good intentions!
The road to a friend's house is never difficult nor long.
The road to happiness is paved with Thorazine.
The road to hell is paved with legislation.
The road to hell is paved with milestones.
The road to ignorance is paved with good editions. -G.B. Shaw
The road to knowledge........Exit only
The road to madness is loud... and goes through my room!
The road to success is always under construction
The road to success is always under construction.
The road to success is dotted with many tempting parking places.
The road to success is under construction ...
The road to success is usually under construction.
The road to success is usually under construction. - L. Long
The road to the patent office is paved with good inventions.
The road to to success is always under construction.
The road to to success is always under construction..
The road's risen up to meet me, and it won't go back down.
The roar of hot dogs, the smell of the crowd..
The rock of the gospel is either Amen or Oh me.
The rocket becomes engorged with astronauts - Joel
The rod of discipline applied to the seat of understanding!
The room was lit by the soft glow of featherlight.
The rooster may crow, but the hen delivers.
The root of all evil makes a pretty good tea.
The rootenest tootenest movie ever! - Joel
The roots of education are bitter, but the fruit is sweet. -- Aristotle
The roots of honesty and virtue lie in a good education.
The roundest knight at the round table? Sir Cumference!
The ruiner's your only friend, well he's the living end - NIN
The rule is, get a bigger one than you think you need.
The rule of law is too precious to entrust to shysters.
The rules stay the same, the game changes.
The sacred chalice of Riix is an old pot with mold growing in it.
The sacred cows have come home to roost with a vengeance.
The sacred lies in the ordinary.
The sacrifice of *men's* lives have led to *everyone's* survival.
The sad thing about Clinton bashing is that it's all *true*.
The sad thing about Clinton bashing is that it's all _TRUE_.
The sad thing about Windows bashing is it's all true.
The sad thing about Windows bashing is that it's all true.
The sad thing about Windows bashing: it's all true.
The sad thing about a Kitten is that it grows into a Cat.
The saddest about Windows bashing: it's true!
The safest place is behind a BFG9000 - Unknown Virtual Reality Fanatic
The safety net has turned into a hammock. --Rush Limbaugh.
The safety of the Enterprise is of Parmount importance - Picard
The same 2 keys are used to do everything
The same accidents often happen to different people. - Machiavelli
The same clutter that'll fill a 1 car garage will fill a 2 car garage.
The same hands that cook your food clean the cigarette butts out of this
The scalded cat fears even cold water.
The scalded cat fears even cold water. Thomas Fuller
The scantily clad prey - Tom as girl in slip runs by
The scariest words known to man: "We need to talk".
The scariest words known to man: "We need to talk."
The scattered crates add to the ambience - Mike
The scene they always show on That's Hollywood - Mike
The scenery changes only for the lead dog.
The scenery only changes for the lead dog!
The scenery only changes for the lead dog. (the Law of th
The school called. Everyone hates you. - Crow T. Robot
The school of hard knocks is an accelerated curriculum <Menander>
The school of hard knocks is an accelerated curriculum.
The school team's cheerleader has athlete's fetus.
The scientist has no corner on wisdom or morality.
The scientists are a couple dickweeds! - Joel & Bots
The scientists are barking down my snorkel - Joel on Mads
The scooters are not for the devout.
The score didn't really reflect the outcome.
The score is now Deep Space-9, Babylon-5 & Earth-2
The score so far: Deep Space 9 - Babylon 5 - Earth 2.
The screen is mightier than the sword.
The scum also rises. -- Dr. Hunter S. Thompson
The scum build-up on your keyboard is called carpal poo-poo.
The scum build-up on your mouse pad is rat poo-poo.
The sea hath bounds, but deep desire hath none.
The sea hath bounds, but true deep desire hath none.
The seabird hater left no tern unstoned.
The sealing kiss of hot lead. How I missed you.. - Apu
The searcher for pearls doesn't fear the mud.
The second gunman on the grassy knoll was$^!#$^@ NO CARRIER
The second hardest thing on earth wears the hardest on her finger.
The second mouse gets the cheese.
The second myth of management is that success equals skill.
The second rule of intelligent tinkering is to read the docs.
The second shortest man in the scriptures was Nehemiah, the Shoe-Height.
The second sport was tennis, when Moses served in Pharoah's Court.
The secret back room of your aunt's house - Tom
The secret is in the rinse cycle.
The secret is to BANG the rocks together, guys...
The secret of Life is &^":* '' NO CARRIER
The secret of being a bore is to tell everything- Voltaire
The secret of contentment is realizing that life is a gift not a right.
The secret of education lies in respecting the pupil.
The secret of eternal youth is arrested development.
The secret of eternal youth: never mellow.
The secret of flying is to throw yourself at the ground and miss.
The secret of happiness is to admire without desiring.
The secret of life is a nectarine. -- Q
The secret of life is a nectarine. -The Q
The secret of life is... a nectarine.
The secret of popularity is confidence - W. Allen
The secret of staying young is good health and lying about your age.
The secret of success is constancy to purpose.
The secret of success is sincerity. Once you can fake that you've got it made.
The secret of success is sincerity. Once you can fake that, you have it made.
The secret of success is sincerity. Once you can fake that you've got it made.
The secret of success is to be the one who keeps score.
The secret of success is to do the common things uncommonly well.
The secret of success is to start from scratch and keep on scratching.
The secret of the universe is @*&^^^ NO CARRIER
The secret of the universe is a nectarine?
The secret of the universe is~~*#~** FF * NO CARRIER
The secret to a long life is knowing when it's time to go.
The secret to creativity is knowing how to hide your sources.<Einstein>
The secret to dieting is not to eat between snacks.
The secret to dieting: don't eat between snacks.
The secret to immortality is %^^^@### NO CARRIER
The secret to patience is doing something else in the meantime.
The secretary will disavow any knowledge ...
The security of The J'Nai...they bother me -- Worf
The security of the Enterprise is of Paramount importance.
The security of the Enterprise is of Paramount importance. - Picard.
The seed of love must be continually resown.
The seed of love must be eternally resown.
The selling revolution will NOT be televised - Mike
The semi-conscious mind is a tricky thing.
The seminar on Advanced Time Travel will be held a week ago.
The seminar on Time Travel will be held two weeks ago.
The sense of adventure is changing to danger.
The sensual and the dark rebel, in vain
The sensuous pagan ritual begins - Crow on teens
The sentence is death. Let the trial begin. --Tribunal.
The series isn't canceled; it's another one of Q's stupid pranks!
The series isn't cancelled, it's another of Q's pranks!!
The series isn't cancelled; it's another one of Q's stupid pranks!
The session ain't over until the Zamboni comes out.
The session ain't over until the Zamboni driver kicks us off the ice..
The seven dwarfs were feeling happy in the bath - so he got out
The seven words you can never, ever say are f
The severity of the itch is inversely proportional to one's reach.
The severity of the itch is inversly proportional to its reach.
The sex act is the funniest thing on the face of this Earth. -- Diana Rigg
The sex life of a fish is nothing to brag about.
The sex was so good even the neighbors had a cigarette.
The sex was so good even the neighbors lit cigarettes!
The sex was so good the neighbors lit cigarettes!
The sex was so good, even the neighbors lit cigarettes
The sex was so good, even the neighbors lit cigarettes!!
The sex was so good, even the neighbours had a cigarette.
The sex was so good, even the neighbours lit cigarettes.
The sex was so good, the neighbors lit a cigarette.
The sex was so good, the neighbors lit cigarettes!
The sex was so good...the nighbors lit cigarettes!!
The sexes are equal with their erogenous zones blown sky-high!
The shadow of reason lurks in the mind of the insane.
The shadow of your :-)
The shadow's are comming! They're here. They are called Congress.
The shadows where the Mewlips dwell are dark and wet as ink.
The shadowy figure seems to be trying to get your attention.
The shameful expulsion from the chess club - Dr. F
The shape I'm in... you could donate my body to SCIENCE FICTION!
The sheep that fly over your head are soon to land.
The sheer, natural uzi - Joel as girl shoots gun
The ship is docked, said Tom importantly.
The ship will automatically destruct in T - 5 minutes. <Mother>
The ship's breaking up- get one of Kira's symbols of strength & unity!
The ship, it sang to me. - Dr. Jackobs
The ship, its changing.
The shoes got into the barn? - Crow as guy lisps 'shrews'
The shortest answer is doing.
The shortest distance between new friends is a smile.
The shortest distance between two Points is a BossNode.
The shortest distance between two friends is a smile.
The shortest distance between two points is a hot-loaded .44 Mag
The shortest distance between two points is always under construction.
The shortest distance between two points is generally under repair.
The shortest distance between two points is off the wal
The shortest distance between two points is off the wall
The shortest distance between two points is off the wall.
The shortest distance between two points is under construction.
The shortest distance between two points is under construction. -- Noelie Alito
The shortest distance between two puns ... is a straight line.
The shortest distance between two puns is a straight line.
The shortest distance between two puns: a straight line.
The shortest distance betwen two puns ... is a straight line.
The shortest distance betwen two puns is a straight line. . .
The shortest route between two points is always under construction.
The shortest route between two points is under construction.
The show hasn't started yet, you clueless fashion victims! - Dot
The show isn't canceled... Q's is just playing a joke on us.
The show-off is always shown-up in a show-down.
The shower is, for me, a great source of creativity. -- Jack Butler
The side with the simplest uniforms win.
The side with the simplest uniforms wins. 'Maj Mark Cancian
The side with the simplest uniforms, wins.
The sight of death frightens them [Earthers].
The sight of death frightens them. --Kurn.
The sight of her cleavage cut deeper in my heart than a sword.
The sign of a confident scientist: Often wrong, never in doubt.
The sign said "WET FLOOR" so I did
The sign said "Wet Cement" so I did
The sign said "eight items or less". So I changed my name to Les.
The sign said WET FLOOR, so I did...
The sign said eight items or less. So I changed my name to Les.
The sign said, "SLOW CHILDREN"... how sad for the neighborhood!
The sign said: Stop, Look, Listen, and while I did the train hit me.
The significant owl hoots in the night.
The simple answers are invariably the least obvious.
The simple explanation always follows the complex solution
The simple explanation always follows the complex souti
The simple explanation always follows the complex soution
The simple things are always hard.
The simple things are always hard. 'Murphy
The simplest of tasks for T. Hewitt Edward Crow - Crow
The sitting writer writes, and having writ, sits on.
The sixth sheik's sixth sheep's sick.
The sixth sheikh's sixth sheep's sick.
The size of government is inversely proportional to its competence.
The size of those cobs is a-maize-ing! was Tom's corny joke.
The sky already fell. Now what?
The sky is a poisonous garden tonight
The sky is as clear as Gary, Indiana - Crow
The sky is falling!! ....No, I'm tipping over backwards.
The sky is falling, burning your eyes...
The sky is not the limit. The ground is. Shut up and jump.-NO FEAR
The sky was Bible black in Lyon when I met the Magdalene.
The sky was the colour of a television tuned to a dead channel.
The sky's the limit when your heart is in it.
The sleek should inherit my girth.
The sleep of reason breeds monsters. - Goya
The sleeper has awakened.
The slow hand is dragging on, afraid to meet the dawn. - Deep Purple
The slower you go, the longer it takes you to get over the hill.
The slower you work, the fewer misteaks you make.
The slowest checker is always at the quick check-out lane.
The slowest checker will be at the quick check-out line.
The smaller the issue, the bigger the fight.
The smaller the print on things the more important it is.
The smallest deed is better than the grandest intention.
The smallest feline is a masterpiece. --Leonardo da Vinci
The smallest good deed is better than the grandest good intention.
The smallest handcuff in the world is a wedding ring.
The smarter you are, the easier some vet's job is.
The smell of men enjoying themselves - Tom on wrestlers
The smog is really bad today, Tom cried breathlessly.
The smoker you drink, the player you get.
The smut was placed here by the Gideons - Mike
The smut's gonna blow! - Mike
The sneak attack is the first resort of a coward. - Sinclair
The sniper is endangering my *private* medical files. - Hawkeye
The snow is really piling up outside.
The snow slithered down like a pair of badly made nylons.
The solar system has no anxiety about its reputation.
The soldier makes the glory of the general.
The solution any problem tends to change the problem.
The solution to a problem changes the nature of the problem.
The solution to a problem changes the problem.
The solution to forgery is to outlaw possession of pens.
The solution to gay bashing is NOT Christian bashing.
The solution to the problem changes the problem.
The solution to the problem only changes the problem !
The son of Skywalker must not become a Jedi. - Emperor
The son of Skywalker must not become a Jedi. -- Palpatine
The song remains the same" -Zep
The sooner all the animals are extinct, the sooner we'll
The sooner we get out of Oz, the safer we'll be..
The sooner you fall behind, the more time you have to cat
The sooner you fall behind, the more time you have to catch up.
The sooner you fall behind, the more time you will have to catch up
The sooner you get out of Oz, the safer you'll be..
The soul would have no heart had the eyes no tears...
The soul would have no rainbow had the eyes no tears.
The soul would have no rainbows if the eyes had no tears.
The sound of a Moderator reading mail: <cr><cr><cr><cr><cr><cr>
The sound of a SysOp reading mail <cr><cr><cr><cr><cr>
The sound of a SysOp reading mail: <cr<<cr<<cr<<cr<<cr<
The sound of a Sysop reading mail <cr><cr><cr><cr> <=The *T.A.*'s fave!
The sound of a Sysop reading mail <cr><cr><cr><cr><cr>
The sound of a switchblade and a motorbike
The sound of glass speaks quick disdain.--Jim Morrison
The sound of one hand clapping keeps me up at night.
The sound of one hand clapping.
The sound of the Democrat Party's clock, "TAX tax....TAX tax...."
The sound you just heard was that of your link being cut.
The sparrows are flying again -- Steven King.
The sparrows are flying again. You said someone's dead?
The speed of light is just barely faster than the speed of cat
The speed of the leader determines the rate of the pack.
The speed of time is one second per second.
The speed of-? Uh,EXCUSE me? LINT,the fastest thing in the Universe!
The spider keeps eating the credits - Joel
The spirit of a misplaced childhood is rising to speak his mind
The spiritual life is not a theory. We have to *LIVE* it. BB, p.83
The spit valve's fallen off his trumpet again.
The spoils of war: Army food.
The sports model has pull-back ears and her teeth fold in.
The squab is in the hole - Crow on secret mission
The squadron is upping it's standards.. So up yours!!
The squeaky wheel awakens Cthulhu.
The squeaky wheel gets the grease.
The squirrels are looking for nuts like you.
The stains in your shorts can indicate your future!
The standard deviation on reality has exceeded acceptable limits.
The stars are right. Vote the Elder Party in 1996.
The stars were falling in every direction.
The starship U.S.S. Spinal Tap: "It goes to warp 11."
The state law of Pennsylvania prohibits singing in the bathtub.
The state motto of Alaska: Brrrrrrrrrrr!
The state motto of Canada: Brrrrrrrrrrr!
The state of Denile is NOT in Egypt!
The stationary bus you've run for won't move for 15 minutes.
The statue got me high -- TMBG
The steady state of disks is full. - Ken Thompson
The steady state of disks is full. -- Ken Thompson
The steady state of disks is full. -- Ken Thompson
The still mind of the sage is a mirror of heaven and earth.
The stock footage is erupting! - Crow
The stock market's going up, said Tom bullishly.
The stomach expands to accommodate the amount of junk food available.
The stories are woven and fortunes told.
The stork and the wolf usually work the same neighbourhood...
The stork delivers bundles of joy, the Messenger bundles of taglines.
The story of life is quicker than the blink of an eye... - Hendrix
The straight and narrow path has no traffic problems.
The stranger, the better.
The stream-of-unconsciousness BBS.
The strength is in the sword, not in the arms. - Duncan MacLeod
The strength of woman lies in her ability to love.
The student who changes the course of history is probably taking an exam.
The study of non-linear physics is like the study of non-elephant biology.
The stupid argue; the talented talk; the wise are silent.
The stupidest question is the one unasked.
The stupidest thing you can do is to out-smart the DM!
The stylus is more potent than the claymore.
The subatomic particles comprising this product are exactly the same.
The subject of today's political debate: Politics - Mike
The sublime and the ridiculous are closely related. - Paine
The subliminal message for today is " ."
The subliminal message for today is.
The submitted Taglines have been *S*W*I*P*E*D*! Thanks, Gord. :-)
The subtitle is So Easy, Even a Kindergardener Can Do It.-Jack Butler
The sultan married 8 wives - four better and four worse.
The sultan married eight wives - four better and four worse.
The sum of a column of numbers is time dependant.
The sum of all knowledge begins at //
The sum of the IQ in the world is a constant. Population is growing.
The sum of the Universe is zero.
The summer of my German humiliation - Tom
The summer wind demon, came blowing in - Mike sings
The summer's truly adult Hollywood movie: The Lion King -Toronto Star
The sun ain't yellow, its chicken. -Bob Dylan
The sun always rises on the most tired people.
The sun comes up and that north wind blows.
The sun comes up too early for my liking!
The sun comes up too early for my liking! - Janier
The sun don't shine on the same dog all the time.
The sun goes down just when you need it the most.
The sun is a mass of incandescant gas -- TMBG
The sun is a mass of incandesent gas.
The sun is blinding at this latitude.
The sun is never the worse for shining on a dunghill.
The sun is not kind to plastic or people.
The sun is ris, the sun is set, and here I is in Florida yet.
The sun is up, the sky is blue, it's beautiful, and so are you.
The sun isn't going down. The horizon is coming up!
The sun isn't going down. The horizon is moving up.
The sun isn't the center of the universe. I AM!
The sun never sets on British race cars!
The sun never sets on British race cars!.
The sun shines even on the most wicked of people.
The sun won't melt our wings tonight --U2
The sun's over the yardarm.
The sunlight and the moonlight are beyond my control.
The sunshine of a single smile brightens any day.
The superfluous is very necessary.
The superfluous is very necessary. -- Voltaire
The supply of government exceeds the demand.
The supreme happiness of life is the conviction that we are loved.
The surest protection against temptation is cowardice. -- Mark Twain
The surest sign that a man is in love is when he divorces his wife.
The surest way to be late is to have plenty of time.
The surest way to lie convincingly is to tell the truth unconvincingly
The surest way to make a monkey of a man is to quote him.
The surgeon general has determined the life causes death!
The sweat in your eyes the blood in your veins are listening to me.
The sweat, the moonlight, and the lace...
The sweetest honey isn't always in the highest tree.
The sweetest of all sounds is the voice of a woman in love.
The swimming portion of the trucker triathalon - Crow
The swingingest joint since Jedi!
The sword of truth is the ultimate weapon.....VOTE !
The sword outwears it's sheath, and the soul outwears the Beast.
The sword outwears it's sheath, and the soul outwears the breast.
The sysop MADE me do it!
The sysop is out to get you.
The tag line ends here.
The tag-line generator is in the shop.
The tagline I put here was good, so the sysop deleted it.
The tagline I put here was good; it made sense. The sysop deleted it.
The tagline is mightier than the sword.
The tagline's here, the message is over.
The taillight covers on my car were taped on...what's wrong with that?
The taste of Zen is the taste of tea.
The taste of power has left you insane.
The tattoo on her forehead said, "Don't pull my ears."
The tax system is stacked against the average taxpayer.
The taxes of George III were small compared to those of today's Congress
The tea leaves say: You will find happiness in recipes.
The tea leaves say: You will find happiness in taglines.
The teddy bears are alive and they have six-inch fangs.
The teenage Andy Capp - Crow on dorky guy in cap
The telephone always rings just when you step into the shower.
The telephone always rings when you're in the bathroom.
The telephone will ring when you are outside
The tension is mounting... and my nails are shortening...
The tepid embrace tells me they're ready for marriage-Tom
The term "Cargo bay doors" is not currently in my lexicon!
The term "Liberal Thinktank" is an oxymoron.
The term "Speak in tongues" is not found in the Bible.
The term Liberal Think tank is an Oxymoron!
The test of a good religion whether you can joke about it. -Chesterton
The test of democracy is freedom of criticism.
The test: Behavior in times of controversy and challenge.
The thief is sorry he is to be hanged, not that he is a thief.
The thing I like best about cats is that they don't bark.
The thing I like best about cats: THEY DON'T BARK!
The thing I like best about ferrets: THEY DON'T BARK!
The thing generally raised on city land is taxes.
The thing most generally raised on land is taxes.
The thing wrong with strangers, you never know who they are.
The things I need are love and greed - Course of Empire
The things beauticians do it with would curl your hair.
The things love can drive a man to ...
The things that we fear are a weapon to be used against us. - Rush
The things that we're concealing will never let us grow.: Rush
The things you hear out of the mouths of 33 year olds...
The things you think will last, just disappear.
The thinking man's approach to most problems is a good nap.
The thinnest book in the world: What Men Know About Women.
The thinnest book? Lawyers that don't care about money.
The thinnest book? Successful Foriegn policy enacted by Democrats.
The thinnest book? The Concordance of Efficient Goverments.
The thinnest book? The Republican book of good natured humor.
The third Warner Brother on Animaniacs.
The third day HE AROSE.
The thorns which I have reaped are of the tree I planted.
The thought of busting Batman makes me feel all dirty.
The thoughtles are rarely wordless.
The thoughtless are rarely wordless.
The thoughts of youth are long, long thoughts
The thoughts that destroy an entire man - Course of Empire
The three R's of learning today: Radical Religious Right
The three branches of government: Money, Television and Bullshit
The three branches of government: lobbyists, media, PAC's.
The three food groups: Instant, Frozen, and Take Out
The three kinds of falsehoods: Lies, Damned Lies, and Statistics.
The three most dreaded words when making love: "Is that it?"
The three most painful words to any man: "Is it in?"
The three worst words you can hear in bed: "Honey, I'm home!"
The thrill is gone, the thrill is gone baby
The thrill is not just in the winning, but in the courage to join the race.
The thrill of the chase is worth the pain.
The thrill of victory and the agony of delete.
The thump of colliding egos could be heard for miles. (Bill W.)
The ticker's very faint...not the bomb's, mine. - Hawkeye
The ticking of freshly minted seconds--REAPER MAN.
The tides of sin draw tighter and brighter,
The time I like is the rush hour, cos I like the rush.
The time for action has past--now is the time for senseless bickering!
The time for action is past! Now is the time for senseless bickering!
The time for bickering has past. Now is the time to drop our gloves.
The time has come to let you go...
The time is NOW for OS/2!
The time is always right to do what is right.
The time is fulfilled, and the kingdom of God is at hand. -Mark 1:15
The time is gone the song is over, thought I'd something more to say..
The time is past. There is no room for gods.
The time is past.There is no room for gods.
The time is right to make new friends.
The time machine has landed you in the wrong ECHO!!!!
The time to abort, is before conception!
The time to make friends is before you need them.
The time to make up your mind about people is...never.
The time travel convention two weeks from now was great!
The toad likes water, but not when it's boiling - Guinea
The toes you step on now, ..might be the A** you'll kiss later..
The toilet, clitoris and anniversaries: Why do men miss all 3?
The toilet, the clitoris, and anniversaries, why do men miss all 3?
The tongue weighs very little, but few people are able to hold it.
The torture never stops ...
The torture never stops.
The toughest BBS you'll ever love.
The towels are done - Crow on spinning lunar effect
The town I grew up in had a zip code of E-I-E-I-O.
The tragedy of war is using man's best to do man's worst
The trail's got to be 'round here somewhere! D. BOONE
The train's already leaving and it won't come back.
The transporter is not malfunctioning...I have locked out the controls
The transporters are down. We'll have to FAX you there.
The treatment center I got was Durham nick.
The tree fell after the land of Nod's beaver nod it.
The tree of Liberty is watered with the blood of Patriots
The tree of liberty is watered with the blood of tyra\SLM
The tree of liberty is watered with the blood of tyrants.
The trick in overcoming temptation, is to play dead.
The trick is to die young as old as possible.
The trick is to imply that *anyone* can get lucky.
The trick of sawing a lady in half is easy.
The trick to flying, missing the ground.
The trickle-down theory of plots - Tom
The trigger has been pulled.
The triumph of the bread! - Crow
The trodden path is the safest.
The trouble in America is that so many political jokes get elected.
The trouble is that you think you have the time.
The trouble with 'normal' is that it always gets worse.
The trouble with TRIBBLES is triplication.
The trouble with WINDOWS. . .it isn't DESQview/X
The trouble with a kitten is that eventually it becomes a cat.
The trouble with a kitten is that eventually it's a cat.
The trouble with a kitten is that, eventually it's a cat.
The trouble with airplanes is, you can't walk out on a dull movie.
The trouble with apathy these days is nobody cares.
The trouble with being a god is that you've got no one to pray to. (SG)
The trouble with being a good sport is you have to lose to prove it.
The trouble with being broke is that it takes up all your time.
The trouble with being poor is that it takes up all your
The trouble with being poor is that it takes up all your time.
The trouble with being punctual is that no one is there to appreciate it.
The trouble with being punctual is that no one is there to appreciate.
The trouble with being punctual is that nobody's there to
The trouble with being punctual is that nobody's there to see it!
The trouble with cats is that they've got no tact
The trouble with cats is they've got no tact.
The trouble with children is that they are not returnable.
The trouble with common sense is it's no longer common.
The trouble with dieters is that they are poor losers.
The trouble with facts is that there are so many of them!
The trouble with getting a life is making the payments.
The trouble with giving advice is that people want to repay you.
The trouble with kittens is that eventually they turn into cats.
The trouble with life is I keep getting what I deserve.
The trouble with life is the lack of cool background music.
The trouble with living sacrifices is they crawl off the altar.
The trouble with living sacrifices is they keep crawling off the altar
The trouble with memories is they keep coming back!
The trouble with men is their trouble with women.
The trouble with mornings is they happen when you're awake.
The trouble with most political jokes is they ussually get elected.
The trouble with most political jokes is they usually get elected.
The trouble with political jokes is that they get elected.
The trouble with political jokes is that they get elected. - L. Long
The trouble with political jokes is that they get elected. -- RAH
The trouble with political jokes is they get elected!
The trouble with political jokes is they get elected.
The trouble with reality is that there's no background music.
The trouble with reality is there's no background music.
The trouble with reality is, there's no background music.
The trouble with reality-no background music!
The trouble with resisting temptation is that it may never come again.
The trouble with some self-made men is that they worship their creator.
The trouble with superheros is what to do between phone booths. -- Ken Kesey
The trouble with the rat race is even if you win you're still a rat.
The trouble with the rat race is even the winners are rats!
The trouble with tribbles is that they've got *'s in their eyes.
The trouble with trouble is that it usually starts out like fun.
The trouble with troubleshooting is that trouble shoots back.
The trouble with women is their trouble with men.
The true mark of an M.B.A.: often wrong but never in doubt.- R. Buzzell
The true meaning of Life? No parole.
The true measure of love is to love without measure.
The true spirit of a phrase is in the thought it initiates.
The true statesman is the one who is willing to take risks.
The truest end of life is to know that life never ends.
The truly fashionable are beyond fashion.
The truly paranoid are clever enough not to *act* paranoid.
The truth about a man lies first and foremost in what he hides.
The truth cannot be found in epigrams.
The truth doesn't hurt unless it ought to.
The truth is - Columbus discovered Ohio.
The truth is NOT always dressed for the evening.
The truth is in the backyard? :)
The truth is inside you. I cannot help you find it. Don Juan DeMarco
The truth is measured by the weight of your gold.
The truth is more important than the facts.
The truth is more important than the facts.
The truth is not kind and neither am I!
The truth is one thing that @FN@ will not believe.
The truth is one thing that YOU will not believe.
The truth is one thing that no-one will believe..
The truth is one thing that nobody will believe.
The truth is out there ... but so are lies.
The truth is out there! Help us find it!
The truth is out there, Mulder. Just don't question Garak.
The truth is out there, Mulder... but so are lies. - Dana Scully.
The truth is out there, but so are lies.
The truth is out there, don't stop looking until you find it.
The truth is out there. -X Files
The truth is out there. --Mulder.
The truth is out there. --X-Files.
The truth is out there... - Fox Mulder
The truth is out there....... Just waiting.
The truth is rarely pure, and never simple.
The truth is that our real enemy is already here.
The truth is the most freeing discovery you can make. - L. Long
The truth is the most important thing.
The truth is the one thing no one will believe.
The truth is the one thing nobody will believe.
The truth is the quickest and easiest way out of trouble.
The truth is the truth whether it hurts or not...
The truth is what is; what should be is a dirty lie. -- Lenny Bruce
The truth is, Columbus discovered Ohio.
The truth isn't out there. It's hiding in the fridge.
The truth may be out there, but it certainly wasn't in the above post
The truth may be out there, but we'll never know it.
The truth shall get you fired.
The truth shall make you free, but first it shall P*** you off!
The truth shall make you free, but first it shall piss you off.
The truth should never stand in the way of a good story.
The truth was never intended to be comfortable.
The truth will be found when it is no longer needed.
The truth will set you free, but first it will piss you off!
The truth will set you free, but it might piss you off first.
The truth will set you free, but it won't pay your bills.
The truth will set you free,but first it'll piss ya off.
The truth, however, is not pertinent to the issue.
The truth, if you recognize, will clear out your sinuses.
The tuna doesn't taste the same without dolphin.
The tuna doesn't taste the same without the dolphin.
The tuna doesn't taste the same without the dolphin.
The tuna just doesn't taste the same without the dolphin ...
The turbolift can't climb past deck 5 when there are more than 2 people
The turkey vultures are returning - Tom
The turn of the century was probably made by a woman driver!
The turtle only makes progress when he sticks his neck out.
The twinkle in his eyes is actually the sun shining between his ears.
The two cents is not refundable.
The two great Dukes: Wayne & Nukem
The two great tragedies in life: not getting what one wan
The two most common elements in the universe: H and IQ90.
The two most common elements in the universe: Hydrogen & Stupidity.
The two most common elements of the universe..Moose and Aardvarks.
The two most common things in the universe are hydrogen and stupidity.
The two things children wear out are clothes and parents.
The two wits...nit and dim.
The ugliest outfit you could wear is your birthday suit!
The ultimate Doughy Guy: J. Edgar Hoover - Crow
The ultimate Law: All general statements are false.
The ultimate Operation Rescue dilemma: A gay fetus
The ultimate Oxymorons. Military intelligence and Tech support!
The ultimate Turn on. When they shoot at you.. and miss!
The ultimate in useless diversions.
The ultimate liberty is that to be yourself, no matter what.
The ultimate mail reader is here - BlueWave 2.20!
The ultimate mail reader is here!!!!
The ultimate mail readers are coming - BlueWave 2.20/DOS/386/OS2!
The ultimate offline mail system!
The ultimate oxymoron: Holy War
The ultimate oxymoron: "male feminists."
The ultimate oxymoron: "male feminizts."
The ultimate quest has no ending. <D Carradine>
The ultimate reason is "because."
The unborn can't talk, so they should have more rights.
The uncertainty principle won't help you now.
The undersea foot ball all-stars - Tom
The unemployed do it off company time.
The unemployed usually have poor-gasms.
The unexamined life is not worth living.
The unexamined life is not worth living. Socrates
The unexamined life is not worth living.<Socrates>
The unexpected IS our normal routine.
The unexpected cannot be planned for, by definition.
The unity of freedom has never relied on uniformity of opinion.
The universe DOES make sense--if you look at it from far enough away.
The universe does not have laws -- it has habits, and habits can be broken.
The universe does not have laws--it has habits; habits can be broken.
The universe doesn't care what time it is. -- Jack Butler
The universe is NOT so badly designed! - Picard to Q
The universe is _intensely_ beautiful.
The universe is a spheroid region 705 meters in diameter. - Computer.
The universe is a spheroid region 705 meters in diameter\SL
The universe is alive and it knows where you are
The universe is all a spinoff of the Big Bang.
The universe is an island, surrounded by whatever surrounds universes.
The universe is full of magical things.
The universe is laughing at you behind your back.
The universe is laughing behind your back.
The universe is laughing behind your back.
The universe is laughing behind your back. I'm laughing to your face.
The universe is my home, but I'm thinking of moving.
The universe is not a friendly place.
The universe is one of God's thoughts. -- Schiller
The universe is queerer than we CAN imagine.
The universe is run by 3 elements, energy, matter and self-interest.
The universe is simple - it's the explanation that's complex.
The universe is surrounded by whatever it is that surrounds universes.
The universe is very BIG. Believe me.
The universe is very BIG. Believe me.
The universe looks smooth - if you stand back far enough.
The universe looks smooth-if you stand back far enough.
The university exists to only to find and communicate the truth.
The unjust steals the just's umbrella. -Charles, Baron Bowen
The unknown Terminate origin!
The unknown always seems sublime.
The unknown future roles toward us. - T2
The unlived life is not worth examining.
The unnatural, that too is natural.
The unnatural, that too is natural. - Goethe
The unofficial motto of the NWT: brrrrrrrrrr!
The upper crust is just a bunch of crumbs clinging together.
The upper crust....a bunch of crumbs who stick together.
The uproar of one hand clapping.
The urban landscape unnatural? Hardly -- Glass Walkers
The urologist was tried by a jury of his peers.
The use of 'goto' statements is discouraged, especially with the label HELL:
The usefulness of a meeting is inversely proportional to its attendance.
The useless bit of skin on the end of a penis: @FN@.
The useless bit of skin on the end of a penis: The man.
The useless bit of skin on the end of a penis: YOU.
The useless bit of skin on the end of the penis: the man.
The usual Pooh test will be at 3 AM at the *Tagline Courthouse.*
The usual, Odo? Nothing. The usual. -- Quark/Odo
The value of a program is proportional to the weight of its output.
The value of my waterfront property's up, said Tom in a superior manor.
The valve is all bunged up with sentiment...
The vastness of space and time... and I end up here...
The vending machine is my friend!
The very fastest way to run Windows programs is OS/2 2.1
The very idea of a Giant Space Hamster of Ill Omen. Mwah Hah Hah
The very latest from Earth Force's R&D. - Richard Franklin
The vessel is on a collison course. Impact in 36 seconds. - Data
The vessel with the pestle has the pellet with the poison...
The vicious beating has a cool accompaniment - Crow
The victim had 37 stab wounds...foul play is suspected.
The victim is a victim no matter who the perpetrator was.
The victim of a prank upon waking, Geordi grabs a banana ..
The victim of a prank, Geordi grabs a banana upon waking.
The victor will never be asked if he told the truth.
The view from the high mountain is worth the climb - Mori
The view is better from the edge of reality.
The views expressed above are not necessarily those of the management.
The views of this user are strictly his own.
The vine Jane! No the vine! aaiiieeeee...
The vine Jane, No Jane the vine, aieeeeeee
The virus taglin--please copy me to your tagline.
The visible universe is for those who have to see it to believe it!
The voices in my head assure me I'm still perfectly sane.
The voodoo ceremony for that guy's backhand - Mike
The wages of SIN is DEATH - Romans 6:23.
The wages of sin are Death ..... but the work's pretty good!
The wages of sin are Death....but the work's pretty good.
The wages of sin are deadly.
The wages of sin are death. Pat Robertson's are $6MM/year.
The wages of sin are high but you get your money's worth.
The wages of sin are unreported.
The wages of sin depend on what union you belong to.
The wages of sin go unreported.
The wages of sin is death (Which, after taxes, is just a bad feeling).
The wages of sin is death, but after taxes it's just a headache.
The wages of sin will now be taxed.
The waist is a terrible thing to mind
The waiting seems eternity, this day will dawn of sanity.
The waiting seems eternity/The day will dawn of sanity.--Queen
The walkin' dead ain't very impressive with no kneecaps!
The wall was too high, as you can see! - Pink Floyd
The walls are crawling with giant, fanged Orville Bullitt's.
The walls are crawling with giant, fanged Orville's.
The walls are melting again! He he he. - Hallucinating Marge
The walls screamed poetry disease & sex--Jim Morrison
The war between the sexes is over...nobody won...
The war is not fought to preserve the enemy. - Hitler
The war of life is not to be decided in a single battle.
The war on drugs is like a war: on drugs.
The war on drugs is more deadly than drugs.
The warcats must condemn themselves.
The warm glow of a state home - Crow
The warp drive has spontaneously turned into lingiuni. Without sauce.
The warranty: Bold print giveth & fine print taketh away.
The warrior elite is a dead class!
The washing machine in my head is on spin cycle.
The water tasted bad for a week / and we had to make do with gin
The way I speak often reveals more than the words I say.
The way for you to find happiness is to get amnesia.
The way guys spend time with them you'd think they were cumputers.
The way he runs things, it won't last a hundred. - Helmut
The way it stands right now, I'm filled with evil-Dracul
The way of the sage is to act but not to compete.
The way of the world is to praise dead saints and prosecute live ones.
The way some people find fault - you'd think there was a reward.
The way some people find fault, you'd think there was a reward.
The way that is spoken of is not the enlightened way. Lao-Tzu
The way things are going, they're gonna crucify me.
The way to *this* woman's heart is through her stomach!
The way to a lesbian's heart is through her clitoris!
The way to a man's heart is through his pants -- wallet and underwear.
The way to a man's heart is through his stomach... NOT!!
The way to a man's heart is through his veins
The way to a man's heart is through the left ventricle
The way to a man's heart is through the left ventricle.
The way to a man's heart is with a broadsword.
The way to a man's heart: Crack the chest between ribs #3 and #4.
The way to a man's heart: between the ribs, and slightly up.
The way to a mans heart's through the ribs with a knife.
The way to a woman's heart is through her ribs.
The way to deal with predators is to taste terrible.
The way to fairyland - shut your eyes and blunder on
The way to get rich is to start your own religion - L.Ron Hubbard
The way to get rid of a temptation is to yield to it.
The way to get to the top is to get off your bottom.
The way to love anything is to realize it might be lost. - Chesterton
The way to love anything is to realize that it might be l
The way to love anything is to realize that it might be lost.
The way to prevent nuclear war is to prevent it. --Diefenbaker.
The way to procure insults is to submit to them.
The way you do the things you do. The Temptations
The way you vote creates politicians.
The ways of being human are bounded but infinite.
The ways of being human are bounded but infinite. - Larry Niven
The weak can never forgive. Forgiveness is the attribute of the strong
The weak die, the strong survive - Toq
The weaker of the herd can feel their eyes and hear them howl.
The weather is good, but the economy is bad !!!
The weather is great! Wish you were beer.
The weather is great! Wish you were beer.
The weather is here - Wish you were beautiful.
The weather is here, wish you were beautiful.
The weather is here, wish you were beautiful.
The weather is here, wish you were beautiful. Jimmy Buffet
The weather is here. Wish you were beautiful.
The weather is here. Wish you were beautiful...
The weather is here. Wish you were beautiful.
The weather's here, wish you were beautiful.
The weatherman might drive a Sunbeam.
The weed of crime bears bitter fruit. -The Shadow
The weird sisters, hand in hand, posters of the sea and land.
The weird stuff this nutcup is into! - Dr. Servo on Crow
The weirdest My Little Margie I've ever seen - Tom
The welfare of the people is the chief law.
The well resolved mind is single & one pointed
The west wasn't won with a registered gun!
The wet Noodle Award goes to....the envelope please.....Orville!
The wheel that squeaks the loudest is the first to be replaced.
The wheel that squeaks the loudest is the one that gets the grease.
The wheel turns, does it not <G'kar>
The wheel turns, does it not? - G'Kar
The wheel's spinning but the hamster's dead.
The wheels of progress are turned by cranks.
The whims of Murphy and his Laws are not to be taken lightly.
The whims that we're weeping for, our parents would be beaten for.
The whip is oiled and coiled.
The whiskey ain't working anymore...
The white queen rolls on the chessboard of the dawn.
The white water is almost to the gate. Time to build a stone wall.
The whiteness of confusion is unfolding from my mind. -Panacea, Rush
The whole bloodsucking thing, it's all so sexual.- Don Schanke
The whole damned castle is out of order! - Tom
The whole earth is in jail and we're plotting this incred
The whole is greater.
The whole is the sum of its parts, plus one or more bugs
The whole movie was worth it to see this! - Mike
The whole of Nature is Chaos : A Fract all should know
The whole purpose of your life is to serve as a warning to others.
The whole universe is laughing at you behind your back.
The whole voodoo motife continues - Dr. Forrester
The whole world is a tuxedo and you are a pair of brown s
The whole world is about three drinks behind
The whole world is about three drinks behind.
The whole world is festering with unhappy souls. -Kingston Trio
The whole world wants to have sex bar 75% of women.
The whole world's just going to hell in a hand puppet!
The wicked old thread is dead!
The wife and I have sex doggy style. I roll over. She plays dead.
The wife and I laughed until the weather came on.
The wife of a careless man is almost a widow.
The wife's gonna be awfully glad to see THE me - Tom
The wild and the young they all have their dreams, they gotta be free.
The wild dreams of today are the practical realities of tomorrow.
The wildest colts make the best steeds.
The will of God is the sanctuary of ignorance. - Spinoza
The will to kill, the need to breed - Course of Empire
The willingness to take risks is our grasp of faith.
The willow paints the wind, without using a brush. <Saryu)
The wind blew nervously on the shore.
The wind can carry the echoes home to me....
The wind cries, Mary - Hendrix
The wind is not swifter than a womans choice between two men!
The wind is pansexual. It blows everybody.
The wind of change blows straight into the face of time.
The wind's rush is the pulse of a Dragon's heart
The window she undooth, and that in haste.
The windows to the world might be your own front door.
The wine is good but the meat is spoiled.
The winner in a war is who has the most toys left!
The wise don't merely stalk their prey, they make the kill.
The wise learn from fools, not vice-versa.
The wise learn more from fools than fools from the wise
The wise learn more from fools than fools from the wise.
The wise man does not shave with a Vorpal Razor.
The wise man knows a little; the wise guy knows it all!
The wise open their minds, but a fool opens his mouth.
The wise person writes bomb-proof code.
The wise shepherd never trusts his flock to a smiling wol
The wise shepherd never trusts his flock to a smiling wolf.
The wiser mind mourns less for what age takes, than what it leaves.
The wisest man remembers that to catch a mouse you starve a cat.
The wisest men have the best reference libraries.
The wisest mind has something yet to learn.
The wisest prophets make sure of the event first.
The witch hunt isn't over - it's just merely shifted brooms.
The wizard thinks he's in control. The gods think that's *funny*!
The woman cries before the wedding; the man afterward.
The woman cries before the wedding; the man, afterwards.
The woman cries before wedding; the man afterward
The women can come back out now, Bullitt has gone.
The women can come back out now, Orville has gone.
The women can come back out now, Scheibe has gone.
The wonderful world of dog snot! Next, on channel 37.
The woods are wonderous here, but strange.
The word "bravery" is not in the Clinton dictionary.
The word "bulldozer" wandered through his mind for a moment.
The word "honesty" is not in the Clinton dictionary.
The word "honor" is not in the Clinton dictionary.
The word "integrity" is not in the Clinton dictionary.
The word "loyalty" is not in the Clinton dictionary.
The word "morality" is not in the Clinton dictionary.
The word "tolerance" is selectively used in the liberal lexicon.
The word 'dog' does not bite. --William James.
The word 'exonerated' is invented - Mike
The word Sysop should ALWAYS be capitalized. (cf. Suprem
The word bulldozer wandered through his mind for a moment.
The word bulldozer wandered through my mind for a moment!
The word is no. I am therefore going anyway. - Kirk
The word is pussy. Spread the word!
The word legend is a mythnomer.
The word of God is the will of God
The word of the day is "legs". Spread the word!
The word of the day is LEGS, spread the word
The word of today is LEGS. So spread the word.
The word today is Legs ... Spread the word.
The word today is, LEGS. Help spread the word
The words 'nyah nyah' were clearly heard - Mike/#606
The words of the profits are written on the studio walls -RUSH
The words of the prophets are written in the tagline files
The words of truth are always paradoxical. - Lao Tsu
The words we use can compound our problems
The worker who fell into the upholstery machine is now fully recovered.
The workings of your mind are a mystery to me. - Brain
The workmanship surpassed the material.
The world bores you when you're cool - Calvin
The world crowns success, but God crowns faithfulness.
The world does not revolve on an axis.
The world doesn't make any heroes. Orson Welles
The world doesn't owe me a living -- I wish it owed me a loving.
The world ends at 8 P. M.... Film at 11.
The world ends at 8 P.M. ... Film at 11.
The world gets better every day - and worse in the evening.
The world has finally achieved perpetual commotion.
The world has one less Santa - Mike as alien eats fat man
The world has two kinds of people: Friends and Targets
The world in a nutshell--an appropriate receptacle.
The world is "weird." Al is normal.
The world is a Schrodinger box, and we are merely cats.
The world is a beautiful book, for those who can read it.
The world is a cynic's playground.
The world is a madhouse ....That's why it makes sense to Orville.
The world is a madhouse ....That's why it makes sense to he.
The world is a madhouse, that's why it's patrolled by armed idiots.
The world is a madhouse...that's why it makes sense.
The world is a stage with no audience.
The world is a stage, but acting is attrocious!!!
The world is but a school of inquiry.
The world is coming to an end - Online time has been adjusted.
The world is coming to an end - your time online has been adjusted.
The world is coming to an end -- please log off.
The world is coming to an end --- please log off now.
The world is coming to an end ... SAVE YOUR BUFFERS!!!
The world is coming to an end please log off.
The world is coming to an end!
The world is coming to an end! Online time has been adjusted.
The world is coming to an end! Repent and return those library books!
The world is coming to an end! Online time adjusted!
The world is coming to an end! Repent & return those library books.
The world is coming to an end! Repent and return those library books.
The world is coming to an end--Online time has been adjusted.
The world is coming to an end. Please log off now..
The world is coming to an end. Please log off.
The world is coming to an end. Press any key to continue.
The world is coming to an end. Your online time has been adjusted.
The world is coming to an end. Insert coins to continue.
The world is coming to an end. Please log off properly.
The world is coming to an end. Please log off.
The world is coming to an end... SAVE YOUR BUFFERS!!
The world is coming to an end... SAVE YOUR BUFFERS!!!
The world is coming to an end... Press ESC... No Carrier
The world is coming to an end... your on-line time has been adjusted.
The world is coming to an end; please log off.
The world is coming to and end --- please log off now.
The world is coming to end . Please log off
The world is comming to an end... Press ESC... No Carrier
The world is ending. Do not drop carrier.
The world is filled with the Absolute. To see this is to be made free.
The world is full of Special Friends...
The world is full of cactus, but we don't have to sit on it
The world is full of dogs, and I'm stuck in this tree outfit.
The world is full of educated derelicts.
The world is full of ignorant people. Thank God it's not the disabled!
The world is full of ignorant peopleand they're not disabled!
The world is like a cactus except the pricks are inside.
The world is not yet entirely perfect, and I'm getting impatient.
The world is only as far as an InterLink board!
The world is proof that God is a committee. Stokes
The world is run by those who show up for the meeting.
The world is run by those who show up.
The world is safe for lady's wrestling - Tom
The world is so big and so global now.
The world is too complicated for one line aphorisms.
The world isn't worse - the news coverage is more extensive.
The world isn't worse. It's just that the news coverage
The world laughs at Bill Clinton and he's too incompetent to notice.
The world laughs at Bill Clinton.
The world looks as if it has been left in the custody of trolls.
The world looks flat to me.........That's a map dude !
The world of children's publishing is bunny eat bunny.
The world of reality has its limits, imagination is boundless.
The world of today is run by "C" students of yesterday.
The world owes me happiness, fulfillment and success - Calvin
The world owes you nothing. It was here first. - Twain
The world quietly reshapes itself to suit the cat.
The world thumbs its nose at Bill Clinton.
The world thumbs its nose at Clinton and he's too ignorant to notice.
The world today seems absolutely crackers.
The world tolerates conceit from those who are successful.
The world weighs on my shoulders, but what am I to do?
The world will come to the man who is truly wise." <Caine>
The world will end at midnight, 12:30 in Newfoundland.
The world will end in 5 minutes. Please log out.
The world's as ugly as sin, and nearly as delightful.
The world's coming to an end. Log off and leave in an orderly fashion.
The world's full of Cactus, but I don't have to sit on it
The world's full of Cactus, but I don't have to sit on it.
The world's higgly piggly and Cher has a brand new butt tattoo.
The world's imagination is contained in a Crayola box.
The world's largest salute to Orvel Reddenbacher - Joel
The world's most affectionate creature is a muddy dog.
The world's most efficient mouse trap...Windows95.
The world's net intellegence is constant, the population is growing!
The world's so terrible that one can only make fun of it.
The world's studliest monster! - Joel as Gamera swaggers
The world's thinnest book? Reliable Fido nodes.
The world, as we know it, has come to an end!!
The world: A comedy for thinkers; a tragedy for feelers.
The worm gets the late bird.
The worm in the sour apple doesn't know any better.
The worm that sleeps in doesn't get eaten by the bird.
The worse the weather, the more chance you will be out in it .
The worse things get the better I look.
The worse your line is tangled, the better is the fishing around you
The worse your line is tangled, the better the fishing is around you.
The worst actress in the company is always the manager's wife.
The worst beer around is WinBooze.
The worst case of false advertising since The Neverending Story!
The worst case of testosterone poisoning I've seen. --Ivanova.
The worst cliques are those which consist of one man.
The worst day fishing is better than the best day working.
The worst day's fishing is better than the best day's w
The worst day's fishing is better than the best day's washing.
The worst day's fishing is better than the best day's work
The worst fear is the fear of living. - Theodore Rosevelt
The worst feature of a new baby is it's mother's singing.
The worst feature of a new baby is its mother singing.
The worst form of failure is the failure to try.
The worst hatred is that of relatives.
The worst ice cream flavor is probably squirrel.
The worst men often give the best advice.
The worst nightmare: A cop w/a learner's permit -Mike
The worst of life. Pushing Fast Forward on reality.
The worst part about group sex is deciding on pizza toppings
The worst possible set of circumstances is bound to occur
The worst prison would be a closed heart.
The worst problems have solutions that create problems.
The worst social disease you can get from cats is fleas.
The worst thing about Altzheimer's is...ahh...
The worst thing about Altzheimers is
The worst thing about censorship is
The worst thing about censorship is
The worst thing about censorship is **************************.
The worst thing about censorship is XXXXXXXXX
The worst thing about censorship is XXXXXXXXXXXXXX
The worst thing about censorship is [[[[[[[[[
The worst thing about censorship is ħħħħħħħħ
The worst thing about censorship is ÛÛÛÛÛÛÛÛÛÛ.
The worst thing about incomplete sentences.
The worst thing about political jokes is that they get elected.
The worst thing about political jokes is, they get elected.
The worst thing in this world, next to anarchy, is government.
The worst thing men is that when not drunk they are sober
The worst time to have a son is 18 years before a World War
The worst vice of a fanatic is his sincerity.
The worthy machine out not always paste the astronomer.
The wreck is going down, get out before you drown. - Soundgarden
The written word preserves the wonders of the human mind.
The wrong way always seems the more reasonable.
The wsOMR, a telemicroscope that views cyberspace!
The year is 1980. The name of the place is Funky Town.
The year is 1994. The name of the place is, ahh, hey, where *am* I?
The year is 1995, The place is Congress, Our last hope. IT failed.
The year is 1995. The name of the place is Babylon 37.
The year is 1995. The name of the place is, ahh, hey, where *am* I?
The year is 2258.
The year is 2258. The name of the place is Babylon 5.
The year is NOW. The name of the place is Babylon 5.
The year of the great war, 2259 - Babylon 5
The young Peter Graves Chronicles - Tom
The young are slaves to novelty, the old to custom.
The young constable has just thrown up into his helmet.
The young couple keeps a lot of booze on hand - Crow
The young know everything
The young know rules, the old know exceptions.
The young know the rules, the old know the exceptions.
The young man knows the rules but the old man knows the exceptions.
The young must learn to obey a free gov't. - Aristotle
The young must learn to obey a free government.<Aristotle>
The young sow wild oats. The old grow sage.
The young wish to give their elders the full benefits of
The younger they get, the older I get.-Hawkeye on wounded soldiers
The youngest one liked girls. huh huh huh
The zombie drives a K car! - Mike
The zombie is deep in the rough on the 13th - Crow
The zombie's gotta clear that frog outta his throat -Crow
The zorg draws nearer. Spiff sets his blaster on "medium well" - Calvin
The.Question = (2 * B!) OR NOT(2 * B!)
TheBorgAreBackAn'TheresGonnaBeTroubleHeyNaHey
TheMenWhoHoldHighPlacesMustBeTheOnesToStart..-Rush
Theasaurs: An ancient dinosaur w/ an excellent vocabulary
Theasaurus - A smart Dinosaur with a good vocabulary.
Theater is Life...Film is Art...Television is Furniture.
Theater people do it on stage.
Theater techies DO IT in the dark, on cue.
Theater: Holding a mirror up to a keyhole.
Theater: Holding a mirror up to a keyhole.
Theatre is Art; Film is Life; Television is Furniture
Theatre is life - Film is art - Television is furniture.
Theatre is life - film is art - television is furniture.
Thecontentsofthismessagearesubjecttosettleduringshipment.
Thecontentsofthismessagesubjecttosettleduringshipment.
Theft Among Arthropods: The Lieutenants
Theft Proof Tagline <hehe>
Theft Proof Tagline <hehe<
Theft Proof recipe <hehe>
Theft and Robbery: Andy Tover(4)
Theft and Robbery: Andy Tover
Theft is illegal because the gov't hates the competition!
Theft is illegal because the government hates the competition!
Theft will result in a $50,000 fine, imprisonment, or even death.
Theft-proof tagline.
Thehe tags together in one
Their 5-year mission: to boldly split infinitives!
Their Shadows come again. --Delenn.
Their are Beta wave types others are Alpha Wave, but I love the Blues
Their are thre things wrong here.
Their are trhee things wrong hear.
Their are trhee things wrong here.
Their company loves misery.
Their experiment needed a new test case - MST3K04
Their faces' really worn out their welcome - Mike
Their hair all came outta the same mold - Tom
Their horses will poop on the parking lot - Tom sings
Their is NO suitable tagline when speaking about CONGRESS
Their island just turned into stock footage - Tom
Their kind is the reason there are no wolves left in Ireland.
Their orgasms hit, in a siMadokataneous peak. - r.a.a.stories scandal
Their pants are missing! - Crow
Their sex was so good even the neighbors lit cigarettes!
Their success is not"flattering about America"TIME on Limbaugh & Stern
Their such a fastidious couple She`s fast an he`s hideous
Their talk is cheapened by the double-tongue.... --Ten Bears.
Their throats tighten with apprehension - Mike
Their very silence is a loud cry. - Cicero
Their war is going to tear this galaxy apart. - Richard Franklin
Theives Do It Furtively
Theives do it with dexterity.
Thelemites DO IT 93 ways!
Thelemites do it at Will
Thelma & Luigi! - Tom on couple in car
Them Bots! Them Bots! Them Dry Bots! - Joel sings
Them bats is smart, they use radar.
Them hogs is startin' to get a little intense up here.
Them people back there, they weren't normal. <Papa>
Them that can does, them that can't RTFM.
Them that has the taglines make the rules.
Them what can, do; them what can't, hire them what can.
Theme song of John Bobbitt's doctor: Try to Re-Member.
Themostdifficultproblemwiththe!!
Themosthorrendouslydifficultproblemwithrecipesisfindingenoughspace!!
Themosthorrendouslydifficultproblemwithtaglinesisfindingenoughspace!!
Then Adam said "What's a headache?"
Then Amber looked at the Tyrannosaur and screamed.
Then Came Moron - Crow on cycle guy
Then Danny looked at the Tyrannosaur and screamed.
Then Doctor, this will be your one chance to get away from it all ..
Then God be blessed, it is the blessed sun..
Then God didst say "Noah, build ye an ARJ."
Then God said, "Let there be light -- bloody hell! Did I create this?"
Then God said: "Go forth and kick butt!"
Then I caught Lt. Zier and Commander Long.
Then I felt it for the first time: another Immortal. - Duncan MacLeod
Then I get afraid of what that could bring.
Then I joined the Crash Test Dummies - Crow as Caradine
Then I killed him & he died - Tom
Then I killed him & he got dead - Tom
Then I saw those black lace panties and I knew that it was you!
Then I thought, `Neat. Land piranha's!' -- Jack Butler
Then I watched her hands of leather, turn to velvet in a touch
Then I will exploit the dylithium crystals! - Evil Tom
Then I'll see you in hell! Yah! - Han
Then I'm Mr. Glac-a-wick-tz. You mean DR Galacawicz? Yes-I-aam!
Then I'm Mr. Glack-a-week-ich. You mean DR. Galacawicz? Yes-I-am!
Then Jeff caught the measles trying to get spots like a Trill.
Then Judy looked at the Tyrannosaur and screamed.
Then Lancelot, Robin and I will jump out of the Rabbit.
Then Losira appeared and said, I am for you, Orville Bullitt.
Then Losira appeared and said, I am for you, Orville.
Then Mary looked at the Tyrannosaur and screamed.
Then Orville let out the dove to see if the waters were receding. Gen 8:
Then Orville said masturbation. huh huh huh
Then Q met Lorena - after which he was known as O.
Then Vampyra appeared and said, "I am for you, @FN@."
Then Vampyra appeared and said, "I am for you, YOU."
Then a mournful smile; always pale and hungry, <Lew Romney<
Then a shot rang out and barney hit the floor, no more purple dinosaur
Then again, I could be chasing an untamed ornithoid without cause.
Then again, I could be completely wrong...Nahhh!
Then again, I obviously have a feeble grasp of army protocol.-Mulder
Then again, all good things must come to an end. - Q
Then again, maybe they have :-)
Then again, there are those of us who actually find it funny!
Then at a deadly pace It Came From Outer Space...
Then badabingbangboom, my wing is introduced to radial tires! -- Bobby
Then cycle power and try it again.
Then die in ignorance! --Worf.
Then die in ignorance. I can waste no more time on you.
Then do the pelvic thrust.
Then don't fool with the dustbuggers; mess with these...
Then get rid of that damned twitch! - Picard
Then go to her door and beg like a human. -- Worf
Then he poured a beer in his hand and got his date drunk.
Then he said 'masturbation'! - Beavis
Then he said 'penis'! - Butthead
Then he said 'vagina'! That was cool! - Butthead
Then he wrinkled his noses and raised his eyebrow...
Then is Doomsday near? - Shakespeare
Then it MUST be an AT&T 6300! One of the least IBM-compat
Then it would RULE! -- Butthead
Then it's agreed. We'll do a hysterectomy on Maj. Burns. - Hawkeye
Then lobbest thou thy Holy Hand Grenade towards thy foe..
Then lobbest thou thy Holy Hand Grenade towards thy foe...
Then my initial assumption was correct! -Data
Then mysteriously -- NO DICK!! - Crow on Van Patten
Then shalt thou count to three. No more, no less.
Then shalt thou count to three. No more, no less.
Then she appeared - apple venus on a half-open shell.
Then she gave me a Vegemite sandwich and I dropped dead.
Then she said masturbation. That was cool. huh huh huh
Then she said masturbation. huh huh huh
Then sings my soul, my Savior God, to thee, How great thou art!
Then somebody spoke, and I went into a dream....
Then something went wrong for Fay Wray and King Kong
Then something went wrong for Fay Wray and King Kong...
Then suddenly and embarrassingly, my swash came unbuckled!
Then suddenly it starts to get weird. The rules change.
Then that southern whiskey began to fog my mind. -L. George
Then the Swedish Bikini Team arrived and things improved.
Then the internet is not for you.!!!
Then the socket packet pocket has an error to report!
Then there was the Formosan bartender named Taiwan-On.
Then there was the workaholic who was arrested for resisting a rest...
Then there's my virgin classes - Mike as girl
Then there's the model who sat on a broken bottle and cut a good figure.
Then they inserted this Alien into him +Ca#aXNO CARRIER
Then they'd eat me afterwards.. what else can you ask for?
Then this moon is a penile colony - Picard
Then this village will cease to exist -- Dax
Then we have number four. Number four: Crunchy Frog.
Then we sat on the sand for some time and observed.....
Then wisdom and sagacity are born, along with hypocrisy. - Lau
Then you are cast...into the Gorge of Eternal Peril!!!
Then you die on the table, and we spend eternity together.
Then you have abandoned, what I have sought all my life.
Then you will play for the honour of your ship - Kolrami
Then, after a second or so, nothing continued to happen. - HGTTG
Then, hit ENTER and enjoy the tour.
Then, kill, kill, kill, kill, kill, kill!
Then, quite suddenly, I realised life was hilarious :)
Then, quite suddenly, I realized life was hilarious :)
Then, suddenly and embarrassingly, my swash came unbuckled ...
Then, we slaughter 'em! - Crow as farmer on cows
Then, where are MY taglines?
Theological terrorists have 9mm Bibles in their socks.
Theology is a branch of Physics.
Theorem I - The universe is a figment of its own imagination.
Theoretical Physics is a science locally isomorphic to Mathematics.
Theoreticians DO IT with a proof.
Theories are always better than explanations.
Theories cannot be proven...only disproven.
Theory of relativity: If you go back far enough, we're all related.
Theory of relativity: If you go back far enough, we're all related!
Theory: A hunch with a college education.
Theory: the rings of Saturn are composed entirely of lost luggage.
Theory: when you have ideas. Ideology: when ideas have you.
Therapeutic Tagline
Therapists are expensive, but friends -- long as you PAY!
Therapy helps, but screaming obscenities are cheaper.
Therapy helps, but screaming obscenities is cheaper, Captain!
Therapy helps, but screaming obscenities is cheaper.
Therapy is nice, but shouting obscenities is cheaper.
Therapy is not a luxury.
There *are TRIBBLES on boa*rd *t*his tagl*ine!
There *is* a use for Atog... kindling!
There *is* intelligent life on Earth, but I leave for Texas on Monday.
There *is* no justice; just mercy.- Duncan MacLeod
There *must* be a God. What else explains Leather Miniskirts?
There *were* Martians. The Viking landers squashed *both* of 'em.
There ARE no nice compters.
There Are More Horses' Rear Ends Than Horses
There Are No More Metaphors
There Dan goes again....totally disregarding reality...
There Dwight goes again, confusing me with real life!
There Gary goes again, confusing me with real life!
There He Is, Mister Fish Talk! - Ren.
There I go talking to myself again.
There IS Safety in numbers! For Example .357, .44, .45
There IS intelligent life in the universe It ignores us
There IS intelligent life in the universe. It ignores us.
There IS intelligent life in the universe. It's ignoring us.
There IS intelligent life in the universe. It ignores us.
There IS order to MY Chaos
There Is No Land Unhabitable, Nor Sea Unnavigable -- Richard Harluyt.
There Is No Such Thing As A Well-Adjusted Slave!
There MUST be a God. What else explains Leather Minis?
There MUST be a God. What else explains Speedos?
There MUST be a God. What else explains leather mini's?
There Myra goes again.totally disregarding reality
There Orville Bullitt goes again, confusing TV with real life!
There Orville Bullitt goes again, confusing me with real life!
There Orville goes again, confusing TV with real life!
There Orville goes again....totally disregarding reality...
There R 2 ways 2 write error-free programs,the 3rd works.
There REALLY IS a BBS called "This BBS Sucks!" <G>
There SURE was a lot of wrestling in this movie - Mike
There Tika goes again....totally disregarding reality...
There WAS a traitor.. Now she is gone! Nice job JMS!
There _is_ sex after death; you get laid in the coffin.
There a threat to Humanity, and they always will be. - Richard Franklin
There actually is a solar powered flashlight, you know.
There ain't no cure for the summertime blues - The Who
There ain't no cure for the summertime blues.
There ain't no place that I'd rather be - next to you, next to me.
There ain't no rules around here! We're trying to accomplish something!-T.Edison
There ain't no such thing as Texas, it's really Baja Oklahoma!
There ain't no such thing as a free launch.
There ain't no such thing as a free lunch.
There ain't no such thing as a free lunch. L. Long
There aint nothin wrong with the radio
There are *reasons* why eating out is better than cooking!
There are 10,000 unwanted pets in YK. Eat a cat today.
There are 100,000 unwanted pets in Nanaimo. Eat a pussy today.
There are 1001 uses for a dead cat and I know 'em all.
There are 12,332 people here. Dog pile on Bob! <g<
There are 2 Sides to Every Argument
There are 2 kinds of people: pessimists and fools....
There are 2 snakes in Hawaii, both males, in the Honolulu Zoo.
There are 2 theories on arguing with a woman, and neither one works.
There are 2 theories on arguing with a woman...(But neither work!)
There are 2 types of people: Weasels and Weasel-Slappers!
There are 2 types of people: Those who can remember things.
There are 2 ways to handle women and I know neither.
There are 2 ways to write error-free programs. Only the third one works.
There are 2 ways to write error-free programs... The third one works.
There are 3 absolutes: Death, Taxes and P.M.S.
There are 3 kinds of people - those who can count and those who can't.
There are 3 kinds of people: Those who can count & those who can't.
There are 3 kinds of people: Those who can count & those who can't.
There are 3 possibilities: The solar panel has turned from the sun; a me
There are 3 types of people: Those who can count and those who can't.
There are 44 sounds in the English language, but only 26 letters!
There are 5 lights, but one is burned out.
There are 50,000 unwanted pets in NZ. Eat a cat today.
There are 548 peanuts in a 12 oz. jar of peanut butter.
There are 8 potatoes, Mrs. Jewls. - Joe No, there are 8. - Mrs. Jewls
There are FOUR lights! Picard/COC, Part II
There are Monkey Boys in the facility!
There are NO civil rights for the Technological Minority...
There are NO lemurs in this movie! - Tom
There are Nodems in the land of Nod, only Repubs.
There are Satanic messages in the preceding message.
There are TWO 'B's in BBS, not one....
There are [tax] increases for every family. New York Times.
There are _never_ enough bookshelves
There are _no_ absolute statements. Not even this one.
There are a lot of hot arguments over "cold cash."
There are a lot of lies going around.... and half of them are true.
There are a thousand languages, but a smile speaks them all.
There are about 550 hairs in one eyebrow..
There are always alternatives.
There are always alternatives. - Spock
There are always at least two ways to program the same thing.
There are always bozos with guns...more than willing to ruin our day.
There are an awful lot of skinny people in the cemetery.
There are approximately 12 cockroach heads per fig newton.
There are birds in the trees, Tom said swiftly.
There are certain givens... sex, love, wealth and power. - Rourke
There are certain things men must do to remain men.
There are days I'm glad I don't have to think the way you do!
There are diversities of gifts, but the same Spirit. - 1 Cor. 12:4
There are drugs named after us.
There are exceptions to every rule, and I'm one of them. - Forrest Gump
There are few privileges without responsibilities.
There are few problems that can't be solved by high explosives.
There are few problems that cannot be solved with high explosives
There are glitches in Fidonet!
There are gods in the mirror.
There are good five-cent cigars, but they cost two bits.
There are good people everywhere - even at Social Services-Nick Knight
There are good times ahead for you.
There are greater gifts than Immortality. - Kalas
There are humans for whom the words Never Again carry special meaning.
There are just some parts on your body you can't replace! - John Bobbitt
There are just to many children to list from this line...
There are laws saying Beer labels can't lie to you.
There are lazy minds as well as lazy bodies.
There are lies, damn lies, and Democrat promises
There are lies, damn lies, and Democrat statistics
There are lies, damn lies, and Liberal Socialists.
There are lies, damn lies, and environmentalists.
There are lies, damn lies, and statistics. --Samuel Clemons
There are lies, damned lies, and Bill Clinton!
There are lies, damned lies, and benchmarks!
There are lies, damned lies, and statistics -- Mark Twain
There are limits to my knowledge. - Mr. X
There are limits to the limits with which one can live.
There are many among us who feel life is but a joke - Hendrix
There are many intelligent species in the universe. They all own cats
There are many intelligent species in the universe. They all own cats.
There are many kinds of people in the world. Are you one of them?
There are many things I could say...
There are many ways to handle a woman... I don't know any of them...
There are many ways to handle women. I don't know any.
There are many ways to handle women. I don't know any of them.
There are many ways to handle women. I don't know any.
There are many ways to show affection.
There are millions of people who should not be Unitarians.
There are millions of stories in the Naked Echo.
There are more Indians alive today than ever. - LIMBAUGH
There are more bad musicians that there is bad music.
There are more dead than living and they are increasing.
There are more fish taken out of a stream than ever were in it.
There are more fools in the world than there are people.
There are more horse's asses than there are horses.
There are more horses' asses in Washington than anywhere else.
There are more horses' asses in this world than there are
There are more idiots than ways to idiot-proof anything.
There are more important things to do than wiggling your posterior.
There are more of us lurking here than you realize.
There are more of you than previously.
There are more old drunkards than old doctors.
There are more phones than people in Washington DC.
There are more things in Heaven and Earth, Horatio...
There are more ways of killing a cat than buttering it with parsnips
There are more ways of killing a cat than choking her with cream.
There are never any bugs you haven't found yet.
There are no "Anglo-Saxon" food booths at foreign culture exhibits.
There are no "First Amendment" rights on FidoNet.
There are no "Scots-Irish" food booths at foreign culture exhibits.
There are no Aussie food booths at foreign culture exhibits.
There are no ESC keys on prison PCs.
There are no Escape keys on prison PCs.
There are no OS/2 viruses. Nobody writes _ANYTHING_ for OS/2.
There are no OS/2 viruses. Noone writes _anything_ for OS/2.
There are no Scots-Irish food booths at foreign culture exhibits.
There are no Shadows in Amber.
There are no absolute answers to life - just revelations.
There are no absolutes...and I believe that absolutely!
There are no answers at best a few possibly good guesses.
There are no answers, at best JUST a few possibly good guesses.
There are no answers, only a few good cross-references.
There are no answers, only cross-references
There are no answers, only cross-references.
There are no answers. At best a few possibly good guesses.
There are no atheists in foxholes. - I've heard that. - Mulcahy
There are no atheists in hell.
There are no atheists in the bottom of a foxhole.
There are no atheists in the foxholes.
There are no athiests in hell.
There are no bugs, only unrecognized features.
There are no bugs, only unrecognized features.
There are no conspiracies! "We" won't allow it.
There are no convenient crises.
There are no dangerous weapons, only dangerous men.
There are no dead. -- Maeterlinck
There are no dirty words, only suggestive ones.
There are no edges. Only the places where things meet.
There are no errors in this book, except this one.
There are no facts, only interpretations.
There are no facts, only interpretations. - Friedrich Nietzsche
There are no facts, only interpretations.<Nietzsche>
There are no games on this system.
There are no giant crabs in here, Bob.
There are no giant crabs in here, Frank.
There are no giant crabs in here, Orville.
There are no giant crabs in here.
There are no hugs like Bear Hugs.
There are no lawyer jokes, they are all true.
There are no limits for journeys of the mind.
There are no loopholes in the chivalry code..I checked! =) -Tristessa
There are no mistakes in the kitchen -- just lessons!
There are no mistakes in the kitchen, only lessons.
There are no mistakes, only learning opportunities.
There are no moral messages in nature.
There are no more I/O operations to do today, Tom disclosed.
There are no more bugs. ///\oo/\\\ ///\oo/\\\
There are no more bugs. ///\oo/\\\ ///\oo/\\\///\oo/\\\
There are no more nits, for thou hast picked them all.
There are no more than 255^57 possible taglines.
There are no new taglines, only recycled ones.
There are no rules in this game, except one and that is to win.
There are no rules. - Kalas
There are no shortcuts to any place worth going.
There are no simple answers, only big challenges
There are no skeptics in hell.
There are no stupid questions - just stupid answers!
There are no stupid questions, except for the ones YOU ask!
There are no stupid questions, except for the ones you ask.
There are no stupid questions, just stupid answers.
There are no stupid questions, only stupid answers.
There are no teachers -- only students.
There are no ugly women, only ugly men.
There are no unimportant acts of kindness.
There are no unimportant acts of kindness..
There are no winners in life - only survivors.
There are no winners in life; only survivors.
There are no words to explain a cat except "A bundle of care & love"
There are none of you, good doctors, who could cope with my family...
There are none so blind as those who will not see.
There are none so foolish as those that will not learn.
There are nuts in my family tree!
There are old pilots and bold pilots. But very few old, bold pilots.
There are only 2 kinds of faultless men--the dead and the deadly.
There are only 2 perfectly good men: 1 dead, the other unborn. Mae West
There are only 3 lawyer jokes - the rest are fact!
There are only 3 lawyer jokes, the rest are true stories.
There are only 3 things you can grow in MN - colder, older and fatter.
There are only 3 things you can grow in YK - colder, older and fatter.
There are only 44 sounds in the English language?
There are only TWO lawyer jokes. The rest are true.
There are only three lawyer jokes. The rest are facts.
There are only two emotions in Wall Street: fear and gree
There are only two emotions in Wall Street: fear and greed.
There are only two kinds of users, Moderators and targets.
There are only two seasons in Florida: Tourist and Road Construction.
There are only two seasons in Hawaii: Tourist and Road Construction.
There are only two sizes....adequate and inadequate.
There are only two things I believe in: everything and nothing.
There are only two things that I believe: everything and nothing.
There are only two things that I know: everything and nothing.
There are only two things that I want: everything and nothing.
There are only two things that are real: everything and nothing.
There are only two things that are true: everything and nothing.
There are only two things that exist: everything and nothing.
There are only two things that exsist: everything and nothing.
There are other ways to challenge oneself? - Data
There are patriotic Americans and then there are liberal democrats.
There are people who have been born killers who have never killed.
There are performance improvements, and they are very minor.
There are pleanty of businesses like show business...
There are plenty of businesses like show business
There are plenty of businesses like show business - Bart Simpson's lines
There are plenty of businesses like show business -Bart Simp./Epis. 1F19
There are plenty of businesses like show business. --Bart Simpson.
There are skeletons at the bottom of my garden!
There are so dragons! 'Round here, we call'em gaters!
There are so dragons! Here we call 'em gators!
There are so dragons! 'Round here, we call'em gaters!
There are so many drinks that are yet to be drunk.
There are so many upgrades, I am bankrupt.
There are so many.... I'm saving a hard time choosing. --Mulder.
There are some defeats more triumphant than victories.
There are some parts on your body you can't replace! - John Bobbitt
There are some remedies worse than the disease. - Syrus
There are some strings. They're just not attached.
There are some things I can't do. I can't make you as good as I am!
There are some things even *Cowboys* won't eat!
There are some things worth dying for.
There are some things worth dying for. - James Tiberius Kirk
There are some things worth dying for. Kirk, Errand of Mercy, stardate
There are some who call me . . . Tim . . .
There are some who call me...Orville...
There are some who speak one moment before they think.
There are sore losers, REALLY sore losers, & Republicans
There are sore losers, pretty women, and Idiot Liberals
There are sparks coming out of the printer. Is that normal?
There are such things as monsters. -- Belle, Bone Gnawer
There are things rats won't do that lawyers will.
There are things that are never forgotten! (Bozart)
There are things that are so serious that you can only joke about them
There are things which we do not understand, they exist nonetheless.
There are things which we do not understand, yet they exist nonetheless.
There are things which we do not understand, yet they exist..
There are thinkers and there are doers. I think I need a doer.
There are those who say life is an illusion - Chucky Grey
There are those who say, that life is an illusion.
There are thre erors in this tagline.
There are three cases: UPPER CASE, lower case and brfcs.
There are three erors in this sentance.
There are three kinds of lies: Lies, Damn Lies, and Statistics.
There are three kinds of lies: Lies, Damn Lies, and Statistics. -- Disraeli
There are three million stories in the Naked Space Station.
There are three misteaks in thes tagline.
There are three sages in a man's life: STUD - DUD - THUD.
There are three sexes: males, females and girls.
There are three things that come next, uh four.
There are three things that come next, uh four...
There are three things that last, faith, hope and love....
There are three types of people: one who can count, and one who can't.
There are times and places when tact is entirely misplaced.
There are times when I long for a Klingon woman -- Worf
There are times when I long for a Klingon woman. * Worf
There are times when silence has the loudest voice.
There are times when you can't let the right thing stand in your way.
There are times, Pinky, when I question our friendship. -Brain
There are tiny bugs in the dust, Tom said mightily.
There are too many tight-ASCII characters in this echo
There are truths which can kill a nation.
There are two castes of Mimbari, the Warrior & the Religious. - Delenn
There are two castes of Minbari, the Warrior & the Religious. --Delenn.
There are two error in this sentence.
There are two kinds of egotists: 1) Those who admit it 2
There are two kinds of people in the world -- human and nonhuman.
There are two kinds of women - goddesses and doormats. - Pablo Picasso
There are two kinds of women, Bitches and those who like chocolate.
There are two reasons for doing: one good, the other real
There are two sides to a question, politicians take both.
There are two sides to every question. Protagoras(410 BC)
There are two solutions - hardware or software.
There are two times I feel stress--day and night.
There are two types of Davidians. Regular and extra crispy.
There are two types of people in this world, and I ain't either one.
There are two ways to handle women, and I don't know either
There are two ways to handle women, and I know neither.
There are two ways to handle women. I don't know either one.
There are two ways to write error-free programs. Only the third one works.
There are two ways to write error-free programs; only th
There are two ways to write error-free programs; the third one works.
There are two ways to write error-free programs; only the third one works.
There are umpteen imaginary numbers.
There are unguarded entrances to any human mind.
There are vampires out there!
There are worse occupations than feeling a woman's pulse.
There are worse things than dying. - Kalas
There area three stages in a man
There aren't any hard women, just soft men. - Raquel Welch.
There aren't enough O's in Smoooooooth to describe it...
There aren't enough days in the weekend.
There aren't enough guns in the world to make socialism work.
There aren't enough scoundrels in your life. - Han Solo
There be dragon's here.
There be teleporters here -- no, over there! Wait, behind you! No --
There but for the grace of God go I.
There can _be_ no "appropriate recipe" for this post.
There can _be_ no "appropriate tagline" for this post.
There can be no justice when laws are absolute. - Picard
There can be no rainbow without a cloud and a storm.
There can be no twisted thought without a twisted molecule. -- R. W. Gerard
There can be only NONE! Er, waitaminnit...
There can be only fun - BORGO the Clown
There can be only fun with BORGO the Clown.
There can be only fun! - Kurgan the Clown
There can be only one Collective! -- Highlander of Borg.
There can be only one! - Duncan MacLeod
There can be only one! Remember *that* rule? - Connor MacLeod
There can be only one.
There can be only one. It might as well be me. - Kenny
There can never be a computer language in which you cannot write a bad program.
There can never be too many recipes, just too much blank space.
There can never be too many taglines, just too much blank space.
There can't be a crisis next week--my schedule is already full
There cannot be a crisis next week. My schedule is already full.
There cannot be a crisis today; my schedule is already full.
There comes a time in every man's life, and I have had many.
There doesn't seem to be a Klingon word for jolly - Troi
There exist minds which think as well as you do, but differently-Niven
There exist minds which think as well as you do, but differently. - l.n.
There go my people. I must follow for I am their leader.
There go my scouts; I must follow for I am their leader.
There goes Bill!
There goes Jon Glenn, bringing up *dead issues* for consideration.
There goes Orville Bullitt, bringing up *dead issues* for consideration.
There goes a great tennis player - Mike as guy dies
There goes my heart breaking in two.
There goes my people. I have to follow them, I'm their leader.
There goes my vacation - Gypsy
There goes one HELLUVA Nun! - Tom
There goes our 3 bean salad. - Dot
There goes the Bursor again, whos got the dried frog pills
There goes the bursar again, who's got the dried frog pills?
There goes the dumbest cowboy you'll ever meet - Tom
There goes the last of the bottled water--&!@#_)$#*% NO PERRIER
There has to be a better answer somewhere---- :)
There hoping soon my kind would drop and die. Hendrix
There is *NOTHING* we can do to make God love us more. - Tom Correll
There is *nothing* latent in my voyeuristic activities... :) - TEC
There is 24 hours in a day! Only 1 is Called Happy Hour!
There is ALWAYS a chance! - Worf
There is ALWAYS an easier way to solve a problem !!
There is History in our Roots!!!
There is NO SUCH THING as "reverse discrimination."
There is NO known antee-dote - Crow
There is No Reality Here!!.............Just Imagination, Oh Boy!!
There is a 500 point penalty for striking Morn with the darts.
There is a 70% probability of tomorrow. (actual weatherman quote. 1988)
There is a GUI that *RUNS* on a 286 - GEOS!
There is a God and you are not Him!
There is a God. And you aren't him.
There is a Nietschze near dupe in there that starts with Convictions.
There is a PLOT afoot to make me PARANOID!
There is a Vulcan proverb -- only Nixon could go to China.
There is a balm in Gilead to make the wounded whole....
There is a bear following you around.
There is a black lining in every silver cloud.
There is a bologna in my carburetor. -The Pope to Clinton -Dave Barry
There is a certain light within a man of light.
There is a copy on this board.
There is a dangerous TagLine shortage today. Please, recycle TagLines.
There is a devil sleeping in my bed - NIN
There is a devil sleeping in my bed.
There is a difference between an open mind and a hole in the head.
There is a fine line between 'witty' and 'moronic'.
There is a fine line between creative genius and insanity.
There is a first time for everything!
There is a flaming gash in the sky.
There is a fungus among us!!!
There is a grace of kind listening as well as a grace of kind speaking.
There is a great disturbance in the Force. -- Emperor Palpatine
There is a green, multi-legged creature crawling on your shoulder.
There is a hole in your mind.
There is a hole in your mind. --Babylon 5.
There is a holy mistaken zeal in politics as well as in religion.
There is a law for every Occasion!!
There is a moderator in the ANARCHY Echo but he never does anything.
There is a multi-legged creature crawling on your shoulde
There is a multi-legged creature crawling on your shoulder. - Spock
There is a natural hootchy-kootchy to a goldfish. -- Walt Disney
There is a plot afoot to make me think I'm paranoid!
There is a remedy for everything; it is called death.
There is a rumor going around that Star Trek is just a TV show!
There is a skeleton in every old house and old horse.
There is a skeleton in every old house.
There is a storm coming, a black and terrible storm. --Elric.
There is a substitute for good manners - better reflexes.
There is a time and place for tact. - Larry Niven (But this AIN'T it!)
There is a time and place for tact. --Larry Niven.
There is a tiny plant here, murmuring "water, water"
There is a tiny plant here, murmuring "water, water".
There is a vas deferens between men and women!
There is a vas deferens between men and women.
There is a very superficial physical resemblence, but that is it.
There is a voter born every minute. -- P.T. Clinton
There is absolutely no right way to do a wrong thing.
There is absolutely no substitute for a genuine lack of preparation.
There is allways a way, and it usually is mined.
There is always a better way, our challenge is to find it.
There is always a big future in computer maintenance.
There is always a law against doing anything interesting.
There is always a mistake just waiting for you to make.
There is always a way, and it usually doesn't work.
There is always a way, and it usually is mined.
There is always a way.
There is always an easier way to do it.
There is always danger for those who are afraid of it.
There is always free cheese in a mousetrap.
There is always free cheese offered inside the Liberal tax trap.
There is always one more bug.
There is always one more imbecile than you counted on.
There is always someone within us whom we enchain..
There is always someone worse off than yourself.
There is always tommorrow - Darkwood
There is an absolute truth, but language fails miserably.
There is an audience to our drama. --Jim Morrison
There is an easy answer to your problem that is neat, pla
There is an exception to every rule, except this one.
There is an express door in Hell just for priests and preachers.
There is an historic opportunity here. Spock/STVI
There is an order of things in this universe-Who Mourns For Adonis?
There is an order of things in this universe.
There is an order of things in this universe. Apollo, stardate 3468.1.
There is another basic shortage on our planet. - Martin, V
There is another way of looking at the world.
There is beauty in the bellow of the beast. W.S. Gilbert
There is comfort in the fact that God can never be taken by surprise.
There is enough guilt in the world without reaching for more - Ivanova
There is good sex and there is bad sex but chocolate is always chocolate.
There is help available that doesn't cost.
There is hope for you. Metron to Kirk
There is hope, for Medicine can cure all, even Worf'.
There is independence and charity in a full stomach.
There is intelligent life on Earth, but I'm just visiting.
There is intelligent life on Earth, but we are just visit\SLM
There is intelligent life on Earth, but we are just visiting.
There is intelligent life on Earth...just ask a moderator.
There is intelligent life on earth, but I'm just visiting
There is iron in your words of death--Ten Bears.
There is just too damn much going on in this conference!
There is less pressure with a pneumatic girlfriend
There is life after DOS, but it isn't Windows!
There is life after DOS...and it isn't MS Windoze!
There is life after death: in Cleveland, people are still
There is life, there is death. In between is a blood stained cross.
There is more at stake here than our lives.
There is more at stake here than our lives.-Col Travis (Alamo Pep Talk)
There is more than one way to purify the soul.
There is more to life than increasing its speed. <Gandhi>
There is more to reality than meets the eye
There is more to reality than meets the eye.
There is much Obi--Wan did not tell you.
There is much Obi-Wan did not tell you.
There is much Obiwan did not tell you.
There is never a need to outrun anything you can outwit.
There is never enough beer, sex or disk space!
There is never enough disk space, beer, or sex!
There is never enough rum, sex, or disk space!.
There is never time to do it right, but always time to do
There is never time to do it right, but always time to do it over.
There is never truth without sufficient proof.
There is news.
There is no "A" in "KERNEL"!
There is no 'he' or 'she' in a race with no gender -- Soren
There is no DURIAN in this tagline.
There is no Dana, only ZUULL.
There is no God! He just thinks he's there!
There is no Minnie Mouse... it's just Mickey in drag.
There is no Power like Firepower.
There is no Windows software;only WINOS2 software
There is no X in ESPRESSO.
There is no XXXXXXX place for censorship!
There is no appeal. The sentence is just. - Robert A. Heinlein
There is no atheists in any foxholes.
There is no bad beer: some kinds are better than others
There is no beauty like that of black coffee.
There is no benefit in the gifts of a bad man. Euripides
There is no body-checking in golf! - Charlie Brown
There is no bottom to worse. -- Cohen
There is no cause for alarm ... but there will be.
There is no cause for alarm! But there probably will be. - Brain
There is no cause for alarm! But there probably will be. - The Brain
There is no coming to consciousness without pain. - Carl Jung
There is no conclusive scientific evidence that life is serious.
There is no conversation more boring than where everyone agrees.
There is no criminal class. Except Congress.
There is no cure for birth & death, save to enjoy the interval.
There is no cure for birth and death save to enjoy the interval.
There is no dark side of the moon really. Matter of fact, it's all dark
There is no dark side of the moon, really.
There is no dark side of the moon. Really.
There is no death so nothing matters. --Jim Morrison
There is no death, only a change of worlds.
There is no death; there is only the Force.
There is no death; there is the Force - The Jedi Code
There is no defense except stupidity against a new idea.
There is no detox for BBS addiction.
There is no devil; it's God when he's drunk.
There is no door that will stop a lover or a cat.
There is no doubt pets have souls...only they deserve them.
There is no education in the second kick of a mule.
There is no education without books.
There is no eel so small but it homes to become a whale.
There is no elevator to success. You must take the stairs.
There is no emotion; there is peace - The Jedi Code
There is no emotion; there is peace.
There is no empirical evidence to support the existence of tailwinds.
There is no end to this sequence of digits, said Tom irrationally.
There is no escape-we pay for the violence of our ancestors. Muad'Dib
There is no escape. But to die. - Narn
There is no excuse for laziness, but I'm working on it.
There is no fear in love. But perfect love drives out fear.
There is no fear in love; but perfect love casteth out fear.
There is no fool like an old fool. J.Heywood (1497-1580)
There is no forgiveness. -- Wisetongue, Get of Fenris
There is no future in time travel
There is no future in time travel.
There is no future. There is no past. - Sara Carter
There is no god, it's just satan when he's sober!
There is no gravity, the Earth sucks.
There is no gravity, the earth sucks.
There is no gravity--The earth sucks!
There is no gravity. The earth sucks.
There is no gravity. The Earth sucks.
There is no greater asset than a sense of humor!
There is no happiness when there is no hockey.
There is no happiness where there is no wisdom. Sophocles
There is no happiness where there is no wisdom.<Sophocles>
There is no heroine, sir...unless it is our Mother Tongue. -Dr.Johnson
There is no hiding from a verbal shotgun.
There is no honor in attacking the innocent. -- Hand of Tyr
There is no honor in boring an enemy to death.
There is no honor in boring an enemy to death. --Worf.
There is no honour in being Bajoran. <WHACK!> Uh,let me rephrase that.
There is no idea so stupid that some professor doesn't believe in it.
There is no ignorance; there is knowledge - The Jedi Code
There is no ignorance; there is knowledge.
There is no insanity, just different views of reality
There is no instinct like that of the heart.
There is no job so simple that it cannot be done wrong.
There is no joy in Mudville, mighty Casey has struck out.
There is no knowledge that is not power
There is no lawyer who cannot take two sides.
There is no lifeguard in the gene pool.
There is no limit to how bad things can get.
There is no little enemy. --Franklin.
There is no love sincerer than the love of food.
There is no man so blind as he who will not see.
There is no man so blind as he who will not see.- Moody Blues
There is no medicine to cure hatred.
There is no more independence in politics than there is in jail.
There is no more mercy in him than there is milk in a male tiger
There is no more time. Leave, or be trapped here - forever.
There is no need to seek truth, only stop having views. -SENG TS'AN
There is no need to visit a mad-house to find lunatics.
There is no net like The Internet!
There is no night in deep space, and time is a meaningless concept
There is no one. Except you. My good, close friend, Garibaldi. - Londo
There is no opinion so absurd that some philosopher will express it.
There is no pain without gain.
There is no passion; there is only serinity.
There is no passion; there is serenity - The Jedi Code
There is no patriotic art and no patriotic science. - Goethe
There is no place for compliancy in a Republic.
There is no point in beating a dead horse.
There is no politically correct word for "booger".
There is no problem a good miracle can't solve.
There is no problem so big that you can't walk away from it.
There is no problem that cannot be solved by high explosives
There is no problem that cannot be solved by high explosives.
There is no problem that, when programmed just right, isn't more complicated.
There is no reason for any individual to have a computer in his home.
There is no reason that I can think of to have seperate databases.
There is no recipe to see here; please disperse! - Odo
There is no record in human history of a happy philosopher.
There is no religion when a man has a decent sailboard under him.
There is no remedy for fun but more fun!
There is no remedy for sex but more sex.
There is no remedy for sex, except more sex.
There is no restraint that is not self-imposed.
There is no revenge so complete as forgiveness.
There is no revenge so sweet as forgiveness.
There is no right to life if money decides who lives and dies.
There is no room.
There is no sadder sight than a young pessimist.
There is no safe seat at the feast.. RUSH Anagram
There is no satisfaction in hanging a man who does not object to it
There is no satisfaction in hanging a man who does not object.
There is no security on this earth. There is only opport
There is no sin except stupidity.
There is no sincerer love than the love of food. - Shaw
There is no sincerity like a politician telling a lie.
There is no snooze button on a cat who wants breakfast.
There is no statement so absurd that no philosopher will say it. -Cicero
There is no statute of limitations on stupidity.
There is no stopping in the read zone.
There is no substitute for Brute Force and Ignorance!
There is no substitute for a genuine lack of preparation.
There is no substitute for a genuine lack of preperation
There is no substitute for good manners - except fast reflexes.
There is no substitute for good manners, except, perhaps, fast reflexes.
There is no substitute for incomprehensible good luck!
There is no such book, and never has been.
There is no such thing as "best" in a world of individuals.
There is no such thing as "just a Cat".... -RAH
There is no such thing as UUCP access to the Internet!
There is no such thing as `just a cat'. -- Heinlein
There is no such thing as a "Fail Safe" design.
There is no such thing as a "free" cat.
There is no such thing as a bloody Cat License.
There is no such thing as a dumb question.
There is no such thing as a free cat.
There is no such thing as a little garlic.
There is no such thing as a new Democrat!
There is no such thing as a stupid question, right?
There is no such thing as a successful prototype.
There is no such thing as a useless piece of information.
There is no such thing as an ordinary cat.
There is no such thing as an original tagline anymore.--Jack Butler
There is no such thing as bravery; only degrees of fear.
There is no such thing as bravery; only degrees of fear.
There is no such thing as fortune. Try again.
There is no such thing as gravity; consider it a hug from Gaia.
There is no such thing as idiot-proof software!
There is no such thing as just a cat. -- Heinlein
There is no such thing as peace. -- Wisetongue, Get of Fenris
There is no tagline that really fits this situation...
There is no tagline to see here; please disperse! - Odo
There is no time like the pleasant.
There is no time like the present for postponing what you ought to be doing.
There is no traffic until you need to make a left turn.
There is no truth to the rumor CompuServe is changing it's name to CompuNerd.
There is no truth wiout proof!
There is no truth without proof.
There is no try. There is only do. Or do not.
There is no use crying over distilled milk. (My Grandson)
There is no vaccine against stupidity.
There is no valid way of estimating this.
There is no weather sir, we're on a ship. - Riker
There is no world.
There is not freedom in the law, only oppression!
There is not gravity. The earth sucks.
There is not one female comic who was beautiful as a little girl.
There is nothing "fair" about the "fairer sex" if they are feminists.
There is nothing "fair" about the "fairer sex" if they are feminizts.
There is nothing else but That...
There is nothing good or bad,but thinking makes it so-W. SHAKESPHERE
There is nothing instant in AA except the coffee.
There is nothing like . . . well, there is nothing like a woman!
There is nothing like an ice cream cone in your armpit.
There is nothing like death. To it, everything is a metaphor.
There is nothing like the taste of Protoculture in the morning.
There is nothing more erotic or sexy, than a women who knows she is.
There is nothing more horrifying than stupidity in action
There is nothing more impartial than a hanging judge.
There is nothing more permanent that a temporary tax.
There is nothing more satisfying than being prepared for a final.
There is nothing permanent except change. -- Heraclitus
There is nothing quite as wonderful as money.
There is nothing so habit - forming as money.
There is nothing so permanent as a temporary government program.
There is nothing so simple that it can't be done wrong.
There is nothing so small that it can't be blown out of proportion.
There is nothing that a good defense cannot beat a better offense.
There is nothing to mediate, Delenn. - G'Kar
There is nothing to scratch but the surface.
There is nothing worse than being peerless in a peer-review system.
There is nothing wrong with feminists that reincarnation won't solve.
There is nothing wrong with feminizts that reincarnation won't solve.
There is nothing wrong with sobriety in moderation.
There is now a cure for Cancer. --Death.
There is often more than two sides to a story.
There is one God, but which one is He?
There is one antidote only for coquetry and that is true love.
There is one called @FN@ among them. He is mine.
There is one called Bullitt among them. He is mine.
There is one called Orville among them. He is mine.
There is one called YOU among them. He is mine.
There is only one RUSH, and it ain't Limbaugh!
There is only one man who would dare to give me the Rasberry. Lonestar!
There is only one reality: the reality knowable to reason.
There is only one sure way to throw dice: away.
There is only one universal passion: fear.
There is only one way to console a widow, but remember the risk. L. Long
There is only one way to console a widow. But remember the risk.
There is other intelligent life in the universe. It ignores us.
There is serenity in Chaos, seek the eye of the hurricane.
There is sex after death, you get laid in the coffin
There is sex after death, you get laid in the coffin. --Carlin.
There is sex after death. You get laid in the coffin.
There is sex after death... You get laid in the coffin!
There is so much to be learned from beasts.-Bram Stoker's Dracula
There is something about a closet that makes a skeleton restless.
There is something to be said about me: "Wow!!"
There is something to be said about my looks --- WOW!
There is something to be said for my looks ---- WOW!
There is something up there Mulder. --Dana Scully.
There is something up there Mulder. --Scully.
There is strength in our Roots.
There is that 'Benny Hill' thing - Crow on the British
There is three errers in this tagline.
There is too much blood in my caffeine stream!
There is too much blood in my caffiene stream!
There is unrest in the forest, there is trouble with The Trees. -RUSH
There is very little future in being right when your boss
There is very little future in being right when your boss is wrong.
There is victory in surrender.
There is water on Mars, we've seen canals --Dan Quayle
There is what you say, what you intended, what was heard, and percieved.
There is wisdom in music and power in song.
There is wishful thinking in hell as well as on earth. - C.S. Lewis
There is, by definition, ONE universe.
There isn't a clear and present danger, Commander. - Sheridan
There isn't a door which can stop a lover or a cat.
There isn't a shower COLD enough for this man - Crow
There isn't a whole lot one can say in 50 characte
There isn't enough space for a good quote!
There isn't nearly enough filk around here for my taste...
There isn't room enough in this dress for both of us.
There it is! The Bridge of Death!
There it is! The Bridge of Death! --Arthur.
There just is no problem too difficult for God to handle. Allow Him!
There just isn't any way to discreetly shoplift a piano.
There just seem to be too many irresponsible people on the Net, though.
There may be SOME discharge - Crow on creating a zombie
There may be a corolation between humor and sex. - Data
There may be a corolation between humour and sex. - Data
There may be a correlation between humor and sex * Data
There may be a correlation between humor and sex * Data
There may be no heaven anywhere, but somewhere there is a Florida.
There may not be a 15th incarnation. I may be the last.-Dalai Lama
There must be 50 ways to love your liver ...
There must be a *lot* of people in Columbia named Juan Valdez :)
There must be a God - who pops up the next Kleenex?
There must be a demand for useless software.
There must be a volcano under there somewhere. - Dr. Freedman on BJ
There must be fifty ways to leave your lover! - P. Simon
There must be more than this provincial life.
There must be more to life than compile-and-go.
There must be more to life than sitting wondering if there is more to life.
There must be some kind of way out of here said the Joker to the Thief
There must be some kinda way outta here - Jimi Hendrix
There must be some mistake I didn't mean to let them take away my soul
There must be some mistake, General. - Sheridan
There must be someway out of here said the Joker to the Thief.
There must have been a thread here somewhere.
There never was a good knife made of bad steel.
There never was a good war or a bad peace. --Franklin.
There now, don't you feel bet-TUR? - Stimpy
There once was a Bobbitt named John, of sex he was overly fond.
There once was a [ ] from [ ] whose [ ] was [ ]
There once was a [ ] from [ ] whose [ ] was [ ] as [ ]!
There once was a lady from Venus, whose body was shaped like a--
There once was a man from Nantucket- Delenn.
There once was a man from Nantucket. You've been talking to Garibaldi!
There once was a man from Nantucket... - Delenn.
There once was a man from Nantucket.You've been talking to Garibaldi!
There once was a woman from Venus . . . - Data
There once was a woman from Venus, whose body was shaped like a ....
There once was a women from Venus, whose body was shaped like a...
There once was a women from Venus, whose body was shaped.
There once was a women from Venus, whose body was shaped....
There once was a young lady from Venus...
There ought to be a background check on purchasers of modems.
There ought to be a room in every house to swear in. - Twain
There ought to be some justice for this victim of a love crime.
There really is no place to go - Crow during fire drill
There seems to be a pattern to these Taglines...--Data
There seems to be a pattern to these recipes...
There seems to be an ECHO in here!
There she goes again....totally disregarding reality...
There she goes with the "goose" gags! Leave that Dragon Alone!
There she goes, again....totally disregarding reality....tsk tsk tsk.
There she was just a purrin next to me: Do wa kitty kitty dum kitty do
There should be a law to hunt those things with 12 ga. shotguns!
There should be one day on which everyone must go barefoot. . .
There they dimmed amongst the lilies fair. -L. McKennitt
There twenty-five bombers behind.
There used to be a tagline here, but it got a job and moved.
There was a Bobbitt named John, of sex he was overly fond
There was a Bobbitt named John, who thought he was Don Juan.
There was a Borg at the filksing. Sang "Unassimilated from Argo."
There was a difference in her laughter, a softness in her eyes.
There was a fish...in the percolator.
There was a king and he ruled the land -- Maltilda Mother.
There was a light at the end of the tunnel, and it was a flamethrower.
There was a long silence. Then a slightly shorter silence.
There was a meal deal so I got two Beef & Swiss - Dr. F
There was a pool beneath the window. - Ivanova
There was a recipe here but someone stole it.
There was a star danced, and under that was I born. - Shakespeare
There was a tagline here but someone stole it.
There was a time I could remember but now I can't recall.
There was a time when OJ was more likely to get hung than the jury
There was a tiny flaw in the plan. It was bollocks. -BlackAdder
There was a young lady from Nantucket...Oh, never mind!
There was a young lady of Crewe; whose limericks stopped at line two.
There was a young maid with a bucket. She once got upset and said__
There was a young man from Bombay . . .
There was also an humming-bird that spake unto the horned cerastes,
There was an 8th drawf, his name was Lumpy and he died of cancer. *
There was an old man from Nantucket, whose di#@$^*NO CARRIER
There was much to explore, but an adult might not think so.
There was nothing in the Docs about this!
There was only one true Christian and he died on the cross.
There was somebody here when I got here.
There was supposed to be an Earth-shattering Kaboom! - The Martian
There was the waiting. Terrible waiting. - Franklin
There was this door to which I found no key.
There was this veil through which I could not see.
There was this... this... and it... forget it, you wouldn't understand
There were bells, but I never heard them.
There were computers in Biblical times. Eve had an Apple.
There were computers in Biblical times. Adam a Wang.
There were computers in Biblical times. Adam had a Wang.
There were computers in Biblical times. Apple had an Eve.
There were computers in Biblical times. Eve had an Apple, Adam a Wang.
There were computers in Biblical times. Eve had an Apple.
There were plagues of locusts, and frogs, and Amigas.
There were plagues of locusts, and frogs, and Windows..
There were prodigies and portents enough, One-Eye says. -Glen Cook.
There were two Biddle's in this film - Tom
There will always be idiots.
There will always be those who read by the light in the dunny.
There will be a 5 hour delay in our movie - Crow
There will be a rain dance Friday night - weather permitting ...
There will be a rain dance Friday night, weather permittimg.
There will be a rain dance Friday night, weather permitting
There will be a rain dance Friday night, weather permitting.
There will be a rain dance Friday, weather permitting.
There will be a rain-dance this Friday ...weather permitting.
There will be a slight delay while I try to remember why.
There will be a test held at 3AM at the *Tagline Courthouse*, 1st Flr.
There will be an Atheists for Christ meeting 9:00 pm Wednsday.
There will be an answer, but it is funner to blame Kirk....
There will be an answer, let it be.
There will be big changes for you but you will be happy.
There will be more announcements later. - S. Commander John, V
There will be no NEXT time for you, Tyrannical Moderator.
There will be no escape for the princess this time. -- C3PO
There will be no escape for you THIS time!!!
There will be no last bus tonight.
There will be no mockery of your name, Mr. Flascock. - Skinner
There will be one empty chair.
There will be plenty of time for brain eating after we conquer earth.
There will be vice as long as there are men.
There will be vice as long as there are the Bruins.
There will be vice as long as there are the Rangers.
There will be...Tribble! -- RoboKirk
There will never be another you....
There will now be a short pause while everyone says, "Big deal."
There would be fewer hypothetical answers!!
There would be no Texas if the Alamo had a back door.
There ya go 123 "New" taglines! ENJOY!
There ya go, Joe Weider's protein blast - Mike
There ya' go, Ron. Enjoy - Mike
There ya' go, kids - Dr. Forrester
There you go again - thinking you have rights
There you go again, being kind that is. <G>
There you go again, stealing my thunder, raining on my parade....
There you go again--thinking you have rights
There you go, @FN@! For the first time you're wrong again!
There you go, Orville Bullitt! For the first time you're wrong again!
There you go, Orville! For the first time you're wrong again!
There you go, YOU! For the first time you're wrong again!
There you go, bringing class into it again...
There you go, passing out all my secrets. I KNEW I shouldn't trust you.
There you go. Proud? You've made me lose my lunch!
There you stood by the side of the road & I just KNEW you was trouble.
There you will learn from Yoda, the Jedi master who instructed me.
There! Got him with my ASCII gun! Right through the monitor!
There! I made a meaningless pop-culture reference!
There! Now we're both transmogrified! We're even!
There! Now we're both transmogrified! We're even! - Calvin
There! I made a meaningless pop culture reference! - Tom
There! I've run rings around you logically!
There! That'll tire out yer Bonyparts! ;-)
There'd be dragons here.
There'll always be another war. - Frank Burns
There'll be no escape for Orville this time.
There'll be no escape for the #TN# this time.
There'll be no escape for the @LN@ this time.
There'll be no escape for the Bullitt this time.
There'll be no escape for the Orville this time.
There'll be no escape for the Princess this time. - C-3PO
There'll be no escape for you this time.
There'll be no locks or bolts between us. John Wayne
There'll be no more AAARRGGHH!! but you may feel a little sick.
There'll be no more aaaaaaaaah!
There'll be no strippers in my town, said the sheriff unbareably.
There'll be no tire changing in my county, mister - Mike
There're three sides to every story: my side, your side, and the truth
There's 150 teens in a town of 200 - Tom
There's ALWAYS enough time for a QWKie!
There's ALWAYS one more amoeba!
There's ALWAYS one more bug!
There's Chocolate, but where's the Chocoearly?
There's Colonel Dirtyfishydishcloth, he'll distract her good.
There's Death in the cup, so beware. -- Burns
There's Gods church, and then there's religion.
There's Japanese people named 'Pepe'? - Tom incredulously
There's Klingons off the starboard bow! Scrape them off, Jim!
There's Klingons on the staboard bow. Scrape em off, Jim!
There's Klingons on the starboard bow - scrape 'em off, Jim!
There's Klingons on the starboard bow, scrape 'em off, Jim.
There's Klingons on the starboard bow, starboard bow, starboard bow....
There's Klingons on the starboard bow. Scrape them off, Jim!
There's Loonies running freely through the halls.
There's No Government like No Government!
There's SIMPSON DNA on this gun! - Chief Wiggum
There's TWO Lois Lanes in this movie - Mike
There's Tony Bennet's heart - Crow on bombing of Frisco
There's Wesley, FULL PHASERS!!!
There's a $20 charge if you tell me how much better it is up north.
There's a $20 surcharge if you tell me how much better it is up north.
There's a 90% chance of weather today.
There's a Bobcat Under the Outhouse!" - by Claude Balls
There's a Cardie on the road/His brain is squirming like a toad.
There's a Grace Slick on the runway - Crow
There's a Joey "Skinny Legs" Tagliano here - Frank
There's a NEW testament in town - Mike as priest
There's a Pakled born every minute. -- LaForge
There's a TV comedy somewhere in all this
There's a Thargoid ship out there somewhere, and I want it!
There's a Voter born every minute ... P. T. Klinton.
There's a Yankee in my closet - will trade for skeleton.
There's a Yankee in my closet...will trade for skeleton...
There's a backwards message hidden in this tagline....
There's a big difference between kneeling down and bending over! -zapp
There's a black cat down on the quayside.
There's a blind man looking for a shadow of doubt.
There's a blonde pubic hair in my Coffee. Is it yours?
There's a blonde pubic hair in my Coke. Is it yours?
There's a blood-sucking insect in my French cheese, said Tom briefly.
There's a brain in my tumor.
There's a brain in my tumour!
There's a bug somewhere in your code.
There's a computation error here! - Don Schanke
There's a cool wind on the desert tonight.
There's a crazy superstition that's got to do with Chickens
There's a dead bishop on the landing, dad!
There's a dead hunk in the middle of the road -Crow sings
There's a dead space-man to see you, sir! --Crow T. Robot.
There's a devil sleeping in my bed - NIN
There's a difference between kneeling down & bending over.
There's a droid running crazy in my lounge.
There's a fat man in the bathtub with the blues. -L. George
There's a final in from Rome: Lions 45 Christians 0
There's a fine line between courage and foolishness. Too bad it's not a fence.
There's a fine line between fishing and standing on the shore
There's a fine line between genius and insanity. Don't push.
There's a fine line between sanity and reality.
There's a fine line between stupid and clever.
There's a fine line between stupid and clever. -Spinal Tap
There's a fine line between wise and weird
There's a frood who knows where his towel is.
There's a frood who really knows where his towel is.
There's a fundamental importance of learning the alphabet, Abie ceded.
There's a fundamental importance of learning the alphabet, Tom ceded.
There's a fungus among us.
There's a gay character in For Better Or Worse - Mike
There's a hole in your mind too ?
There's a hole somewhere in that girl's marble bag.
There's a hot place with pitchforks waiting.
There's a jackass at every trough - Rickard's Maxim of Online Community
There's a jelly baby floating in my Earl Grey!
There's a job for you in the system boy, with nothing to sign.
There's a lady who's sure all that glitters is gold...
There's a large group of insane men staying on my floor. -Dale Cooper
There's a lawyer criminal. You mean criminal lawyer. Same difference.
There's a leak in his ceiling.
There's a lesson in there somewhere.
There's a light over at the Frankenstein place...
There's a light, a light, in the darkness of everybody's life.
There's a light, over at the Frankenstein place.
There's a little Buddha in all of us. His Holiness - Dalai Lama
There's a little bit of Jerry, George, Elaine, and Kramer in all of us
There's a little black spot on the sun today.
There's a lot of trial & error here-100% of each
There's a lot to be said for a blow to the head.
There's a lot to be said for total silence.
There's a lot to be said, for a blow to the head.
There's a map to the hospital on back of menu.. - Japanese Waiter
There's a measure of blame on both sides.
There's a mole crawling on your mouth - Crow on beard
There's a moon and a road outside baby we're getting outta here.
There's a moon tonight and a road outside baby we're getting outta here.
There's a new Divorced Barbie Doll... comes with all of Ken's stuff.
There's a new Japanese board game out. It's called 'New York City.'
There's a new dance craze: the Banana ... you peel ...
There's a new movie about two unborn babies in love? Fetal Attraction.
There's a nit! Quick! Pick it!
There's a nut loose on my keyboard... I've been told it's me.
There's a party in my mind, and I can never leave.
There's a pick-up line if I've ever heard one. - Dot
There's a plot afoot to make me think I'm paranoid!
There's a plot to make it look like I'm a paranoid!!! - Amos Salmonson
There's a rattlesnake in my phone - Crow
There's a reason why there's no "OS" in Windows...
There's a red house over yonder, that's where my baby stays - Hendrix
There's a red house over yonder, that's where my baby stays. --Hendrix.
There's a red house up yonder...yeah that's where my baby stays.
There's a red pubic hair in my Coke. Is it yours?
There's a right way, a wrong way and my way. Do it MY way!
There's a robo purge button on the control panel? - Crow
There's a rose in every crowd.
There's a shocker - Yakko
There's a skeleton in every old house and old horse.
There's a squirrel in there! - Crow on wine barrel
There's a storm in the heartland...
There's a stranger in my head.
There's a striking difference between Bondage & Discipline
There's a sucker born again every minute
There's a sucker born every minute - P.T. Barnum
There's a sucker born every minute ..no wonder guys are so happy?
There's a sucker born every minute!
There's a sucker reborn every minute.
There's a switch. Someone shooting a postal worker - Tom
There's a tick on Gamera. Oh, it's Itchy - Joel on kid
There's a time for love and a time for letting me be, baby
There's a time to fight, and a time to hide out.
There's a time to live, and a time to die...
There's a time when you have to stick your feet out the car window.
There's a track winding back by an old abandoned shack...
There's a vas deferens between men and women.
There's a war on and we've no time for violence. - Frank Burns
There's a way out of any cage.
There's a way out of any cage. - Captain Pike
There's a way out of any cage. - Christopher Pike
There's a whiskey named after you - Old Crow!
There's a whole Lalo Schifrin goin' on.
There's a whole dead cat in every bar of Dead Cat Soap!
There's a whole generation of people out there my age.
There's a whole manual of obsolete features!
There's already too much flying in this movie - Mike
There's always 1 more SOB than you counted on
There's always 1 weirdo on a bus-but I couldn't find him!
There's always a loophole.
There's always a newer model computer coming out, **and you need it!**
There's always a rainbow at the end of every rain.
There's always an easier way to do it.
There's always been TV. There's just more channels now. - Butthead
There's always one in every crowd.
There's always one more S.O.B. than you counted on
There's always one more bug.
There's always one, isn't there? Now, where were we?
There's always room for JELLO!
There's always room for Odo...<BURP>
There's always room for filth!
There's always something magic..there's always something new.
There's always something more to learn... the hard way!
There's always something. - Ivanova
There's always terror to fall back on. - Hawkeye
There's always the temptation to let other people think you're normal
There's always time for a hockey game!
There's always tomorrow for dreams to come true. Clarese
There's always too much month at the end of my money!
There's always too much month left at the end of the money!
There's always trolling for nurses. - Trapper
There's an Ant Crawling up your back in the nighttime -- TMBG
There's an Arizona Cardinal in the End Zone?...must be a Safety.
There's an Italian in my room and he won't go away!
There's an advantage in being poor. The doctor will cure you faster.
There's an answer to every problem. Sometimes it's "No".
There's an easier way to get tail -Tom as dino swats tail
There's an emergency going on. It's still going on.
There's an exception to every rule, except this one.
There's an old Ferengi saying: 'Why ask when you can take?'
There's an old Ferengi saying: `Never ask when you can take?'
There's an old cat saying, but you don't want to hear it.
There's an old proverb that says just about whatever you want it to.
There's an onion ring - answer it!
There's another dead Bishop on the landing, Vicar-Sergeant!
There's another dead bishop on the landing, Vicar Sargeant!
There's another dead bishop on the landing, Vicar Sergeant!
There's another dead bishop on the landing, vicar Sargent!
There's another way to survive.Mutual trust -- and help.
There's antimony, arsenic, aluminum, selenium.
There's as good fish in the sea as ever came out of it.
There's at least one fool in every married couple.
There's barely any rats - Tom on rundown motel
There's blood in the streets, it's up to my ankles...
There's bound to be a gargoyle here somewhere.
There's bullets in the other end of that thing - Mike/#606
There's coffee in that nebula! - Capt. Janeway
There's coffee in that nebula! -- Captain Janeway
There's danger when a man throws his tongue before his brain starts.
There's definitely too much blood in my caffeine system.
There's devils inside of ya' - Mike
There's edible food...then there's Spam.
There's enough room here for an eighteen-hole golf course.
There's feline flesh all over the road, Joe said categorically.
There's feline flesh all over the road, Tom said categorically.
There's good luck, bad luck, and no luck at all.
There's got to be a way to make money at this BBS stuff.
There's got to be more to life than compile--and--go.
There's got to be more to life than compile-and-go.
There's hair all over me - Tom
There's hair on my Fruit Rollup - Tom
There's hair on my blue serge suit - Tom
There's history in our roots!!!
There's holmium and helium and hafnium and erbium.
There's hope for anyone who can look in a mirror and laugh.
There's insanity in my family; starting with me, tonight.
There's just not enough Sax & Violin's on TV!
There's just not enough sax and violins on television!
There's just not enough sax and violins on television.
There's just something women like about a pickup man.
There's lies, damn lies, and benchmarks!
There's lies..damn lies..and then there are statistics.
There's life above the mason dixon line, but who wants to live there?
There's little worse than being peerless in a peer-review system.
There's many a slip 'twixt the book and the script.
There's many witty men whose brains can't fill their bellies.
There's meat and music here, as the fox said when he stole the bagpipes.
There's more NOTHING in this movie - Mike
There's more death done in bedrooms than in alleys.
There's more planes in the ocean than ships in the sky!
There's more posting flames on Fido than during California wildfires!
There's more simplicity where that came from!
There's more than one answer to these questions...
There's more than one way to cook a cat." -- 6th Doctor
There's more than one way to scan a cat.
There's more than one way to skin a cat - get a sander
There's more than one way to skin a cat. Buy a power sander.
There's more than one way to skin a cat. Get a sander!
There's more than one way, to cook a cat. --6th Doctor.
There's more then one way to skin a cat; get a sander.
There's more to BBSing than meets the modem.
There's more to being king than getting your way all the time. - Mufasa
There's more to life than RPG's, but not much.
There's more to life than TV (and OJ). <ts>
There's more to life than increasing its speed
There's more to life than increasing its speed -- NOT!
There's more to see than can ever be seen... - The Circle of Life
There's more too life than Pizza, but not much....
There's movement all over the place! -- Hudson
There's much to say but your eyes interrupt me.
There's my proof...poke holes in it if you like...
There's my request Thanks for helping me fatten my tagline collection.
There's my two cents, can I have change please.
There's my way, and then there's the easy way
There's my way, and then there's the easy way.
There's nae fule like an auld fule.- Old Scot Sayin
There's never a bad day of flying...just less than optimum.
There's never a cat around when you need one.
There's never a cop around when you need one.
There's never a topic cop around when you need one.
There's never a topic cop when you need one.
There's never an ornithologist around when you need one.
There's never been a good government.
There's never been a planet Janet hasn't seen.
There's never enough time to do all the nothing you want.
There's never enough time to do all the nothing you want. -Bill Watterson
There's never enough time to do all the nothing you want." * Calvin
There's never enough time to do it right, but always time to do it over!
There's never time to do it right but always time to do it over!
There's no BODY-CHECKING in golf!!! - Charlie Brown to Lucy.
There's no BODY-CHECKING in golf!!! - Charlie Brown, to Lucy.
There's no FAT in a 0 byte file.
There's no accounting for taste! - COLONEL SANDERS
There's no accounting for taste-Col Sanders
There's no accounting for taste.
There's no assassin up here! - Mike to Bots
There's no copyright on love - you can copy it to your heart's content.
There's no crying in baseball! - Tom Hanks
There's no desert between Pennsylvania & New York! - Joel
There's no difference between a wise man & a fool when they fall in love
There's no easy answer in the Green Man's song.
There's no elevator to success. You have to take the stairs.
There's no escape from my authority - I tell ya...
There's no excuse for the way I'm about to behave
There's no film...I'm live. - Father Mulcahy
There's no fool like an old fool, 'cause he's experienced
There's no free ride in this carnival world!
There's no friend like a Computer Addicts friend!
There's no fuel like an old fuel.
There's no future in England's dreaming. -Sex Pistols
There's no future in time travel
There's no future in time travel.
There's no good arguing with the inevitable.
There's no greater folly than trying to reform society.
There's no guarantee that the clones would have that same taste.. :) -DW
There's no heavier burden than a great potential.
There's no honor in boring an enemy to death.
There's no honor in damaging whelps. -- Wisetongue, Get of Fenris
There's no intelligent life down here.
There's no intelligent life here Scotty -- Beam me up
There's no life after death. Just Los Angeles.
There's no love in Tennessee.
There's no more tempting target than Orville trying to be clever.
There's no more valour in you than in a wild duck! - Shakespeare
There's no more valour in you than in a wild tagline! -- Tagspeare
There's no much guile in the heart that's ay singing.-Old Scot Sayin
There's no mystical energy field that controls my destiny. - Han Solo
There's no mystical force that controls MY destiny.
There's no need to buy OS/2 to run DOS and Windows apps.
There's no need to engage your panic circuit. - Kryten
There's no need to fear, UNDERDOG is here!
There's no one like you, I can't wait for my nights with you!
There's no one { } cloaked here!
There's no place like home when you're not feeling well -- G.K.
There's no place like home...There's no place like
There's no place like real mode. I love it.
There's no place like real mode. I love it.
There's no point in acting all surprised about it. the Vogons
There's no point in beating a dead horse.
There's no point in being grownup if you can't act childish sometimes
There's no point in being grownup if you can't be childish sometimes.
There's no recession. I just LIKE being underemployed!
There's no rest for the wicked :-)))
There's no room in my closets for another damned thing, let alone me!
There's no room in the drug world for amateurs.
There's no second chance for a good first impression.
There's no sense being pessimistic, it wouldn't work anyway.
There's no sense worrying about life. Nobody gets out alive.
There's no skeletons in my closet!
There's no skeletons in my closet!
There's no skeletons is @FN@'s closet!
There's no skeletons is YOU's closet!
There's no snooze button on a cat who wants breakfast.
There's no substitute for education; May I suggest you GET one?
There's no substitute for reading. Well, not MY stuff, but generally.
There's no such thing as "just a cat"!
There's no such thing as "too hot".
There's no such thing as "too much garlic"!
There's no such thing as Just a Cat!
There's no such thing as Texas. It's really Baja Oklahoma!
There's no such thing as a Vulcan Death Grip
There's no such thing as a Vulcan death grip.
There's no such thing as a free Tag Line.
There's no such thing as a theft-proof tagline...
There's no such thing as a too-recent backup!
There's no such thing as a two week project
There's no such thing as gravity - the earth sucks.
There's no such thing as gravity. The whole world sucks.
There's no such thing as gravity. The Earth *SUCKS!*
There's no such thing as luck
There's no such thing as too hot.
There's no such thing as too many "chocolate" taglines.
There's no such thing as too much chocolate!
There's no such thing as too much garlic!
There's no such word as FAIL in my vocabulary!
There's no time for us, there's no place for us...
There's no time like the pleasant.
There's no tradition like a NEW tradition! - Crow
There's no use giving in.
There's no wall between East Germanium and West Germanium.
There's no way to know...
There's no way to tell and it doesn't matter anyway.
There's no where far enough away.
There's no wind in the windmills of his mind.
There's no zone like ozone!
There's none in here! - Wakko (about the vomit bag)
There's not a natural fiber on that man - Mike
There's not a star in the sky.
There's not enough Sax & Violin's on TV
There's not enough people here to stomp out a grass fire.
There's not enough sax and violin's on TV.
There's not enough sax and violins on television.
There's not much worse than a pissed-off Klingon!
There's not such thing as a bad X-Files episode.
There's nothing I'm afraid of like scared people. - Robert Frost
There's nothing a concentrated phaser blast can't solve.
There's nothing here but a useless pile of bones and organs. - Ren*
There's nothing like a 15-second nap. - Hawkeye
There's nothing like a Guinness.
There's nothing like a cat to give your home that lived-in look.
There's nothing like a cold beer at the beginning of a long day.
There's nothing like a dog to give your home that lived-in look.
There's nothing like a good hard drive, X. Hollander
There's nothing like a good old fashioned love-poke -Joel
There's nothing like a good piece of hickory.
There's nothing like a view from the cheap seats.
There's nothing like the taste of Protoculture in the morning!
There's nothing more dangerous than a wounded mosquito!
There's nothing more demoralizing than money. Sophocles
There's nothing more irrelevant than a former politician.
There's nothing more restful than taking orders from fools.
There's nothing natural about your family, Rimmer. - Lister
There's nothing on TV. D'you want to have an argument?
There's nothing small about messing with time! - Holly
There's nothing so habit forming as money..
There's nothing worse than half-dead rACHT. --Melora.
There's nothing wrong that you can't make right.
There's nothing wrong w/ incest as long as it's kept in the family.
There's nothing wrong with DOS that Unix wouldn't fix.
There's nothing wrong with Windows 95 a reformat won't fix!
There's nothing wrong with Windows a reformat won't fix!
There's nothing wrong with Windows that OS/2 won't fix!!
There's nothing wrong with a good delusion. - Quark
There's nothing wrong with a good delusion..
There's nothing wrong with being wrong ..it's just not my turn
There's nothing wrong with demons, was Tom's implicit message.
There's nothing wrong with me that a lobotomy won't cure.
There's nothing wrong with my keyboard. There's n&%)$^%@!
There's nothing wrong with my life that a miracle won't cure.
There's nothing wrong with you that an expensive operation can't prolong.
There's nothing wrong with you that couldn't be cured with
There's nothing you can do but lie there and remain quiet.
There's nothing you can do that can't be done.
There's nothing you can know that isn't known
There's obviously been some sort of silly mistake.
There's one assimilated every minute. --P. T. Borg.
There's one behind every Zipper!
There's one born every minute, and they all buy Windows
There's one born every minute.
There's one fool in every married couple.
There's one good thing about @FN@'s life. It's only temporary.
There's one good thing about YOU's life. It's only temporary.
There's one good thing about life. It's only temporary.
There's one good thing about your life, @FN@. I'm a part of it.
There's one good thing about your life, YOU. I'm a part of it.
There's one in every car... You'll see.
There's one in every crowd and they always find me.
There's one in every crowd, and they always find me!
There's one in every crowd....
There's only 1 lawyer in Lawyerville, New York.
There's only one kind of woman.... Or man, for that matte
There's only one thing on this Earth that matters.
There's only one thing that can kill a chicken vindaloo - Lister
There's only one truth about war: people die. - Sheridan
There's only one way I'll learn, and you know it. - Interview...
There's only one way out. - Ivanova's Mother
There's only one way to have a happy marriage and as soon
There's only two kind of music - Country & Western.
There's only two kind's of music - Country & Western
There's only two kind's of music - Heavy & Metal
There's only two kinds of music: Rock and Roll.
There's only two things wrong with you. Everything you do and say.
There's powers and then there's powers. -- Shakespeare
There's protocol to consider. - Ivanova
There's room for one more, Tom admitted.
There's safety in numbers - .357 for example!
There's safety in numbers -- .357 for example!!!
There's safety in numbers when you learn to divide.
There's safety in numbers, when you learn to divide.
There's safety in numbers/When you learn to divide.
There's safety in numbers: .22, .38, .357, .44, .45, 9mm...
There's safety in numbers: F16, F11, B2, F15....
There's safety in unexciting gentlemen, said Mary indulgently.
There's sex after death! You just don't feel it...
There's so much to say but your eyes keep interrupting me
There's so much you'll never know...
There's some RWC thing.... pending... :) - TEC
There's some heroin I've had my eye on - Tom
There's some lovely filth over here
There's some lovely filth over here...
There's someone here in Security who wants to talk to you Cmdr. Orville.
There's someone in my head and it's not me.
There's someone in my head, but it's not me- Pink Floyd
There's someone in my head, but it's not me.
There's someone in my head, but it's not me... - Pink Floyd
There's someone in my mind and it's not me.
There's someone on this echo who should heed the above words!<g>
There's somethin breathin' down here... Uh oh, I'M RATIGATOR BAIT!
There's something I didn't tell you. --Mulder. Something else? --Scully.
There's something SICK about this - Tom on wrestling hold
There's something else I have to show you. - Martin, V
There's something going on, but I don't know what it is.
There's something inside your head
There's something not right here. - Luke
There's something wrong with my radio!
There's something wrong with the transporter .. Where are my thumbs?
There's something wrong with the world today
There's somthing inside your head...
There's spam, egg, sausage and spam. That's got not *much* spam in it.
There's stars in the heavens that I'll never hold.
There's such a fine line between clever and stupid.
There's sulfur, californium, and fermium, berkelium.
There's sumpthin' bigger than Phil!!
There's that Vince magic - Crow on sleazy tough guy
There's that fate thing again. -- Rita
There's that strange noise from the drive again...
There's the dog star, Tom said seriously.
There's the old man from Scene 24!
There's the right way, the wrong way, and the Army way.
There's too many clues in this room.
There's too many pigs for the tits. - Abe Lincoln
There's too much Sax and Violins in Classical Music!
There's too much blood in my caffeine system.
There's too much blood in my caffeine-stream.
There's too much line noise, please flirt harder
There's too much sax and violins in classical music
There's too much sax and violins on public TV.
There's too much sax and violins on tv.
There's too much sex on TV. People really should use the bed!!!!
There's too much vermouth in my martini, Tom said dryly.
There's too much water in our chlorine supply.
There's trouble on the line.
There's two ways to handle women, and I don't know either.
There's your NEXT challenge! - Picard
There's yttrium, ytterbium, actinium, rubidium.
There's...a...cactus...up...my...BUHHHH-uh - Crow
There, I've run rings 'round you logically.
There, I've run rings around you logically
There, I've said it. I feel better. --Death.
There, There, Now, Tell Momma What's Wrong! - Stimpy.
There, but for the grace of God, goes God.
There, poor Flopsy's dead and never called me mother. (Chapman)
There, that ought to catch the moderator's attention...
There, that will do till a REAL explanation comes along.
There, that will do until a REAL explanation comes along.
There, there Dr. F - TV's Frank
There, there. I'll have your Spam. I love it.
There, there. I'll have your Spam. I love it.
There, you broke it. Are you happy now?
There--I've run rings around you logically.
There. I've said it. I feel better.
There. --Kosh.
There. I said it. I'd say it again if I had to - Mike
There. I'm deep fried. We're even. Now gimme a hug -Frank
There`s so much to say but your eyes keep interrupting me.
Therefore I do my little Superior Dance for you.
Therefore, I choose not to cooperate. I *HATE* Vulcans!
Thereisnodarksideofthemoon.Thewholebloodything'sdark!
Thereisonlysomuchyoucansayusingjustfiftyletters.
Theres an echo around here!
Theres more than one way to skin a cat; get a sander.
Theres no such thing as idle Amoebas. They're always busy.
Theres noth'n more exciting than a dirty thought in a nice clean mind.
Theres nothing wrong with a cat that a good pitbull cant fix.
Theres perfect harmony in the rising and the falling of the sea.
Thermal Detonator: The ultimate point and click interface!
Thermocouple...Two persons in a sleeping bag for one.
Thermodynamics - It's not just a good idea, it's the Third Law!
Thermodynamics - a thermometer on the run?
Thermodynamics: a thermometer on the run?
Thermonuclear warheads: Don't run you will only die tired
Thesarus: Ancient reptile w/ excellent vocabulary.
Thesaurus (n) Extinct dinosaur with phenomenal vocabulary.
Thesaurus (n): ancient reptile with excellent vocabulary.
Thesaurus - Ancient reptile with a really good vocabulary.
Thesaurus, n. An extinct reptile with a large vocabulary
Thesaurus: Ancient reptile with an excellent vocabulary.
Thesaurus: Ancient reptile with excellent vocabulary.
Thesaurus: An ancient reptile with an excellent vocabulary.
Thesaurus: Ancient reptile with excellent vocabulary.
Thesaurus: an ancient reptile with an excellent vocabulary.
Thesaurus: ancient reptile with an excelent vocabulary.
Thesaurus: ancient reptile with an excellent vocabulary
Thesaurus: ancient reptile with an excellent vocabulary.
These ARE the GAY 90's, aren't they??
These Days There's No Arrest For The Wicked.
These Happy Hearts diaries are really well made! - Crow
These Italian bun-huggers give me no room at all - Crow
These Knights aren't bad after you get the hard shell off.
These Morons Are Catching My Fish With Crappy Jacks! - Ren.
These Views Do Not Reflect All The Voices In My Skull
These WILL make GREAT general purpose Tags!
These ain't my shorts - they bend!
These are Bill's. Yes, life's expensive
These are almost as bad as bumper stickers.
These are from BLAKE'S 7, first season.
These are good tags. I'd not seen the first two so I swiped 'em
These are my "Q" Taglines:
These are my new sunglasses! Tom glared.
These are my opinions - consequently a reply would be ludicrous.
These are my opinions. Who else would bother?
These are my political taglines. Since I am a conservative Democrat, the
These are not kid gloves, Mr. Valiant
These are only my opinions. You should see my convictions.
These are only my views, and I am proud of them.
These are perilous times. --Delenn.
These are questions we have no business asking. - Dana Scully
These are the Bill Clinton times that try men's soles.
These are the Enterprises of the starship Voyager...
These are the George Bush times that try men's soles.
These are the Pros and Cons of hitchhiking. -- Belle, Bone Gnawer
These are the credits for `I Dream of Genie'! - Tom Servo
These are the days of Miracle Whip and Wonder Bread.
These are the happiest years of your life! - You mean it gets WORSE?
These are the only ones of which the news has come to Ha'vard.
These are the pale deaths men miscall their lives. - Merlin
These are the things dreams are made of...
These are the times that really try men's soles.
These are the times that try men's souls. - T. Paine
These are the times which try men's souls. -- Paine
These are the tools we employ. And we know... many things.
These are the voyages Oops! * DS9 opening
These are the voyages of other aliens visiting us * DS9
These are the years that you've taken to bed - Course of Empire
These are your eggs on drugs.
These are your gloves. But they're too small! They must have shrunk then
These are your own species - Toq
These are your pants || and these are your pants on drugs /\
These aren't dances. Their fertility rites with lyrics.
These aren't dances. They're fertility rites with lyrics.
These aren't my shorts -- they bend !
These aren't the 'droids you're looking for. Move along.
These bacteria have a habit? Fascinating.
These boots were made for walking and they'll walk all over you.
These boots were made for walking....er, line dancing!
These boxes keep us free: ballot, jury, soap and cartridge.
These boxing gloves are too big, said Tom heavy-handedly.
These brownies don't taste anything like Girl Scouts.
These chains are my freedom.. but what chains You..?
These cheerleaders are fat! huh huh huh
These chicks would not talk to us. - Butthead
These cookies don't taste anything like Girl Scouts
These cookies don't taste anything like girl scouts!
These cookies don't taste like Girl Scouts!
These cookies don't taste like girlscouts! Refund!
These cookies don't taste nothing like Girl Scouts!
These creatures do not die like the bee after the first sting.
These days I have sex porcupine style: *VERY* carefully!
These days nobody gives a fugue about classical music..
These days there's no arrest for the wicked
These days they carry you into a hospital "fee first."
These days when your ship comes in, the government docks it.
These days you have to be crazy just to stay sane.
These days, it's all in the mind. It's elemental.
These days, nothing is bad work if you can get it.
These doggie treats are ok, but I need some human food. <Riggs>
These effects aren't very special. -Butthead
These fingers never left my hands. - Hawkeye
These genes are dominant, said Tom expressively.
These guy got no future! huh huh huh
These guys are as subtle as a brick through a glass window - Garibaldi
These guys are pretty cool for a bunch of mimes. -- Butthead
These guys are pretty cool, even though they're 60. That one guy is 69
These guys are pretty cool, even though they're like 60. huh huh huh
These guys aren't soldiers, they're doctors. - Col. Potter
These guys got no future! huh huh huh
These guys have no future! Butthead
These guys live on the edge. -- Butthead
These guys live on the edge. Yeah, the edge of wuss cliff - on Winger.
These guys played at the state fair last year - Butthead on Loverboy.
These guys understand the importance of a good butt. - Butthead
These handcuffs are killing me.
These have been (you know) *S*W*I*P*E*D*!! ... Thanks, KJ! :-)
These hemorrhoids are a pain in the neck!
These humans; such a dangerous, savage child-race
These jokes are from last weeks show! - Tom
These jokes turn my stomach, said Tom wretchedly.
These kids... Do they put their hats on backward, or their heads?
These knights aren't bad once you get the hard shell off 'em.
These laid the world away; poured out the red sweet wine of youth
These limbs are not mine.
These little crab things are great! - The Tick
These look like good blades. - Gandalf
These mating rituals you humans engage in are quite disgusting.
These more than one way to skin a cat. Get a sander!
These moths turn up in the mouths of Bob's victims - Crow
These opinions are mine and only mine (unless you wnat to claim them).
These opinions are mine and only mine - unless you want to claim them.
These opinions are my own - I reserve the option to be DEAD WRONG!
These opinions are my own. I reserve the right to be DEAD WRONG!
These opinions aren't mine - I stole them from someone much more intelligent.
These pants are not short enough, said Mary hotly.
These pants have stirred something deep inside me - Crow
These people are led by a girl group - Crow
These people are natural-born explorers.
These people are natural-born idiots if you ask me.
These people aren't Japanese! - Crow during Czech movie
These planets live fast and die hard. - Riker
These plucky Kiwanis stand to make a bundle - Crow
These really are good times, but only a few know about it
These recipes multipy faster than Tribbles.
These scenes are from a completely different movie - Tom
These scores just in: Babylon = 5 Deep Space = 9 Earth = 2
These shoes look like Frankstein's hand-me-downs. - The Cat
These shots were rejected for Monster A-Go-Go - Tom
These signs cost money,
These speak evil of those things which they know not. - Jude 10
These special effects aren't very special. -- Butthead
These special effects suck. --Beavis.
These taglines are so bloody bland... ugh...
These taglines don't give you enough room to say what yo
These taglines exported courtesy of Messenger:
These taglines multiply faster than Tribbles.
These taglines multipy faster than Tribbles.
These things I command you, that you love one another. John 15:17
These things are fun, and fun is good. -- Dr. Seuss
These things must be done delicately..
These things on my nose aren't just for show. * Ro
These thoughts are mine, but you may rent them for a small fee.
These tools are my friends - Crow
These two nuns go into a bar...
These views are my own. So shut up!
These were great. I just tried to search TLX's database and got a major
These were the 'hi-tech' FBI guys, you see!
These will help cut the odds down a little. --Cranston.
These woods are lovely, dark and deep. But I have promises to keep...
These would make nice purses! - Crow on baby pigs
These young life weekends are getting outta hand -Crow
These young men sound so angry - Mike on metal music
These...Immortals... how many of them are there? - Clancy
Thespians do it playfully.
Thetrouble with a kitten is that, eventually it's a cat.
They *blinded* me with Science!
They *wouldn't*. They *couldn't*. They BETTER *NOT*!!!
They ARE Euthanasia - Joel on Japanese kids
They ARE doing it with mirrors...
They DO make 'em like they used to.
They Don't Make Them Like You Anymore..
They Might Be Giants' newest album: FLOOD
They Might Be Giants, BWAH, They Might Be Giants
They NEVER talked to the Dead - Crow realizes after film
They acquitted OJ; found superbowl ring at crime scene.
They actually believe that a conspiracy exists! - Steven, V
They adopted my recipe! Look Ma, I'm a WRITER!
They adopted my tagline! Look, Ma, I'm a WRITER!
They all died in terror. --Troi.
They all died...
They all got View-master wheels on their chest - Crow
They all hate me because I'm paranoid.
They all hook the same at 2 am.
They all look the same at 2 A.M.
They all look the same face down with their legs spread.
They all stopped arguing as Don fired up his chain saw and growled...
They all stopped arguing as Orville fired up his chain saw and growled.
They allowed to have 2 comedy people in this movie? -Crow
They already know who we are, so let's get louder!
They also serve who only stand and wait.
They also surf who only stand on waves.
They also wait who stand and serve.
They always need a hug just when you need to scream at them.
They always say that.
They are REALLY exploiting the island locations - Crow T. Robot
They are a dying people and should be allowed to pass.
They are a dying race. We should let them die. --Kosh.
They are able because they think they are able.
They are able who think they are able. Vergil
They are all good, but this was my favorite - thanks!
They are called bikinis because they don't cover the ladies' atoll.
They are crazy these humans.
They are laughing at me, not with me
They are laughing at me, not with me - Bart Simpson's lines
They are laughing at me, not with me -Bart Simp./Epis. 7G12
They are laughing at me, not with me -Bart Simpson/Episode 7G12
They are laughing at me, not with me. --Bart Simpson.
They are not for you!
They are not ready, they would not understand. - Kosh
They are not the hell your whales. - Spock
They are only truly great who are truly good. G. Chapman
They are slaves who fear to speak for the fallen & weak.
They are slaves who fear to speak for the fallen and the weak.
They are so incredibly in Holland. - Joel Robinson
They are wax replica's sir. - Kryten
They are'nt hot flashes, they are power s**&%$#@!*NO CARRIER
They aren't called Mickeysoft for nothing !.
They aren't dead. They're metaphysically challenged!
They aren't dead...they're metabolicly absent!
They aren't dead...they're metaphysically challenged!
They aren't evil...just stupid.
They aren't supposed to work that way, are they?
They asked me what I did. --Rimmer. I said you were a shelf. --Lister.
They asked me what I did. I said you were a shelf.
They ate the lemur! - Crow croaks sadly
They authorized extreme sanction against a civilian? - Sheridan
They beamed down - Mike
They blew the Bronx away.
They blew the Bronx away. . .
They blew the budget on bongo players - Mike
They blewed it up before we found out what it was - Crow
They bomb our nation's hobos - Crow on exploding railroad
They bought that from the New Zoo - Crow on moon buggy
They build statue to Zathras, give Zathras own Fido echo!
They built a new church and had the organ transplanted.
They built an information superhighway, but I can't find the on ramp.
They burned Mickey Mouse! Oh well there's one in Fla -Crow
They call 'em "roachclips" because "potholder" was taken.
They call That a "SMALL" demonstration? - Riker
They call him Dick for short, but not for long. . .
They call it WINDOWS 'cause it breaks so easily !
They call it a medium because it is rarely well done.
They call it the `Bonehead manuver'. No offence. - Cmdr. Ivanova
They call me Blue Suede Schubert, the king of the bop -- The Rutles.
They call me Cuban Pete, I'm the king of the rumba beat!
They call me MISTER Pig. Pumbaa
They call me MR. Tuvok!
They call me Mike Slammer on the keyboards.
They call me Mr. Tinker Train! -- Ozzy Osborne
They call me an Electrician.
They call them blonde jokes. They used to call them Annette jokes.
They call them blonde jokes. They used to call them Orville jokes.
They call this the 'Triple Eve Arden' - Mike
They called Sly STONE! - Crow on voodoo girl's makeup
They called him the "De-Railer". -Crow
They called it Windows cuz Bill won't let 'em call it Gates
They called me a madman! I'm not mad at anyone!
They called me mello' yello'...........
They came for the gays. I was silent because I wasn't gay.
They came for the gays. I was silent because I wasn't gay.
They can have my broadsword when they pry it from my cold dead fingers
They can have my gun when they pry it from my cold dead fingers.
They can have my guns...158 grains at a time!
They can have my modem. When they pry it from my cold dead fingers.
They can have my modem. When they pry it from my cold dead hands.
They can only impose, prevent and deny if the people say they can.
They can still here you.
They can#############Tagline Censored#############out even trying !
They can't fire me! Slaves HAVE to be sold!!!
They can't fire me, Slaves have to be sold!
They can't fire me, Slaves have to be sold!!!
They can't get rid of Morn before he speaks!!!!
They can't paddle me! I'm a girl! - Susie
They can't prove a thing, and you know it! - Dire Wolf
They can't say 'richter' - Tom on Japanese scientists
They can't see what's under their noses when it's above their heads.
They can't understand. They truly believe the lies - Tori Amos
They certainly are...fit. - Riker
They chipped off Tammy Faye's makeup and found Jimmy Hoffa!
They claim your trip to Heaven's nearby
They communicated by tap-dancing and farting. - "Breakfas
They could hide in Chris Makepeace's hair - Joel
They couldn't hit an elephant at this dist ..... Gen. J Sedgwick
They couldn't hit an elephant at this dist...
They couldn't hit an elephant at this dist... -- last words of General Sedgwick
They couldn't see the stopsign - took a turn for the worse
They crated me in my sleep! - Frank, on Hawkeye & Trapper
They cured my MPD. Where am I, now, when I need me?
They cured my schizophrenia, but where am I now that I need me?
They decided to go to Shakeys! - Crow on girl's boobs
They decided to stay together for the sake of the cat.
They decorated the airport in an airplane motife - Tom
They did the runway in Spanish tile. Good grouting - Crow
They didn't want it good, they wanted it Wednesday. -R.Heinlein
They didn't want it good, they wanted it yerterday.
They died because they were incompatible. --Banjo Man.
They died in their sleep What a terrible way to die.
They died well. -- Worf
They do not love that do not show their love.
They do whatever their Rice Crispies tell them to do.
They don't call John Caradine The Voice for nothing - Tom
They don't call it Fight-O-Net (tm) for nothing!
They don't call it a BS degree for nothing!
They don't call it the poop deck for nothing.
They don't call me "Magic Fingers" without a good reason!
They don't call me good for nothing!
They don't call this a MODUMB for nothing! :^)
They don't come any nunner - Crow on nun
They don't dance line Carmen anymore ---'---,---@
They don't eat, don't sleep, they don't feed, they don't seethe.
They don't force Beer on minors who can't think for themselves.
They don't have to give him a name - "The Doctor" worked for THAT guy!
They don't make better nurses anywhere. - Col. Potter
They don't make nostalgia like they used to.
They don't make nostalgia like they used to...
They don't print any dirty books in Braille! --Tom Sullivan.
They don't realize I'm a card -carrying genius." - - Calvin
They don't see me, they see the badge. - Garibaldi
They don't seem to be in a hurry. -- LaForge
They don't take kindly to insults.
They don't yell, they don't tell and they're grateful.
They dug a pit in my path but have fallen into it themselves
They end up busting the zombie for tax evasion - Tom
They even bash the fans in rec.autos. sport
They fear what they do not understand...what they fear they destroy ..
They fear what they don't understand and attack what they fear.
They fell off the hashbrowns - Crow
They forgot t'include VBRUN300.DLL in the Mars Probe Path
They forgot to include VBRUN300.DLL in the Mars Probe Path
They found the Tree of Interminable Dialogue - Mike
They get the Family Channel on the ring - Tom
They got seven toes on each foot - Joel on hicks
They got stuck up in that big blueish black thing... - Timone
They got the library at Alexandria, but they're not getting mine!
They got the library at Alexandria, they're not getting mine!
They gotta go pick up Goober - Crow
They guy's got a good set of inscisors.- Richie Ryan
They had a mad posh for hats-- Crow T. Robot
They had computers in Eden. Eve had a Apple and Adam had a Wang.
They had to drag me kicking and screaming into serenity.
They had to throw a bucket of water on me & the Mrs. - Col. Potter
They had to tie a steak around my neck so the dog would play with me.
They hate me, don't they.-Just your guts, sir. - Radar to Frank
They have a book that lists locations and the such.
They have a proud tradition of accepting only large bribes.
They have a word for women who use "rhythm": Mothers.
They have an anti-gravity force field. -Alien LUCKY DUCKS! -The Tick
They have enough for Streisand tickets -Mike on fortune
They have learned nothing and forgotten nothing. Talleyrand
They have more possessions than they can use.
They have obsessive/compulsive behavior - Tom on kids
They have sharpened their tongues like a serpent - Psalm 140:3
They have sown the wind, and they shall reap the whirlwind.-Hos. 8:7
They have started bombing Mars. I repeat, they're bombing Mars.
They have the right to defend themselves. - G'Kar
They have trailer parks there - Crow on Venus
They hired Sacajewea to be their guide...
They hired a temp by name of Mike, a reg Joe they didn't like- MST3K03
They just don't make good cough syrup anymore.
They just don't make nostalgia like they used to.
They just pretend to pay us, so we just pretend to work.
They just won't let you be
They keep us down and they keep us out -- Shakespeare
They kiss like dolphins! - Crow T. Robot
They know enough who know how to learn.
They know everything I know. - Data
They laughed when I said I'd be a comedian. They aren't laughing now.
They leave orphaned bread on people's doorsteps? - Tom
They leave these things everywhere - Tom on dead girl
They lie and then we lie. Where does it end? - Hawkeye
They live at Marcus Welby's house? - Tom
They live, we sleep.
They lived and they died; they prayed to their gods.
They lived in two worlds. They loved in one.
They love those bell bottom pants - Joel on crew uniforms
They made nasal/labial troughs much bigger back then-Crow
They made us eat porridge. It was a gruelling experience
They made us eat porridge. It was a gruelling experience.
They make love at the drop of a hat. Any hat. * Geordi
They make love at the drop of a hat. -- Geordi Any hat. -- Tasha
They make love at the drop of a hat. Any hat. - Geordi LaForge
They may be a little slow in responding but the information is there.
They may be listening.-X-Files
They may do some morefolk dancing. - Brad
They may not kill us, but my driving might. - Mike Donovan, V
They mean to win Wimbledon!
They meant it affectionately. - Q
They might harpoon us, but they ain't gonna pick us up on no RADAR.
They missed. They never miss. - Delenn
They must have hyperjets on that thing!
They must have looked like roast chicken. --Rimmer.
They must have looked like...a roast chicken!
They must have over-shot us by a week and a half!
They must've taken out an insurance policy on me. -Calvin
They need Rogaine - Crow on kids with crew cuts
They need heavier dirt - Crow
They need to invent the stop light - Frank
They never fail who die in a great cause.
They never fail who die in a worthy cause.
They never let you live it down - Nero
They never let you live it down. One little mistake! NERO
They never let you live it down. One little mistake.
They only come out at night.
They only come when there is money in it for the city!
They open with such strong imagery - Mike
They operated just in time. Another day and he would have recovered.
They pass through you like a ghost --U2
They pay me to think... As long as I keep my mouth shut.
They politics like ours profess, the greater prey upon the less.
They promise us Windows 95 and what do we get? *Bob*!
They promise us Windows 95 and what do we get? Bubba!
They promised a drug free America. Where's our free drugs?
They put certain things in cafeteria food so I don't eat there.
They put me in a corner and made me read taglines from 1979!
They ran him for Congress. It was the only way to get him out of town.
They read love poetry and duck a lot. -- Worf
They really should switch to decaf. Dot, Animaniacs
They refuse to acknowledge I exist!"-Longshot "They're manikins"-Lady
They rejected me & that fueled my madness - Dr. F
They reproduce at will...and brother, do they have alot of will! -McCoy
They request to speak about *computer;error* tags 1/2:
They robbed his evil cow.
They run a successful porn shop - Tom on girl's parents
They run like Shemp - Joel on awkward heroes
They said "Grin and Bare it" So I grinned and bared it...
They said "laugh it could be worse" ; I did and it was !
They said I couldn't do it, but they were right.
They said I was pretty enough, but didn't have a *lick* of sense!
They said it couldn't be done and I proved it!!
They said it couldn't be done... so I didn't do it.
They said it sang to them. - Ivanova
They said it talked to them in their sleep. --Ivanova.
They said protect and you'll survive..
They said they can't give *official* help. - Sheridan
They said they saw you with Michael Jackson....in bed.
They said this would save time.
They saved Hitler's brain! It's living in Jerry Falwell
They saved Hitler's brain, it's living in Jerry Falwell.
They saved Stalin's brain - it's living in Bill Clinton.
They say Confucius does his crossword with a pen. - Tori Amos
They say I'm crazy but I don't agree.
They say I'm crazy but I haven't the time
They say I'm crazy but I haven't the time...
They say a secret is something you tell one other person --U2
They say act your age, and when you do they get mad
They say give your money to God, but they give you THEIR address.
They say give your money to God,but they pass THEIR collection pan.
They say he's pretty weird looking. - S. Ipkiss
They say power corrupts, but we _need_ electricity!
They say that John is `Just Nuts' about Lorena.
They say that nobody expects a unicorn horn to rust.
They say the sun is sometimes eclipsed by a moon --U2
They say the wages of sin is death. I wish you'd get paid!
They say they're from the IRS & they're here to help...
They say, "Act your age!" {And when you do, they get mad}
They sent a case of pipe cleaners to MacArthur's table?! - Henry
They shall not grow old, as we that are left grow old,
They shall see me and remember who is the REAL King Under the Mountain!
They shot my spare turtlenecks! -- Joel Robinson
They should get Schneider to do this -Crow on slow worker
They should relax, they're TWO TENTS - Tom
They should set a place for Eraserhead - Mike
They specialize in slinky clothing - Crow on Chinese girl
They spent $400 million advertising Win 95. So wha
They spread us religious fellows rather thin over here. - Mulcahy
They start kissing there's gonna be hair everywhere -Mike
They stole my tagline! Look, Ma, I'm a WRITER!
They stroll into places where no sane Garou would walk alone
They suffer as few have suffered, for they cannot find Valhalla.
They surf, those who only stand on waves....
They talk like Speed Racer cartoons - Tom on bad dubbing
They talk of my drinking but never my thirst <Scottish proverb>
They talk of my drinking but never of my thirst.
They taste salty. - Cassidy Wright
They tell me you're a madman. Ned Beatty
They that know no evil will suspect none.
They that sow in tears shall reap in joy - Psalm 126:5
They that sow the wind, will reap the whirlwind.
They think I need round the clock protection - Mike
They think I'm crazy But I know better.
They think so small, they use small words.
They think we're dead and they're having a party? --Ro.
They threw me out of my subdivision, Tom said distractedly.
They threw me out of my subdivision, he said distractedly.
They told me I was gullible .. and I believed them.
They told me I was gullible ... and I believed them!
They told me to get a life -- I got a computer instead.
They told me to get lost.... so I accessed the Internet!
They told me, Heraclitus, they told me you were dead.
They took "gullible" out of the dictionary! Look it up!
They took your dog home in a people bag. - Blake to Radar
They tore holes in that small metaphysic we had woven over the ages.
They torture flesh, but it's your mind that really hurts.
They treat sex like we treat a handshake - Dr. Franklin
They tried and failed? They tried and died.
They tried to sell us egg foo young...
They tried to sell us egg foo yung - Napkin Cole
They turned away, until we were only memories.
They turned me into a Borg. -A Borg? -I got better...
They turned me into a Borg. A Borg? Well, I got better
They turned me into a Borg.-A Borg?-I got better...
They used to call it puppy love, now it's doggy style.
They walk in the door. (Technically, Quark says, "One of the high
They want us to do the scene over again - Mike
They wanted to increase the odds of breading a P12 or higher - Telepath
They wanted to increase the odds of breading a P12 or higher.
They washed up at a Klingon Language Camp?
They washed up in a Klingon language camp - Tom
They went rushin' down that freeway, messed around and got lost.
They were forced to eat Robin's minstrels.
They were going to send me to a leper colony. - Michael Dorn.
They were gonna make me God but I'm too good looking-Crow
They were horrified by what they found - Crow
They were laughing at me! - Rimmer
They were so nice until I bought the computer.
They were...BOOGERS! - Crow on odd psychic phenomenon
They weren't laughing at me! They were laughing TOWARDS me! - Homer
They who dig pits shall end falling into them.
They who drink beer will think beer.
They who forgive most shall be most forgiven.
They who have nothing to trouble them, will be troubled at nothing.
They who speak the loudest always have the least to say.
They will know us by our syllogisms.
They will never buy the cow if they can get the eggs for free. -K. Bundy
They won't know she's on drugs... they'll just think she's stupid.
They work with their women. And force them to wear clothing!?!
They wouldn't come here in strange alien forms.
They'll declare peace and then where will I be? - Hoolihan
They'll have to pry my computer from my cold, dead fingers.
They'll just find a statue standing where the statue got you high...
They'll never catch up, they're 2 sound stages away -Joel
They'll not only benefit humanity, they're tax deductible. - Frank
They'll release Windows . after . loads.
They'll release Windows 3.2 when 3.1 finishes loading.
They'll see the hypocrite in you, it just takes time.
They'll sniff everyone - Crow on school kids
They'll take away my gun when they pry my cold, dead fingers off it
They'll want a picture of me at the dinner table, Tom supposed.
They're "fab" and all the other pimply hyperboles.
They're Earth Force. - Keffer
They're LIES I tell you.. LIES!! I don't have a sarcastic bone.
They're NOT public schools, they're government schools.
They're Pinky and the Brain! They're Pinky and the Brain!
They're STILL picking up clown noses! - Crow
They're Scott, they're Scott and the Brain...
They're Scratchy YOUR responsibility! Plotz
They're [heated] hunting socks. I have a bra like that. - Klinger
They're a bunch of knuckle-heads - Dr. F on Mike & Bots
They're after my toupee! - Mike as Pernell Roberts
They're all God's children. Some more childish than others.-Mulcahy
They're all Pentium upgradeable - if you have the money.
They're all dead, Dave.
They're all dead, Jim. It's a new record.
They're all dead: they just don't know it yet. --The Crow.
They're all employed by K-Mart - Crow on blue lights
They're all loyal to Earth, if that's what you mean - Sheridan
They're all ridiculously wealthy...and not too bright. -- Quark
They're all together ookie, the Addams Family.
They're baaack!
They're both purple... except the elephant.
They're both trying way too hard - Mike on hammy acting
They're bumping uglies! - Crow on two guys fighting
They're business people, after all.
They're called the Stives. - Delenn
They're calling for another sex maniac murder - Mike
They're car pooling for the heist - Mike
They're carving where no man has carved before - Crow
They're cheating on each other with each other! --Tom Servo.
They're coming 2 take me away HEEHEE,HAWHAW,HOHO
They're coming to take me away HA HA!
They're coming to take me away HAA-HAA HEE-HEE. They'r- Uh-Oh.
They're coming to take me away, HA-HAAAA!
They're coming to take me away, HO HO, HE HE, HA HA (1950s!)
They're coming to take me away, ha HA! They're coming to--uh, oh.
They're coming to take me away, ha ha!
They're coming to take me away, he he, ho ho, ha ha . . .
They're coming to take me away. HA HA.
They're coming to take me away.... Ahhhhhhhhhhhhhh.....
They're coming to take you away, ha ha!
They're cousins, identical cousins? Really? C'mon!
They're dead Dave. Everyone's dead. Everyone is dead Dave.
They're dead! I was only away for 2 minutes!
They're dead, Jim. I always hated those damn mimes!
They're dead, they're dead, they're die-de-die-de-de-del-dead-dead...
They're dead. All they've got left is their looks.
They're dead. --Rimmer. I was only away for 2 minutes! --Kryten.
They're deadThey're ALL messed-up.
They're dropping little liver pills - Crow on bombs
They're fighting with a salad set! - Crow
They're getting better with these 'Holy Grams' - Crow
They're going to call this the Hill/Billy administration!
They're gonna TP the house - Crow on dancers with scarves
They're gonna like Tim McVeigh in jail; he does good blow jobs.
They're gonna taxie into town & impress the chicks - Crow
They're greedy, misogynistic, untrustworthy little trolls. -Kira
They're has got to be a self-destruct mecanism in the central brain...
They're having a jumpsuit party! - Crow
They're headed to Hell - Tom
They're headhunters AND they're squeamish?!? - Crow
They're here - Delenn
They're in Schlepp Car - Mike on odd buggy
They're in the Lab-Boy-Man Love Association - Mike
They're in the dales: Mondale, Clydesdale, Chippendale . . .
They're just country boys and girls gettin' down on the farm.
They're just kobolds...
They're just lying down! -Edmund They're dead, My Lord. -Baldrick
They're just words. They don't mean anything
They're like roaches - Crow on bread men
They're looking for the Grail. I told 'em we already have one!
They're lying.
They're making a John Bobbitt TV movie! It's a 2 parter.
They're making good time, for a Lippert film- Crow
They're making such an issue about a *little* tissue. - Lorena Bobbitt
They're me! They're me! - Tom on space helmets
They're not assault weapons--they're civil defense arms.
They're not dead, they're just being INTELLECTUAL. -Mrs. Miggins, BAII
They're not flesh and blood. Not like me! - Ren Hoek
They're not leftovers, they're frozen assets!
They're numbered now. Frank, Borg 1. Harry, Borg 2. Ernest, Borg 9.
They're only Recipes.only Recipes
They're only taglines.... only taglines....
They're only trying to make me LOOK paranoid!
They're only trying to make me LOOK paranoid.
They're onto us, sister! Let's beat cheeks! - Crow as nun
They're operating under a different theology - Mike
They're playing Husker Du in space - Tom on weird beeps
They're playing in chocolate. It's the Hershey Bowl - Tom
They're playing our tapes on a television station?
They're probably gonna bomb the Grateful Dead - Tom
They're putting 2 more faces on Mt. Rushmore - Clinton.
They're resurrecting Neil Young - Mike on zombie
They're risking alot for a relatively new little pal -Tom
They're shoe mirrors. Why do you ask?
They're so cute when they're righteous
They're so smooth they're almost NOT singing - Tom
They're stealing his blue blockers - Crow
They're still using money. We've got to find some. Kirk
They're stronger than old cheese, stronger than dirt.
They're tiny, and tooney, and all make more than I do!
They're treating us like gods. - Wesley
They're trying to confuse us to death.
They're up to something. I can feel it. - Aahz
They're using the term artist here very loosely - Crow
They're wearing DANCE BELTS! Ohhh! - Crow
They're working for King Features Syndicate? - Crow
They're... Scratchy YOUR responsibility! Plotz
They've Got Guns! This Is Definitely Illegal. [ the TICK ]
They've all dyed their hair brunette ... OH, you mean the TAGLINES!!
They've all got a future in selling baldness cures - Tom
They've been coming and going, right now I'm getting them.
They've experienced the terror of assimilation.. on the next Geraldo!
They've gone potty in here!
They've gone potty out there.
They've got as much sex appeal as a road accident.
They've got nipples like us - Crow on aliens
They've got the stars for the gallant hearts.
They've got zippers on their skirts! - Tom
They've perfected the 'dial' - Mike on alien equipment
They've said *you* are the fertilizer of your family tree!
They've said *you* are the fertilizer of your family tree! ___ Blue
They've stumbled onto another room! - Crow
They've taken Jarts to the next level - Crow
They've worked themself into a state of mild concern -Tom
TheyHadFangs,TheyWereBitingPeople,IThinkTheyWereYoungRepublicans
TheyStoleFromTheRich,&GaveToThePoor,IKnowTheyWereLiberals!
TheyfightTheyfightTheyfight&fight&fightFightfightfightFihgtfightfight
Thhhaaannnkkk YOU! - Stimpy.
Thhis takline iz slitely out of cofus.
Thi i YoUg moqeM OU qgUgs
Thia tagline meets the FDA's requirement for tagline safety.
Thick as a brick.
Thick as you are...PAY ATTENTION! Scar
Thick cloud-steam rising-hissing stone on sweat lodge fire.
Thicken by Quicken...The Hamburger Helper Program from Intuit.
Thicken up runny yogurt by stirring in a lump of lard
Thickheadedness is a very common failing...
Thief is so ugly. I prefer Creative Acquisition Specialist.
Thief! Crook! Call the Tagline Police! (ATDT911)
Thief!!!!! Ohh!!! ... not!!! ... I found it on the ground!!!
Thief: "There's somethin' behind the door." Mage: "Toss the dwarf in!"
Thief:"There's something behind this door" Party:"Toss the bard in!"
Thief? No, I'm a "Creative Acquisition Specialist"...
Thier job done, the EchoMaquis vanish, to strike again when needed...
Thieves do it from behind.
Thieves DO IT when you're not looking.
Thieves Do It Furtively.
Thieves and mushrooms do it in the dark.
Thieves demand your money or your life -- women want both!
Thieves demand your money or your life...Women want both
Thieves demand your money or your life; women require both.
Thieves demand your money or your lifewomen want both.
Thieves do it from behind.
Thieves do it in the dark.
Thieves do it with dexterity.
Thieves do it with their hands in your pocket.
Thieves do it with their lock picks.
Thif if why yooo down't type wiff yowr mowf fuwl!
Thigh Master is now DIE Master! - Dr. Forrester
Thin Elvis: "Love me tender..." Fat Elvis: "Love meat tender..."
Thin may be in, but fat's where it's at!
Thin: "nutritionally disadvantaged"
Thine's Law: Nature abhors people.
Thing tried to jump me so I had to kill it -Tom on puppet
Thing, you're a handful. Morticia Addams
Thingamabob...a mechanical gadget of bizarre origin and unknown applicability.
Things B.C. might say to his wife: No really, I'm still President!
Things NOT to ask a demon prince: "Oh yeah? You and what army?"
Things Not to Say to Dr. Samuel Beckett #57: "Get a life!"
Things Reagan does remember: That Jodie Foster is a real troublemaker.
Things Reagan does remember: Where Nancy doesn't like to be touched.
Things To Do At Parties: Bob Frapples
Things To Do At Parties: Bob Frapples*
Things are always at their best in the beginning. - Pasca
Things are always happening to me, said Tom incidentally.
Things are better here! - Rimmer
Things are getting kinda gross...
Things are getting so bad muggers won't go out alone.
Things are getting worse. Please send chocolate.
Things are gradually falling into place on top of me.
Things are more like they are now than they ever were bef
Things are more like they are now than they have ever been. --Gerald Ford.
Things are more like they are today than they ever were before.
Things are more like they used to be than they are now.
Things are more like they used to be than they ever were before.
Things are much more like they used to be then they are now!
Things are never as good or as bad as first reported.
Things are never quite as scary when you've got a best friend.-Calvin
Things are not always as they seem.
Things are not always as they seem. MANDRAKE
Things are not always what they suppose too be! ---
Things are not as bad as they seem - they're worse
Things are not as bad as they seem - they're worse!
Things are often what they seem
Things are often what they seem...
Things are so bad now that the Poles are telling economist jokes.
Things aren't always what they seem to be Wesley.
Things can only get better!
Things cannot disappear; they can only change. -J.W. Von Gothe
Things could be so different if they weren't as they are.
Things could be worse.. My last name could be #AL#!
Things could only be worse in Cleveland.
Things don't bug you if you don't think about them. - Calvin
Things economists don't teach you #47: the sun is a free lunch.
Things equal to nothing else are equal to each other.
Things equal to nothing, are always equal
Things forbidden have a secret charm. - Tacitus
Things get better with age - I'm nearing magnificence.
Things get better with age. I'm approaching perfection.
Things get worse under pressure
Things get worse under pressure.
Things go better when gravity is on your side.
Things go better with Coke!
Things go better with the Buddha.
Things go from bad to worse. Then they repeat.
Things go on as they always have, getting weirder all the time.
Things go right gradually, but things go wrong all at once.
Things go right so they can go wrong.
Things happen fast, history books add a chapter a week.
Things have been set in motion and I don't have much time - Delenn
Things have gotten worse, send chocolate!
Things in this room do not react well to bullets.
Things like this will not be forgotten so easily.
Things past redress and now with me past care.
Things said in anger are often said for protection.-ML
Things suddenly became poignant - Crow
Things that go Bump on the Keyboard.
Things that go CONNECT 9600 in the night...
Things that love night love not nights such as these.
Things that make you go "Aarrghh!"...
Things that make you go 'Hmmm....'
Things that make you go 'Hmmmm....'
Things that make you go OOoooOOOOooHHHH JEEEZZUUUUSSS!!!!
Things that make you go hmmm.
Things that must be together to work usually can't be shipped together.
Things that must be together to work, usually can't be shipped together.
Things that suck: Rush Lne in every crowd.
Things to Cook Meat In: Stu Potts
Things to Cook Meat In: Stu Potts
Things to do today: Exhale, inhale, exhale. Ahhh.
Things to do when you're grumpy: Leave a cow on your neighbor's porch.
Things to do when you're grumpy: Smoke large black cigars.
Things to see, places to go, people to do.
Things too stupid to be spoken are sung.
Things we'd like to see: Tasha Yar in a Data Entry position.
Things will be bright in P.M. A cop will shine a light in your face.
Things will be brighter tonight. A cop will shine a ligh
Things will be brighter tonight. A cop will shine a light in your face.
Things will be fine as soon as you realize that I AM GOD AND YOU (TAG) ARE IT!!
Things will get worse before they get better, if they do.
Things will get worse before they get better.
Things won are done, joy's soul lies in the doing.
Things won't get any better, so get used to it.
Things work better if you plug them in.
Things work better when you plug them in and turn them on.
Things work better when you plug them in.
Things working well, no problems. Time to upgrade.
Things worth having are worth cheating for.
Things worth having are worth stealing.
Things you never hear people say: "Please saw my legs off."
Things you never hear people say: 'Hand me that Piano!'
Things you never hear people say: 'Hand me that Piano!' - Jack Butler
Things you never hear people say: Please saw my legs off.
Things you never hear people say; "Hand me that piano."
Things you'll probably never see: Kosh taking a leak.
Things'll be brighter tonight. A cop will shine a light on y
Think "HONK" if you're a telepath
Think "HONK" if you're a telepath.
Think "Honk" if you're telepathic.
Think Geco! It may be a new experience for you.
Think He! It may be a new experience for you.
Think I impressed the old fart - Tom
Think I like being stuck in limbo with you? -Holo Clown
Think I'll get some blue ribbon just in case.
Think I'll go to the fridge and get nothing out again.
Think I'll put this woodchuck on my head - Tom on wig
Think I'll slip on down to the Oasis.
Think I'll stroll to the front & see how the shooting's going.-Hawk
Think I'll throw pig's blood on the wall - Mike
Think I'll walk down Certain Doom Lane - Mike
Think I'm pretty? -Joel as teen boy to hero over campfire
Think about it child, in time you will see that I am right! <BLAM>
Think about it. - Aahz
Think about it...now _CONSULTANTS_ do Windows.
Think again...[fdsk] your brain cells.
Think and you won't sink.
Think back to the days when life was Care free, Tax free & Fat free-MR
Think back to the days when life was Care free, Tax free & Fat free.
Think big thoughts, but relish small pleasures!
Think big. Pollute the Mississippi.
Think carefully before wishing, @FN@. It might just come true.
Think carefully before wishing, YOU. It might just come true.
Think carefully before wishing, it might just come true.
Think for Yourself or the Government will do it for you.
Think for myself? Sure. Now, what would Rush be thinking...
Think for yourself - You're being brainwashed.
Think for youself, or the government will do it for you.
Think globally, act locally
Think guns cause murder? Why not at shooting ranges?
Think hard now! Which one is Shinola?
Think hard now, Orville, which one is Shinola?
Think hard now, he, which one is Shinola?
Think hard now. Which one is Shinola?
Think hard, now! Which one is Shinola?
Think harder, Homer. Bart Simpson
Think he's getting paid "scale"? - Joel on dinosaur
Think honk if you're a telepath.
Think how the trellised rose... unhampered climbs.
Think it can't get worse? You're overlooking something!
Think it can't get worse? You must not understand it yet.
Think it'll work? - It'll take a miracle.
Think it's about time for the heheh Entertainment? - Crow
Think like a cat: Make friends with your enemies enemy.
Think like a cat: Make friends with your enemy's enemy.
Think like a cat: Make friends with your enemies enemy.
Think like a cat: Make friends with your enemy's enemy.
Think like a computer...digitize yourself.
Think like a man of action and act like a man of thought. -- Bergson
Think like a man of action, act like a man of thought.
Think like a programming exec. Start by lowering your IQ by 15 points.
Think like a wise man but communicate in the language of the people.
Think mangohazelnutcookiesespressobelgianchocolate...ice cream!
Think medicine's expensive now? Wait til it's "free".
Think much, speak little, and write less.
Think not that I am come to annul the Torah or the Prophets:
Think of Antsy's buns ... that oughta' help!
Think of DOS as an apple and OS/2 as trees of oranges.
Think of a jiggs dinner & a mug up on the rocks down the bay.
Think of all we could learn from it.
Think of doubt as an invitation to think.
Think of it as Evolution in action.
Think of it as an electronic joy-buzzer for your mind.
Think of it as being barely dead.
Think of it as evolution in action
Think of it as evolution in action -- Niven/Pournelle
Think of it as evolution in action! --Niven and Pournelle.
Think of it as evolution in action.
Think of it! With VLSI we can pack 100 ENIACs in 1 sq. cm.!
Think of me when you hear a clock strike--The Doctor
Think of something, if it's really wierd somebody probably did it
Think of the corpse he'd make. - Worf ( about Q )
Think of your family tonight. Try to crawl home after the computer crashes.
Think or die, sheep!. --Jack Butler.
Think passing is entertaining? Sit next to a freeway..!
Think randomly. Act deranged. But then, who's acting?
Think she'll know the difference if I wore the Batman suit?
Think simple....
Think sometimes..
Think swastikas look cool? The real nazis run your schools - J.Biafra
Think the Gods are in a meeting right now - Mike
Think the moderator police will throw me in chains for this?
Think there's 110 coronets right behind -Tom on dino roar
Think they fantasize about wearing business suits? - Crow
Think twice before accepting the lowest bid!
Think twice before speaking, but don't say "think think click click".
Think twice before speaking. But don't say "think think click click".
Think twice before speaking. But don`t say think think click click. This
Think twice before you think.
Think unsexy thoughts, think unsexy thoughts...
Think we found the weak link in the security - Mike
Think we hit a MOOSE - Mike as car hits muscular guy
Think we'll freeze to death before the jackals get us? --Joel.
Think what you want, do what you may...
Think you can hold off a vampire with a sunlamp?
Think you got it bad. My other PC is an Osborne.
Think you look funny with lab goggles? How'd you look without eyes?
Think you used enough dynamite there, Butch?
Think you're confused now ? Try using EZ-Reader w/ EDLIN!
Think you're confused? Wait till I explain it.
Think you're confused? Wait until I explain it.
Think you're confused? Wait until I explain it.
Think you're too small to matter? Try sleeping with a mosquito present!
Think your computer is slow? Try Windows.
Think! It may be a new experience for you.
Think! It may hurt, but it pays off over time.
Think! While it's still legal!!
Think! While it is still legal.
Think, brain! Come on! - Mike
Think. Think. Think. -Winnie the Pooh
Think. think think. Think said Pooh, and got a headache.
Thinker: a person who aims where your head ought to be.
Thinkers travel in cognito.
Thinkign quickly, Spock opens the can of peas with his ear.
Thinking Of Suicide? Call our 24 Hour Hotline. Open 9 AM - 5 PM.
Thinking about it, allows it to happen.
Thinking doesn't seem to help very much. - Kurt Vonnegut
Thinking has a tendency to give me a headache.
Thinking ill of someone can be a two-way street.
Thinking is wise, planning is better, doing is best.
Thinking like me is a sign of extreme intelligence. :)
Thinking more about it; I have never seen yellow bananas on a tree!
Thinking of your blue-shadowed silk/is music.-W.Stevens
Thinking outside the box.
Thinking quickly Spock opens a can of peas with his ears.
Thinking quickly, Spock opens a tin of peas with his ears
Thinking quickly, Spock opens the can of peas with his ear
Thinking sucks! --Beavis
Thinking too much can give you wrinkles. - Malibu Stacy
Thinking up new recipes, now THAT is hard.
Thinking up new taglines, now THAT is hard.
Thinks 'Doing A Clinton' is a 20's dance.
Thinks E=MC^2 is a rap star.
Thinks Moby Dick is a kind of venereal disease.
Thinks a Perot is better than a Bush.
Thinks at 5 baud.
Thinks cellular phones are carbon-based life forms.
Third Law of Advice: Simple advice is the best advice.
Third Law of Advice: Simple advice is the best advice.
Third grader terrorizes FIDOnet! Film at 11...
Third law of dieting: When an Oreo breaks, the calories fall out!
Third law of dieting: When an oreo breaks the calories fall out.
Third law of library science: Every book its reader.
Third level of Hell, please - Crow as priest in elevator
Third of Five, six of one, half a dozen of the other
Third rate romance, Low rent rendezvous.
Third star on the left and straight on til morning
Third star on the left and straight till morning!
Thirsting for knowledge on a very dry planet.
Thirsting for more...Go AWAY...this message is over!
Thirteen questions, each one an endless hole.
Thirty Buffalo Shots Over Tokyo! - Tom
Thirty Orcs in a group? I cast fireball.
Thirty cents short of a quarter.
Thirty minutes of begging is *NOT* considered foreplay.
Thirty seconds to meltdown. Phew! Saved by the bell!
Thirty straight hours, What is that? a metric day?! - Ed Kammerer
Thirty-seven year old women who look 22 *are* wonderfully favored!
This tagline is justified .
This (party)is a (party) subliminal (party) tagline
This *** tagline has *** a lot of *** bugs in *** it ...
This *could* be a match made in Heaven
This *is* my other computer.
This *used* to be an anti Windows, er, pro-OS/2 tagline :)
This ///\oo/\\\ tagline has ///\oo/\\\ some ///\oo/\\\ bugs in it..
This Absolon gan wype his mouth ful drye:
This BAUD'S for You
This BBS has achieved Air superiority.
This BBS is ancient. Some say from the echocene.
This BBS su*&^%$#@!NO CARRIER.
This BBS will self-destruct in five minutes.
This BUDD's for You!
This Bud is for you!
This Bud's for you, said Tom lightly.
This COMM program works great, but what does ALT-H dxOU
This CPU is clean-squeak open and ICE free!
This Charlie Brown must have been a very wise man.
This Charlie Brown must have been a very wise man. -- Riker
This Completes Your Request To The Tagline Addict.
This Computer has achieved *Warp* superiority.
This Computer is Protected by a 357 Magnum. You Guess What Key !
This Constitution, ... shall be the supreme Law of the Land.
This Country Needs Group Therapy.
This Echo gets stranger and stranger.. Oh, that's Myra.
This FUBS thing might actually work after all...
This Father's Day, give him an inflatable Lorena Bobbitt doll!
This Fellowship is emotional dynamite. (Bill W, p79 AACA)
This Fortue Examined By INSPECTOR NO. 2-14
This FrontDoor Opus BlueWave setup is fantastically convoluted.
This I whispered, and an echo murmured back the word, "Lenore!"--
This IS a full time job isn't it?
This IS a really big garage - Mike
This Is A Stephen King Nation, Not A Robert Heinlein Nation -- G.
This Is A Test To See If You Know How To Read Taglines
This Is My Recipe. Go snag Your Own!
This Is My Tagline. Go Get Your Own!
This Is My Tagline. Go Steal Your Own!
This Is Your CPU -,- This Is Your CPU On Windows !@%#
This Kansas song made me so sad - Mike as teen punk
This LAN is your LAN This LAN is my LAN
This LAN is your LAN, this LAN is my LAN!
This Life is a test...It is only a test....
This Lonely Tagline Seeking A Mate
This Lonely Tagline Seeking A Message.
This Lonely recipe Seeking A Mate.
This MESSAGE is the OPINION of the FidoNet USER ONLY!
This MSG created by pouring warm tea on a Ouiji board.
This MSG written by pouring warm tea on an Ouiji board.
This MUST be fun; surely I wouldn't do it for *aggravation* !!!
This May Tell You More Than You Care to Know (g)
This Message Printed on 100% Recycled Electrons
This Message last seen leaving the Great White North.
This Message was written using BLUE WAVE 2.12
This Mind Left Intentionally Blank.
This Net doesn't require mental competency for me to post Taglines! >;->
This New Year I resolve to make no resolutions.
This Old Pyramid - With Bob Vilahotep
This Old Starship - with your host, Montgomery Scott.
This PBS tagline is commercial free!
This R2 unit of yours seems a bit beat up. Want a new one?
This Reality is Null and Void.
This Recipe Copyright 1994 (C) All rights reserved.
This Recipe also snagged by Silly Little Mail Reader!
This Recipe brought to you by Intelligence INC.
This Recipe came last in the `Original Recipe Comp.'
This Recipe cancelled due to lack of interest
This Recipe censored by the moderator <snicker>.
This Recipe compliments of the BatComputer.
This Recipe contains a virus: go ahead and copy me!
This Recipe contains no cholesterol.
This Recipe erased *blush*.
This Recipe for Sale
This Recipe hand-crafted by
This Recipe has been cruelly tested on cute little furry animals.
This Recipe has been electrified with 20,000 volts!
This Recipe has no additives or preservatives!
This Recipe has trouble with Tribbles.
This Recipe invisible to all whose I.Q. exceeds mine.
This Recipe is Closed for Remodeling
This Recipe is Death-Trapped. Stay Away.
This Recipe is Evil, Evil, Evil. Eat at own risk!
This Recipe is FREE in specially marked messages.
This Recipe is Serial # 2377/AFR-1104.991
This Recipe is a charmer.
This Recipe is a figment of your imagination
This Recipe is a lie.
This Recipe is being shipped to our enemies overseas.
This Recipe is boring
This Recipe is copy protected
This Recipe is encouraged where prohibited.
This Recipe is fleeing for it's life.
This Recipe is indecipherable.
This Recipe is inoperative. Please try another.
This Recipe is listed for no good reason!!
This Recipe is new, witty, and snagged <8> times.
This Recipe is old, dull, and not worth snaging.
This Recipe is part of your twisted imagination
This Recipe is so old it has whiskers!
This Recipe is under repair. Thank you.
This Recipe made from 100% recycled electrons.
This Recipe made of 100% unknown Beliefs.
This Recipe not sponsored by Pepsi in any way.
This Recipe now supports Soundblaster!
This Recipe predated the Wheel...
This Recipe protected by an attack cat.
This Recipe self destructs when you hit <ENTER>.
This Recipe stinks. (Scratch N Sniff)
This Recipe utterly lacks class, but is very cute.
This Recipe void where prohibited by law.
This Recipe was blank before you looked at it.
This Recipe was cruelly tested on small, furry animals.
This Recipe was missing, so I filled something in...
This Recipe will appear 1/2 hour later in Newfoundland.
This Ronnie is a Veronica.
This San Miguel is just for Orville Bullitt.
This Scud's for you!
This Space Reserved For Handicapped Mice...Please log-off !
This Suitcase For Hire! - Crow
This Sysop runs on Old No. 7.
This System has achieved Air Superiority...
This T.A.G.-line not sponsored by Pepsi in any way.
This TAG was made w/ 94% recycled pixels. Please help our environment
This TAGLINE stops at all railroad crossings..!
This Tag Line no verb.
This Tag line is HOT!
This Tag line is Stolen.
This Tag line is self referencing!
This Tag self destructs August 19, 1994!
This TagLine is BogusWare, it Will disappear in a min\SLM
This TagLine is Closed for Remodeling
This TagLine is Closed for Remodeling.
This TagMine will self-destruct in 30 seconds.
This Tagline *appropriated* by: Patrick Long.
This Tagline *appropriated* by: Orville Bullitt.
This Tagline ====>><<==== Loves That Tagline
This Tagline Baked Fresh Daily In Our Own Ovens!
This Tagline Censored - N.E.A.
This Tagline Censored by The Citizens For Decency.
This Tagline Closed Captioned for the Hearing Impared.
This Tagline Is Officially For Losers
This Tagline Is Politically Correct...Right, Guys?
This Tagline Stolen by GoldED...
This Tagline Thinks It's Invisible
This Tagline Under Surveillance by the Pinkerton Agency !
This Tagline Will Self Implode -- <mooB>
This Tagline belongs to Seymour Twatt, Gyneachologist.
This Tagline brought to you by Intelligence INC.
This Tagline capable of evading high speed persuit
This Tagline causes cancer take it, I dare you!
This Tagline censored by the Moderator <*snicker*>.
This Tagline contains 100% post-consumer electrons.
This Tagline contains a virus: go ahead and copy me!
This Tagline contains no cholesterol.
This Tagline dispenser temporarily out of order.
This Tagline erased *blush*.
This Tagline exploits the illiterate.
This Tagline filmed before a live studio audience.
This Tagline for Sale
This Tagline for Sale inquire within.
This Tagline for Sale.
This Tagline has <FN0RD< words.
This Tagline has a security lock... But where is the key?
This Tagline has been CENSORED for telling the truth.
This Tagline has been cruelly tested on cute little furry animals.
This Tagline has been pre-stolen, for your convenience.
This Tagline has been removed by U.S. Customs.
This Tagline has trouble with Tribbles.
This Tagline is Copypro<>&* <Sector not found>
This Tagline is Copypro<<&* <Sector not found<
This Tagline is Copyrighted,Trademarked,Registered,Dumb.
This Tagline is Death-Trapped. Stay Away.
This Tagline is Death-Trapped. Stay Away.
This Tagline is OFF TOPIC! (as if the rest of the message wasn't)
This Tagline is Pointless!
This Tagline is SHAREWARE! To register, please send me $10.
This Tagline is Shareware. To register it, send me $10.
This Tagline is a Quinn Martin Production.
This Tagline is a figment of your intelligence
This Tagline is a lie.
This Tagline is confused - it thinks it's a message.
This Tagline is dedicated to the raunchy, horny *animal* in all of us.
This Tagline is especially for kleptomaniacs!
This Tagline is for sale. Call 1-800-TAG-THIS!
This Tagline is illogical, captain. -Spock
This Tagline is just for you, Martin Richardson.
This Tagline is low in salt.
This Tagline is made from 100% recycled electrons.
This Tagline is new, witty, and stolen 327 times.
This Tagline is off color.
This Tagline is printed on 100% recycled paper.
This Tagline is printed on recycled pixels!
This Tagline is secured by two strips of adhesive.
This Tagline is void where taxed, restricted, or deleted.
This Tagline is void where taxed, restricted, or prohibited by law.
This Tagline made of 100% unknown Beliefs.
This Tagline may ride up with wear.
This Tagline not valid in New York.
This Tagline only uses recycled keystrokes.
This Tagline owned by John Bobb.
This Tagline protected by a Rabid Pit Bull with AIDS!
This Tagline stinks. (Scratch N Sniff)
This Tagline stolen by Carmen Sandiego.
This Tagline stolen by KWQ Mail/2.
This Tagline stolen by MegaReader.
This Tagline stolen by Off-Line Xpress (OLX)!
This Tagline stolen by SLMR 2.1a!
This Tagline stolen by Tagline Express (TLX)!
This Tagline void where inhibited by law.
This Tagline void where prohibited by law
This Tagline was blank before you looked at it.
This Tagline was filmed before a live studio audience.
This Tagline was missing, so I filled something in
This Tagline was too good -- The sysop deleted it
This Tagline was written while High on candy kanes.
This Tagline will appear 1/2 hour later in Newfoundland.
This Tagline will self destruct in five seconds 54321
This Tagline will self-destruct in 5 seconds!
This Tagline won't be installed until Tuesday.
This Thanksgiving, try a ham!
This Thing Hasn't Been Milked In Weeks, It Can Go Off Any Second - Cow
This Vacuum cleaner sucks.
This WAS a Saturday morning tradition - Crow on wrestling
This WAS a new car! <Murtagh> It still is. <Riggs>
This Week on the Promanade. The Cybermen Vs.The Borg
This XT emulator requires a 486.
This [kiss me] is a [kiss me] subliminal [kiss me] tagline!
This [send money] is a [send money] subliminal [send money] tagline!
This above all: to thine own self be true. Hamlet 1.3.78
This above all; to thine own self be true -- Shakespeare
This afternoon is favorable for romance. Try a single pe
This ain't Burger King. You can't have it your way
This ain't Dodge City, and you ain't Bill Hickock! - Quigley
This ain't as good as sex - but it's safer these days.
This ain't as good as sex---but it's safer!
This ain't no party! This ain't no disco! This ain't no f
This ain't no party, this ain't no disco.
This ain't no party, this ain't no disco..
This ain't no technological breakdown. This is the road to hell.
This ain't no technological breakdown. This is the road to hell.
This ain't no upwardly mobile freeway. This is the road to hell.
This ain't the first time, it's the way it's always been.
This aint no ordinary woman you are dealing with here!
This air! Isn't it wonderful? Katharine Hepburn
This an example of an endless loop endless loop endless loop endless loop
This aphorism would be seven words long if it were six words shorter.
This area is going to be a cloud of vapor the size of Nebraska. <Bish>
This baby's got a few surprises left in her, sweetheart. - Han Solo
This baby's got a few surprises left in her, sweetheart. --Han Solo.
This balance of power keeps ice cream in check - Mike
This banana is an orange. --Lister.
This bananna is an orange. - Lister
This basically mean no special characters like the ones you mentioned.
This battle station is now the ultimate power in the universe!
This beats a waltz with a wet ferret in a fusebox.
This birthamong the deadit brings something evil. --Samhain.
This bloody road remains a mystery..
This boat leaks, Tom said balefully.
This boat leaks, said Tom balefully.
This book ruined courtesy of Terrance "Novel in a Night" Dicks.
This book taught me how to level a town with a fireball.
This book taught my flight dragon how to level a town with a fireball.
This bounty hunter is my kind of scum. Fearless and inventive. - Jabba
This bounty hunter is my kind of scum. Fearless and inventive.
This bounty hunter is my kind of scum... X-14 should do it...
This bowling ball is not human; it can't be reasoned with!
This bug requires Microsoft Windows 3.x.
This bug's for you.
This building is so high, the elevator shows movies.
This building is so high, the elevator shows movies.
This button does nothing. Please press it again.
This button doesn't do anything. Please press it again.
This calls for a subtle combination of mathematics and explosives.
This calls for a subtle combination of mathematics and extreme violence.
This calls for a very special blend of psychology and extreme violence
This calls for a very special blend of psychology and extreme violence.
This calls for extreme measures - arm the Electric Bagpipes!
This calls for extreme measures! Arm the Electric Bagpipes!
This calls for extreme measures! Arm the Electric Bagpipe!
This calls for extreme measures. Get the electric bagpipes.
This calls for supreme retaliation - Calvin
This calls for the handyman's secret weapon: Duct tape! -- Red Green
This came from a brain damaged offline reader
This can be no trick! -- Benedict (Shakespeare)
This can be the Swayziest Christmas of them ALL! - Bots
This can't be! Artoo, you're playing the wrong message. - C-3PO
This cannot be my room because I cannot breathe ammonia.
This car handles much easier after 3 martinis - Crow
This car only needs _minor_ repairs ...
This caricature, decrepit age that has been tied to me,
This chamber has no windows and no doors.
This chicken has no beak, said Tom impeccably.
This christmas, buy your friends a Chia-Meatloaf.
This circle is you. It's like you've known me all my life!
This city has a heart as big and grimy as all outdoors!
This coffee tastes like mud! Well, it was ground this morning.
This cold water is a blessing! - Father Mulcahy
This communication (C)opyright 1995.
This communication link monitored by your Sysop
This computer display is shocking, said Tom electrically.
This computer is just a loner, my CRAY's in the shop!
This computer is so old it's coal-fired!
This computer is taking over my life!!!!
This computer protected by an attack cat.
This computer protected by an attack recipe.
This computer protected by an attack tagline.
This computer stops at RR crossings.
This computer was built by MurphyTec
This conference is a good place to HEIR out your problems!
This contest has to be the dumbest thing I've ever seen.-H. Cosell
This conversation is b-bu-bui-buil-build-buildi-buildin-building nicely.
This cooking thing IS a science ya know!
This copy of ASTG 1.1 has been unregistered for 7.5 million years.
This copy of BULLITT 1.0 is being evaluated.
This copy of Deep Thought has been unregistered for 7.5 million years.
This copy of Freddie KRUGER - Friday the 13th is being evaluated.
This copy of GEdit has been unregist*&%^ I know the workaround :)
This copy of GEdit has been unregistered for 30 days.
This copy of GEdit has been unregisters for 7 years...
This copy of Orville 1.0 is being evaluated.
This copy of PPoint has been unregistered since the 1st age of Mankind.
This copy of ProBoard has been unregistered for 31 days!
This copy of QEdit has been unregistered for 9,458,142,095,003 hours.
This copy of QEdit has been unregistered for 9,864,331,752,146 days!
This copy of planet Earth has been unregistered for 4 billion years.
This copy of reality has been unregistered for 18 years.
This copy of reality has been unregistered for 4 billion years......
This copy of reality has been unregistered for 46 years..
This could be a setback for pasty white skin - Crow
This could be true it depends on what you were being carfull of.
This could be what you'd call a command decision. - Col. Blake
This could get nasty Captain!
This could get quite interesting. <G>
This could make you puke, Hot dogs that have names like Spot and Fido.
This country belongs to the people who inhabit it. - Lincoln
This country has the best politicians money can buy.
This country has turned into Gladys Kravitz from Bewitched.
This country needs as many Scouters as it can get.
This country needs is more unemployed politicians.
This country needs more unemployed politicians.
This country was FOUNDED by religious nuts with guns!
This country was built on freedom not socialism.
This creature, whatever it was, performed no free miracles. - The Stand
This deal's getting worse all the time. - Lando
This decision could change your life! - Rimmer's Mother
This defecation of character must cease.
This demonstrates the value of not being seen.
This dinner is made from young calves, Tom revealed.
This director has out-Wooded Ed Wood - Mike
This disaster was sponsored by Intel.
This discussion is hanging by a thread.
This does not exist.
This doesn't effect our drinking, does it? - Mike
This door Is Baroque; please wiggle Handel.
This door is Baroque, please call Bach later.
This door is Baroque, please wiggle Handel.
This door is Baroque; please call Bach later.
This door is Baroque; please wiggle Handel or call Bach.
This door is baroque...please come Bach later.
This door is baroque; please call Bach later.
This door is baroquen, please wiggle Handel.
This door is baroqueplease come Bach later
This dugout is infested, said Tom trenchantly.
This echo gets stranger and stranger. Oh that's me, sorry
This echo has been inspected by the Cardassian Customs Service.
This echo has been inspected by the Ferengi Trading Board.
This echo has been inspected by the Klingon Customs Service.
This echo is 90% fat free.
This echo is completely uncontaminated by cheese.
This echo is really great for snaging recipes.
This echo is really great for stealing Taglines.
This echo is so boring, Kilroy wasn't even here.
This echo just gets weirder and weirder. Oh wait. That's me.
This echo just gets weirder and weirder. Oh wait. That's me. Sorry.
This echo just gets weirder and weirder. Oh wait, that's you. Sorry.
This echo protected by PIT BULL with aids....
This echo will soon appear as a Bantam paperback.
This economy is weird. The bank failed before the toaster did.
This emoticon (C) Joe Kanowitz 1994 -> *+-=@![|:|]v)>>>
This end down, not up, Stupid!
This enquiring mind couldn't care less!
This entire thing is make-believe, with small visuals added.
This escape route was used alot - Tom
This face that earned a mother's fear and loathing...
This fall on ABC: Get Courtney Love - Crow
This family tree is sapping all my strength.
This feel kinda funny to you? - Tom as guy sits on guy
This feels pretty good - Mike on being without underwear
This fellow's wise enough to play the fool.
This file will self-destruct in five minutes.
This file's to embarrassed to unzip; Sorry.
This film awakened Elanor Roosevelt's sexuality - Crow
This film is brought to you by the Nerd Council - Tom Servo
This film is full of splices. It's not my fault. - Klinger
This film was a dog! --Crow T. Robot.
This film's moving along quite briskly - Tom
This fix should only take a minute...
This fortune intentionally not included.
This fortune is false.
This fortune is inoperative. Please try another.
This fortune soaks up 47 times its own weight in excess memory.
This foxy biker chick's Ginsu bra-snappler-- Crow T. Robot
This foxy biker chick's Ginzu bra-snappler - Crow
This freezer RULES! - Mike
This game is exceedingly simple. --Data.
This genealogist has finally come to his census.
This glove is a smallThis must be Mr. Bailey's. - Marcia Clark
This god is dead! He moved! You pushed him! Is Not!
This god's dead. No, he moved. You pushed him!
This guy gives awkward adolescence a bad name - Crow
This guy has blown me off for the last time. ~ Geordi
This guy loves his neighbors--especially their wives.
This guy needed a video club card? - Rimmer
This guy seems pretty cool. -Butthead
This guy sure knows how to throw a good RAIDING party!!!!
This guy walks into a bar and the bartender said
This guy walks into a bar.
This guy walks slower than Miss Jane Pittman - Crow
This guy's DEAD! What the hell?! - Tom as voodoo girl
This guy's a pig...and so are you. Did you program this guy?
This guy's got his own train of thought. And no one's aboard!
This guy's incorrigable! -- The Mask
This guy's new to computers. Which key gets wired with the smoke bomb?
This guy's not hard to follow, he leaves dead men wherever he goes.
This guy's so conceited, he thinks he's as good as I am!
This guys inner child is bigger than all of us -- Crow
This haircut wasn't my idea - Tom as alien girl
This hand to tyrants...this finger to Bill and Hillary!!!
This has NOT been a "good week" for the *Tagline Addict*! 8-(
This has been a DEAR MARVIN INCORPORATED presentation.
This has been a Filmways presentation, Dahling - Mike
This has been a difficult line to sort out. Can you lend a hand?
This has been a grave undertaking, said Tom cryptically.
This has been a recording.
This has been a test of the emergency argument suppressor!
This has been a untraceable message from......
This has been an EIB post. Excellence In Bbsing!
This has been an Official Decision of the BLUEWAVE Co-Moderator Dude
This has been another <CRASH> Useless Fact. - Yakko
This has been another<CRASH>Useless Fact. - Yakko
This has been another... <CRASH>... Useless Fact.
This has been another... <WHAM>... Useless Post.
This has been brought to you by way of Oologah, Ok.
This has been only a test. Had this been an actual Tagline
This has been the *Tagline Addict* of FIDONet and RIME.
This has indicated that I am damaged in some fashion - Data
This has the tone of an Incredible Hulk episode... - Mike Nelson
This has to be done on the Q.T., G'kar. - Sheridan
This has to be stopped at the source. - G'Kar
This has to be the dumbest idea since Pong.
This here's a government experiment.
This here's a government experiment....
This here's the butt of choice! - Tom as girl dances
This here's the wattle - the emblem of our land
This here's the wattle, the emblem of our land.
This hippy's straight outta' Brigadoon - Mike
This hitteth the nail on the head. J. Heywood (1597-1580)
This hobby is as addictive as heroin, no question about it.
This holiday season, in Somalia, the UN Forces can say it with flours.
This horse is so dead it's rotting by now...
This house is like Russia, with eyes cold and grey - Tori Amos
This huge writting was designed by Gerard, no autographs please!!
This inability to follow instructions - is it genetic or something?-DW
This incarnation has been my most gruelling. -- Dalai Lama
This information fills a much needed gap
This information fills a much needed gap.
This information is often quoted but no one seems to know the source.
This installation has a substantial dollar value attached to it.
This is your home away from home; keep it clean.
This is "Be kind to Animals" week. Take your boss' wife out to dinner.
This is #TN#. He's 1st mate on a ship that might suit our needs.
This is *NOT* a "Test my brand-new aardvark" echo...
This is *NOT* what I signed up for! Kira
This is *not* a FIDO tag line. WOOF!! WOOF! GRRrrrr...
This is 1 of 235 standard formats for UFP taglines!!
This is 911. For murder, press 1 now; for rape, press 2 now.
This is 911. If reporting murder press 1. Rape press 2.
This is 911. We're all out fighting crime. At the sound of the tone...
This is ALARMING - Crow as fire alarm rings
This is Apdor. - Richard Franklin
This is Apu of Kwik-E-Borg. Be assimilated and have a free squishie.
This is Apu of Kwik-E-Borg. Be assmiliated and have a free squishie.
This is Barker of Borg, reminding you to have your pets assimilated.
This is Bob Barker of Borg reminding you to have your pets assimilated
This is Borg. <ESC> is futile <CTRL> is inevitable
This is Borg. <ESC< is futile <CTRL< is inevitable
This is COOL! -- Butthead
This is Cal dog and his Worthington Spot on drugs
This is Cal dog and his Worthington Spot on drugs.
This is Clinton of Borg, your paycheck will be assimilated.
This is DEFINITIVELY not a tagline.
This is David Koresh of Borg. WE will be incinerated.
This is Elvis, Beam me to the mother ship, Kennedy is dead.
This is Elvis. Any messages for me?
This is Elvis. Any messages for me?
This is Fonzie of Borg. Prepare to be assimilated... heyyyyy!
This is Gary Caplan of FIDO & RIME. He's the *Tagline Addict*, Jim!
This is Harry Connick SENIOR's girlfriend - Mike
This is Hell week for nuns - Mike
This is Hillary of Borg. Bill is irrelevant...
This is Homer of Borg. You will be assim..assim...dooooooh!
This is Jacobs'. I recognize it. --Franklin.
This is Jesus! If you hang up, I'll @#!&$&!&@#$ NO CARRIER
This is KPLA, Klingon Radio: all glory, all the time!
This is KRYM, all crime, all the time.
This is LA. I work here. I carry a club.
This is Laura, my secretary - Tom on corpse
This is Lord Magius. H$ s R MGs 0 dRG$. Any questions?
This is Lore of Borg: You will be assimilated...brother.
This is MY tagline. Go get your own!
This is Major Tom to ground control...
This is Marion Barry <plop> on drugs.
This is Marion Barry--<plop<--on drugs.
This is Marv. Is your million dollars in yet? - Mike
This is Mexican food, not health food. - Kathy Pitts
This is Myra I Fox of FIDO's TAGLINES Conference. Ooh, she's witty, Jim!
This is NOT Burger King. You do not get it YOUR way.
This is NOT a Virtual Tagline. This is -> <-.
This is NOT a paid political announcement.
This is NOT a serial number, I swear.
This is NOT a tagline, it's the conclusion of my message.
This is NOT a tagline, please ignore it . . .
This is NOT a very user friendly CPU.
This is NOT an actual tagline, you're seeing things!
This is NOT good. I Tell me about it. - Garibaldi
This is NOT the Internet. This IS Fido-Net EchoMail
This is NOT what I signed up for. - Kira
This is NOT your fathers Oldsmobile.
This is National Non-Dairy Creamer Week.
This is Ohm, of Borg. Resistance is E/I.
This is Orville. He's 1st mate on a ship that might suit our needs.
This is Over, over.
This is Penguin Lust at its UGLIEST! - Otis Oracle
This is REALLY frustrating - Tom
This is Rush Limbaugh reporting live from Washington. AGGGHHH!
This is SO wrong - Mike as girls wrestle
This is STILL better than Iron Eagle - Crow
This is Scott Wood's favorite tagline!
This is Space Intruder Detector. UFO detected stealing taglines...
This is Stacy's favorite tagline!
This is Star Trek. Nobody's really dead (unless they're security).
This is THE *Tagline Addict* here! See my Tagline List to ALL!
This is Tom Servo your worst doggy nightmare - Tom
This is Tranya. I hope you relish it as much as I. -Belok
This is UNIX. This is your brain on UNIX: #%Z&@!!$?!
This is Worf, our security officer. Would you like to beat him up?
This is X Insurance Co - How May I Shaft You?
This is a "Tagline for the sake of a Tagline" Tagline.
This is a "recipe for the sake of a recipe" recipe.
This is a #2 throwing knife. Which eye don't you need?
This is a 'black card situation, end of conversation'. - Lister
This is a 'no smoking' cave - Crow
This is a *dangerous* place.
This is a .44 Magnum, the most powerful handgun made.
This is a 1st Reader Tagline. Please do *NOT* tag here.
This is a 4-H feeding frenzy - Tom
This is a BRAG line, and I'm proud of it!
This is a CONFERENCE - not a podium.
This is a DOS 5.0... er... Anti-Windows tagline.
This is a Dickens view of the suburbs - Mike
This is a Dragon. You are not a Dragon. Any questions?
This is a FAKE letter! - Mike
This is a FLAME echo?!? I fireball He!
This is a FLAME echo?!? I fireball Orville Bullitt!
This is a FLAME echo?!? I fireball Orville!
This is a Ferengi Tagline. You owe me 500 credits for reading it!
This is a Ferengi Tagline. You owe me 500 credits for reading it.
This is a Ferengi Tagline. You owe me 500 credits.
This is a Ferengi Tagline. You owe me 500 credits for reading it.
This is a Ferengi tagline. Pay 3 slips GPL to read it.
This is a Ferengi tagline. Pay 3 slips Pressed Ladinum to read it.
This is a Ferengi tagline. Pay before you read it.
This is a Ferengi tagline. Pay me before you read it.
This is a Freudian dream- Crow T. Robot
This is a Group 3 fax machine, and yes, it's smudgy.
This is a Lorena Bobbitt Tagline. It can be cut in half!
This is a Moving Message.
This is a Pro-DOS v... er... Anti-Windows Tagline.
This is a ROARshock test.
This is a S.O.S. distress call from the mining ship RED DWARF
This is a SPIFFY Tagline. Spiffytags Inc.
This is a SPIFFY Tagline.. (c) Spiffytags Inc, 1994
This is a Session Manager promo
This is a Sub-Liminal Tagline. Guess what you will do next?
This is a TEST, of the EMERGENCY Tagline agency.
This is a TEST. If this were real, it would be funny.
This is a TEST. Had this been an ACTUAL EMERGENCY, you'd be DEAD now.
This is a Tagline for the sake of a Tagline Tagline.
This is a Tagline mirror><rorrim enilagT a si sihT
This is a Tagline mirror><rorrim enilgaT a si sihT
This is a Tagline mirror<<rorrim enilgaT a si sihT
This is a Tagline. TH!$ iz @ tA%\in# on ?rug$.
This is a Telecom <click>
This is a Tribble -> * This is a Tribble on drugs -> + Any questions?
This is a Tribble -> * This is a Tribble on drugs -> + Any questions?
This is a _professional_ relationship.
This is a battle of nerves between John and me.
This is a battle of wits, and you didn't make the draft.
This is a chain tag. It has been stolen <77> times!
This is a chain tag. It's been stolen <75> times.
This is a chain tag. It's been stolen <n+2> times
This is a chain tag. It's been stolen <n+x> times
This is a chain tagline - already stolen 143,051 times.
This is a chain tagline, it has been stolen nine times.--- QFix
This is a chain tagline, it's been stolen<82>times.
This is a chain tagline. I have now been stolen 8 times.
This is a chain tagline. I have now been stolen 9 times.
This is a chain tagline: please cross-post to 5 friends...
This is a chain-tag. I've been stolen <10> times.
This is a chain-tag. I've been stolen 98372 times.
This is a chain-tag. I've been stolen <10< times.
This is a chain-tag. I've been stolen 98372 times.
This is a chain-tagline. I've been stolen <11> times!
This is a chocolate covered tagline. Yum Yum
This is a coded TagLine. Decode: LANGUAGE Now, are you receiving me?
This is a coded message - the code is "Language." Are you receiving?
This is a confidential recipe.
This is a confidential tagline.
This is a copy - I want you to make me the original.
This is a copy of a completely original recipe .
This is a copy of a completely original tagline .
This is a day for firm decisions!!!!! Or is it?
This is a dead SysOp.
This is a different thing, it's spontaneousit's called wit.
This is a dummy tagline. Do not wind past the heddles.
This is a experimental Tagline. Press return to fire...
This is a fake recipe. SERIOUSLY!
This is a fake tagline. SERIOUSLY!
This is a feminist bookstore! There is no humor section!
This is a fill-in-the-blank tagline: _______________________________.
This is a fine place to hesitate RUSH -Between Sun & Moon
This is a fire drill! - Gypsy
This is a free country, so there will be no charge for my opinion.
This is a fried egg on drugs. Any questions?
This is a good day for overcoming obstacles. Try a steep
This is a good day for overcoming obstacles. Try a steeplechase.
This is a good day to let down old friends who need help.
This is a good time to punt work.
This is a great film for flinching -Crow as girl grimaces
This is a hand phaser. Stunning, isn't it? - Picardo
This is a hazel nut Sumatra blend - Crow on bum's coffee
This is a hell of a time for a walk in the park. ~ Geordi
This is a helluva time to think of this. - Ivanova
This is a helluva time to think of this. -Susan Ivonova
This is a hired computer. Our CRAY-1 is at the analyst's.
This is a hired computer. Our CRAY-1 is at the analyst's.
This is a job for . . . AACK! WAAUGHHH!! . . . someone else. --Calvin
This is a job for Regular Guy! - Crow
This is a job for the Riviera Kid!
This is a job for.. AACK! WAAUGHHH!! ...someone else. - Calvin
This is a job for...AACK! WAAUUGGHH!!...someone else.
This is a job for...Corn Job! - Crow
This is a job for...STUPENDOUS MAN! -S.M.
This is a loaner - my Cray is in for repairs.
This is a logic tagline. <--- This is a lie.
This is a lot of tripe. You know that. - The Brain
This is a manual tagline. The next one will be hand-picked by me.
This is a manually inserted tagline.
This is a modem on drugs:#$^ NO CARRIER
This is a movie. This is a movie on drugs - Tom
This is a my new tagline - I didn't steal it either.
This is a my new tagline - didn't steal it either!
This is a my new tagline and I didn't steal it either.
This is a new brain; label on the jar said it belonged to Abby Normal.
This is a new low in popular culture.
This is a no tagline zone. Violators will be tagged.
This is a no. 2 throwing knife. Which eyeball don't you need?
This is a non-profit organization, though not by choice!
This is a one line proof...if we start sufficiently far to the left.
This is a parapsycic Recipe
This is a parapsycic tagline....
This is a perfect world; I'm riding on an incline
This is a pirated registered tagline. S/N # AN345-A7-L
This is a place of learning, not a house of..hearing about things.
This is a plce to dump your guts, not a place to beat your nuts!
This is a politically correct tagline. It says nothing.
This is a positronic brain on drugs. <*CRACKLE*> Any questions?
This is a pretty wimpy Old West - Tom
This is a put on, right? - Skeeve
This is a question we've discussed often, here and elsewhere.
This is a real Byte in the ASCII.
This is a real problem, Kirk. Now what do you want to do?
This is a really strange place to find a Jedi Master. - Luke
This is a really stupid palindromemordnilap diputs yllaer a si sihT
This is a recording - Remix
This is a recording -- TMBG Remix
This is a recording.
This is a recording. I'm afraid Holly is busy at the moment. --Holly.
This is a recording. I'm afraid he's is busy at the moment.
This is a recursive Tagline. If you're not bored, read it again...
This is a recursive recipe. If you're not bored, read it again...
This is a safe place, no matter what the mathematician is saying
This is a sample Recipe. Ignore it.
This is a sample Tagline. If it were real, it would be funny!
This is a sample recipe. If it were real, it would be funny!
This is a sample tagline. If it were real, it would be funny!
This is a sample tagline. Ignore it.
This is a serious Tagline....stop laughing....stop! STOP!
This is a serious recipe....stop laughing....stop! STOP!
This is a sickbay, not a conference room. Visiting hours are over.
This is a simulated tagline to keep the sysop happy.
This is a stable environment - do not open Windows.
This is a stick-up! Fax me all your money!!
This is a stick-up! Fax me all your money!!
This is a stick-up! Give my all your cache.
This is a stolen tagline
This is a sunny opening - Crow
This is a surrealistic tagline. Fish.
This is a tag line requires no thought.
This is a tag line. ThIs IS a taGLinE on DRuGs.
This is a tagline non-tagline
This is a tagline on a message. Any Questions?
This is a tagline virus. Kiss C:\*.* goodbye!
This is a tagline virus: go ahead and copy me!
This is a tagline- whatever that is!
This is a tagline. ++|$ is a +aGLiNE on dPuG$. Any questions?
This is a tagline. It was a book before taxes.
This is a tagline...handle with care.
This is a tagline...tag it, snag it, bag it.... PLEASE!
This is a tagsentence in a tagline in a tagparagragh.
This is a temporary tagline.....
This is a terrible lapse of logic.
This is a test ... Now returning to regular mesages..
This is a test for my tagline. Those who get it are welcome to reply.
This is a test of the EBS. This is ONLY a test.
This is a test of the Emergency Tagline Broadcast System.
This is a test of the Emergency Tagline System. This is only a test.
This is a test of the Emergency Tagline System. X
This is a test of the Emergency Tagline System...
This is a test of the Emergency recipe System
This is a test of the emergency tagline stealing system.
This is a test of the emergency tagline system. <Beeeeeeeeep<
This is a test tag.
This is a test tagline.
This is a test, If this were an actual conspiracy....
This is a test. Please ignore -- oops, too late ;').
This is a test. Please do not adjust your modem.
This is a test. Please ignore -- oops, too late ;').
This is a work-free smoke-place.
This is abuse, arguments are down the hall.
This is abuse. Arguments are down the hall.
This is actually the hottest scene so far - Crow T. Robot on ducks
This is actually the hottest scene so far - Crow on ducks
This is addictive, I've got to read more...
This is all YOUR doing, @FN@!
This is all YOUR doing, Bullitt!
This is all YOUR doing, Orville!
This is all YOUR doing, YOU!
This is all a modem-induced hallucination.
This is all beginning to sound a bit like dago talk to me. -George,BA2
This is all from memory, Tom wrote.
This is all from the steering wheel's point of view - Tom
This is all your fault, you little glob of tuberculoid sputum. --Kryten.
This is all, of course, utter crap that I just made up.
This is almost (but not quite) as bad as bumper stickers.
This is amazing! - Crow on female wrestlers
This is an ATM: Press ALT-H for $50, or Press CTRL-ALT-DEL for $100.
This is an ATM: Press F1 for $20 F2 for $50 and wait.
This is an Albotros
This is an ECHO- why do I see messages only once??
This is an EX-parrot!
This is an Offline Mail Reader tagline! ;)
This is an SOS Call from the mining ship Red Dwarf
This is an SOS distress tagline from the mining ship Red Dwarf.
This is an Untagline.
This is an almost new, witty, oft stolen tagline...
This is an alternate universe.
This is an arrogant and patronizing tagline. :)
This is an asterisk *! This is an asterisk on drugs @! Any questions?
This is an automated reply. Please do not respond.
This is an egg. This is a frying pan. Any questions?
This is an egg... this is an egg on a 486DX-50 cpu...
This is an ex-parrot!
This is an ex-parrot.
This is an ex-tagline!
This is an execution... I never had a chance... - Lucas Kagan
This is an exhibition, not a competition. Please, no wagering.
This is an honor that thrills me down to my toenails. - Henry
This is an imitation diamond, said Tom stonily.
This is an impatient baby. * Pulaski
This is an impatient baby. --Pulaski.
This is an inuslt up with which I will not put!
This is an offense-optional message.
This is an operating table, and I am the surgeon.
This is an outrage! No, this is insurance.
This is an outrage!If I were you I wouldn't pay it.
This is an ultimate coffee collection from the past 15 months, sorted,
This is an unauthorized cybernetic announcement.
This is an unregistered Tagline
This is another Politically Correct Tagline, you bigot!
This is another fine addiction you've gotten me into!!
This is another fine mess you've gotten us into, R-2..!
This is another fine myth you've gotten me into! - Lor L. and Har D.
This is another fine myth you've gotten me into.
This is another manually entered tagline for those interested....
This is another manually entered tagline for those interested.... This
This is as bad as it can get, but don't bet on it.
This is as bad as it can get, but don't count on it.
This is as much fun as a G-rated pornflick
This is as much fun as you can have with your clothes on.
This is as vile as the Threepenny Opera, said Tom curtly.
This is because reason was, in fact, out to lunch. 'GUIDE'
This is between ME & the fireplug! - Crow fights w/Tom
This is called 'Follow the Burning Doctor' - Crow
This is certainly more fun than being hit with a hammer.
This is change? Couple thousand dollar parking at LAX Runway
This is complex, Tom calculated differentially.
This is corny. They're CORN CZECHS! - Tom
This is curare! Didn't you read the bottle? - Hawk to Winchester
This is day 637 of the hostage crisis for the rich and the dead
This is delicious. What is it?
This is done with smoke signals. There is no computer.
This is down. Down is good. This is up. Up is no. Data to Spot.
This is downtown Death - Crow
This is driving me crazy!
This is either a forgery or a damn clever original!
This is even better than a DuckTales episode, Brain!
This is every Cook's opinion, No savoury dish without an onion - Swift
This is express written consent of Major League Baseball.
This is extraordinarily bad.
This is fake...I really don't have a tagline.
This is fortune #300. Understand it?
This is from the new Sinatra album - Mike on metal music
This is frozen cotton? - Mike on ice cream
This is fun? Are you mad? - Rimmer
This is getting as juicy as a grapefruit.
This is getting confusing!!! - Crow on senseless scene
This is getting deepwhere did I put those boots?
This is getting on my nerves, now that I have them. - Q
This is getting out of hand! We should seek GROUPer therapy!
This is getting way too hardy for me - Crow on movie
This is going to take a little time to explain. - Riker
This is gonna be exciting!! - Geordi
This is gonna be much better'n pancakes! - Crow
This is gonna be something great - Joel on sexy girl
This is gonna be the death of me!
This is good stuff. Is somebody writing it down?
This is good! This is real! - Dr. Forrester
This is good. Definately good. - Runt
This is great art.
This is great, bugger the phone bill...
This is ground control to Major Tom...Commencing countdown, engines on.
This is heavy stuff for a Thursday!
This is heavy. -Marty McFly
This is home - This is mean street
This is hopeless. Fighting would be preferable. - Worf
This is how he murdered the mystery writer, Tom described.
This is how my folks met - Mike on wild gang of teens
This is how to put an imp in a restraining jacket, Tom demonstrated.
This is how ya do The Watermelon Crawl...
This is indeed one for the archives!
This is information - NOT advice.
This is information NOT advice.
This is irritating. -- Butthead
This is is so far off-topic we need a Hummer to get through.
This is it, Radar. We're approaching Nirvana. - Hawkeye
This is just a hobby. Perfection is not required. Fun is.
This is just a hobby. Perfection isn't required. Fun is!
This is just a simulation, Lewis. None of this is real. - Barclay
This is just a tagline, try not to get too emotional.
This is just a test to formulate the anguish and alleviate the pain.
This is just an informational message, please do not respond
This is just one humble opinion. Write today, collect all ten!
This is just one humble opinion. Collect all ten!
This is largely as I predicted, except the Silly Party won.
This is like Gamera vs Zigra. Only with cowboys - Tom
This is like Hide & Seek: They Hide & I Seek!!!!
This is like Silverado only better-Crow on The Gunslinger
This is like a James Bond movie. huh huh huh
This is like a zoo...where the keep cool people. huh huh huh
This is like a zoo...where they keep all the cool people. huh huh huh
This is like a zoo...where they keep cool people. huh huh huh
This is like all wimpy and stuff. --Beavis.
This is like being nibbled to death by cats.
This is loneliness? What a bitter thing ... it's so sad.
This is meaningful only to a small select group, Tom added defusingly.
This is meaningless ...
This is meant to be a place of pain and misery and sorrow.-Black Adder
This is more exciting than Woody Allen on Valium.
This is more fun than any human being should be allowed to have - Rush
This is more fun than sucking on a 9 volt battery!
This is more fun than two oatmeal boxes and string!
This is more fun than watching cartoons!!
This is more intense than a pitbull on crack!
This is more than just a tagline. It's a hug from me.
This is musical masturbation! --Butthead
This is mutiny! said Tom bountifully.
This is my Graceland, Sir. - Ace Ventura
This is my all time best lucky find I ever found in the whole of today
This is my brain '@', this is your brain '.', any questions?
This is my brain. This is...wait! Where's my brain?
This is my brain... This is... WAIT! WHERE'S MY BRAIN!??
This is my brain.... This is... Wait!! WHERE'S MY BRAIN??
This is my favorite Chinese soup, Tom said wantonly.
This is my favorite tagline!
This is my fleet of Elvis impersonators - Joel
This is my four leaf clover.
This is my general humor, wit and wisdom selection. This collection
This is my other computer, my main computer is a Model I TRS-80.
This is my pet tagline, @F.
This is my pet tagline, Orville.
This is my recipe and you can't have it.
This is my tag,there're many like it,this one is mine.
This is my tag...but you're IT !
This is my tagline and you can't have it.
This is my tagline, and you can not have it.HMPF! Nanny Nanny Na Na!
This is my tagline, and you can not have it.HMPF!nananana
This is my very favorite tagline
This is news. This is your brain on news. Any questions?
This is news. This is your brain on news. Any questions?
This is no computer, this is my archenemy! O'Brien
This is no drill, the threat is for real.
This is no family. This is a lab experiment.
This is no fun at all - Johnny Rotten
This is no game for old men! Send in the boys! - W. Hays
This is no manual shift car, Tom said automatically.
This is no more magic than a pair of fuzzy dice. - Dana Scully.
This is no ordinary fool you're dealing with!
This is no ordinary fool you're dealing with.
This is no ordinary person you're dealing with here....
This is no ordinary person your dealing with.
This is no place for a gelding! - Crow as horse
This is no place for an entomologist. - Scully
This is no test - repeat, this is no test
This is no time for heroics! - C-3PO
This is no time for love - Joel as guy takes off shirt
This is no way to treat a visitor.
This is not Socialism - This is Bolshevism run mad!
This is not a @L tagline. You are not what you own.
This is not a Bald Spot, It's a solar panel for a sex machine.
This is not a Bullitt tagline. You are not what you own.
This is not a Orville tagline. You are not what you own.
This is not a REAL tagline, but an incredible simulation!
This is not a Recipe, it is just line noise.
This is not a TAG LINE, I hate TAG LINES!!!!
This is not a Warner tagline. You are not what you own.
This is not a black-and-white issue, Tom intoned.
This is not a bright idea -- Ro
This is not a court of law. - Duncan MacLeod
This is not a fairing, it's a force field.
This is not a pre-made tagline from SLMR.
This is not a rebel song, this is 'O Canada'!
This is not a recipe - It's a political statement
This is not a recipe...
This is not a tag line, just an illusion
This is not a tagline - It's a political statement
This is not a tagline and has no business being here.
This is not a tagline, it is just line noise.
This is not a tagline, trust me!
This is not a tagline.
This is not a tagline. It is only your imagination.
This is not a tagline. It's just highly coincidential line noise.
This is not a tagline. Make no mistake about it. NOT a tagline!
This is not a tagline...
This is not a valid tagline. Please choose another.
This is not a wise thing for you to do. - Delenn
This is not an offer to sell securities.
This is not fun. I had fun once, and it wasn't like this!
This is not like the simulation. *That* delivery was orderly.--Worf
This is not my fantasies. I couldn't print them if it were!
This is not my homeworld!
This is not the kind of guy to wack a kid. - Joe Dawson
This is not the only grey town I could go to - Crow
This is not the way to attract the convention crowd. --Salmoneus
This is not thought control. Think about it!
This is not what I signed up for!!! -Kira
This is not what you think.
This is not your father's Probe.
This is not your imagination. It is just a tagline.
This is not your normal faerie tale...
This is nothing that a few soap sandwiches couldn't straighten out!
This is now. Later is later.
This is on your permanent record at the Credit Bureau!
This is one night you're not turning me out. Clark Gable
This is one of my medical instruments. - Beverly
This is one of the longer tag lines that I have read...
This is one of the many times I find myself *not* envying you your job!
This is one of those joke things, isn't it?--Odo
This is one of those lines that is high on my "next" list.
This is one of those memorable moments even *I* think I'm disgusting...
This is only a demo reply
This is only a demo reply...
This is only a drean, REPEAT This is only a dream!
This is only a test. Had this been an actual Recipe
This is only a test. Had this been an actual Tagline.
This is only an exhibition. Please, no wagering.
This is only one tagline of millions.
This is our only tag line.
This is our security chief Worf, wanna beat him up?
This is our security officer Mr Worf. Would you like to beat him up?
This is phlegm...This is mucous - Tom as home ec teacher
This is ponderous, man Really PONDEROUS.
This is power steering, Tom said automatically.
This is prefect weather for today's game. Not a breath of air.-C.Gowdy
This is pretty exciting for a Thursday!!
This is probably the wrong conference for this message!
This is really expanding my notion of womanhood - Crow
This is revenge for all the arguments he lost.
This is rich! 'Bad Command Or Filename' -Tom Servo using a PC
This is ruining my sitting down time - Tom as cop
This is science, not Romper Room - Dr. Forrester
This is so ALMOST Mitchell - Tom on lame TV Movie
This is so cool I have to go to the bathroom - Calvin
This is so easy...it MUST be wrong!
This is so far off-topic we need a Hummer to get through.
This is so goofy. Operation Goofy now in effect - Tom
This is so humiliating. - Zazu
This is so nuts. I mean, listen to what you're saying. <Burke>
This is some rescue!
This is starting to get interesting, don't you think?
This is starting to get interesting...
This is steak, not rocket science! (Dex to Tam, just last night...)
This is still a free country, ain't it?
This is stun setting. <zeet> This is not. <ZOT> -Data
This is stupid. huh huh huh
This is such a satisfactory conclusion- Crow
This is tagline 3 of tagfile 5 reporting for duty!
This is tagline number 225 in my file.
This is that thing you call sarcasm, isn't it?
This is the *Last* time I hhighjack an organic foods truk -- Tom
This is the ANGRY WHITE MALE POINT OF VIEW
This is the Bobbitt tagli....
This is the Borg, prepare to be assimilated... oops out of memory
This is the Central Scrutinizer....
This is the Coda, said Tom finally.
This is the FCC !@#$&&%*#$ NO CARRIER
This is the LAST time I take travel suggestions from Ray Bradbury!
This is the OFFICIAL tagline of the 1996 Olympics!
This is the PC-Addicts echo, all members are committed!
This is the Recipe to end all Recipes.
This is the Taglines Echo. It is *INTERNATIONAL* & open to everyone.
This is the U.S. Secret Servic#$!&&@#!$ NO CARRIER
This is the Winter of our discontent...
This is the android that I respect in battle -- Sela
This is the answer on Final Jeopardy. What is to do it with phrases?
This is the best Sol Bass credit sequence, EVER - Mike
This is the best planet on Earth! (Dan Quayle)
This is the best tagline in the known universe.
This is the best tasting sword, ever! - Mike as hero
This is the big one, I'm falling in love.
This is the big one, there's nowhere to run.
This is the castle of my master, Dweezil Water!
This is the chase...Rocky & Ken! - Tom sings
This is the city, I'm a sysop, I carry a modem..
This is the coming of the century - Course of Empire
This is the coolest video I've ever seen in my life!
This is the day for firm decisions! Or is it?
This is the day the teddy bears fly to venus - Tom sings
This is the end of the message. You can stop reading now.
This is the end/my only friend, the end...--The Doors
This is the famous Dead Sea Tupperware.. (burp) Still good!
This is the fight...Rocky & Ken! - Tom sings
This is the first day of my last days - NIN
This is the first step towards my thesis, said Tom abstractly.
This is the first time this ever happened again!
This is the garden spot of Ceti Alpha 6. * Chekov
This is the general's jack! - Radar. Salute it and get in. - Hawk
This is the greatest thing since sliced toothpaste. - Cadigan
This is the greatest thing since sliced toothpaste. - Synners.
This is the hottest Petty Coat Junction ever! -Tom leers
This is the kind of scene Ed Wood does really well - Mike
This is the last day of the first part of your life.
This is the last of the bathroom tissue - Crow
This is the maximum length of any tagline BlueWave will allow.------>|
This is the mess hall. If you're dying for a Big Mac, you're out of lu
This is the mess. If you're dying for a Big Mac, you're out of luck.
This is the most blasphemous and offensive tagline I could think of.
This is the most common language used on micros, said Tom basically.
This is the most dramatic asbestos suit scene - Joel
This is the most severe punishment; finding out you are wrong!
This is the official Bobbitt tagli
This is the only place around, it must be the place.
This is the only tagline I have.
This is the only time i really feel alive -- NIN
This is the part where @FN@'s head explodes!
This is the part where Bob's head explodes.
This is the part where Chrissy's head explodes.
This is the part where George's head explodes.
This is the part where I run like hell.
This is the part where Orville's head explodes.
This is the part where Scott's head explodes.
This is the part where Scott's head explodes. -SLR
This is the part where Tim's head explodes.
This is the part where YOU's head explodes!
This is the part where his head explodes.
This is the raw file; looks a bit different than my edited ones do. :)
This is the recipe Australia had to have!
This is the restored second unit director's cut - Tom
This is the result of too many lost clusters!
This is the shabby furnished room of my dreams - Crow
This is the short version. The long answer is even less interesting.
This is the shot they used for the album cover - Tom
This is the song right after the train chase! -Tom sings
This is the song written for the train chase! -Tom sings
This is the sort of English up with which I will not put. -- Winston Churchill
This is the story of the LAST of the Babylon stations.
This is the stuff from which dreams are made.
This is the sysop, please log off. Thanx. SUCKER!
This is the tag that never ends--it just goes on and on my friend.....
This is the tagline Australia had to have!
This is the tagline to end all taglines.
This is the tagline you are reading right now.
This is the time of year (summer) when the nudist colonies are full.
This is the time, and this is the record of the time.
This is the uniform of a great man! "Does he know you're wearing it?"
This is the voice of World Control...
This is the voice of world control. I have brought peace
This is time travel, Tom said relatively.
This is time travel, she said relatively.
This is too easy a city to die in -- Mari Cabrah, Black Fury
This is too much like reality for me.
This is torture! Change it! huh huh huh
This is truebut unhelpful. Arthur
This is unheard of in a divorce settlement Mrs. Bobbitt!
This is up for Best Picture - Tom on 'Time of the Apes'
This is what I do for fun, can you imagine my job?
This is what a FEMINIST looks like!
This is what is laughingly known as my apartment. Gregory Peck
This is what it sounds like when Morn cries...
This is what started the electronic revolution??
This is what you might call an Odo episode. Or, Columbodo.
This is what's known in film lingo as 'filler' - Crow
This is when hope and desire collapse,
This is when the night comes down a hammer on an anvil.
This is where @ is !
This is where Aldo Farnese got his start - Tom on credits
This is where Forrest Gump shows up - Crow
This is where Mr. Hooper died - Tom
This is where heroes are made. -- Doctor Bashir
This is where the Pink Panther comes in - Crow on music
This is where the sepia tone really paid off - Mike
This is where the tagline goes, right?
This is where they play the wedding march on bongos -Tom
This is why Ed Wood gets final cut - Crow
This is wrong! Think about it! - Mike to Crow
This is your Amoeba *. This is your Amoeba on drugs . Questions?
This is your Brain: OS/2; your brain on UNIX $*#$(%!%!()%
This is your CPU -.- This is yor CPU on Windows !#$%)*
This is your CPU -.- This is your CPU on Windows !#$%)*
This is your CPU -@- This is yor CPU on Windows !#$%)*
This is your PC... **is *s *o*r ** o* Dr*gS
This is your Replies Conference on autopilot.
This is your Sysop. +++|s |$ youI s+sop on dfuga.
This is your Sysop. +++!s s you( s+sop on qTuga.
This is your Sysop. s s ou ssop ug.
This is your brain @ This is a file leech's brain * Any questions?
This is your brain o This is your brain on Tribbles *
This is your brain ... This is your brain on Windows.
This is your brain C:\> This is your brain on drugs C:\ELDERS>
This is your brain Orville. This is your brain without psychedelics; _.
This is your brain This is your brain on Windows.
This is your brain [.], here it is on your windshield [*], buckle up!
This is your brain o This is your brain on tribbles *.
This is your brain on drugs as part of our Grand-Slam Breakfast!
This is your brain on drugs with a side order of bacon.
This is your brain on drugs, toast and coffee
This is your brain on drugs. Any questions? Any bacon?
This is your brain with a side order of bacon.
This is your brain-->.<-- Here's your brain on Bluewave-->!<--
This is your brain. This is your brain on Trek. Any questions?
This is your brain. PostScript on brain your is This.
This is your brain. Postscript on brain your is This.
This is your brain. Postscript on brain your is This.
This is your brain. ( x ) this is your brain without reference material( )
This is your brain. Fidonet on brain your is This.
This is your brain. THIS IS YOUR BRAIN ON CHOCOLATE!
This is your brain. This is Barney. No more brain. Questions?
This is your brain. This is your brain on Pentium. Any questions?
This is your brain. This is your brain on a Braingyser.
This is your brain. ThisIsYourBrainOnTaglines.
This is your brain. o This is your brain on tribbles. *
This is your brain... this is your brain on 486DX-50...
This is your brain...THIS is your brain on DOS!
This is your brain...THIS is your brain on Windows!
This is your brain...this is your brain on DOS...
This is your brain: . This is my brain: O Any questions?
This is your brain: ARJ. This is your brain on drugs: ZIP
This is your brainTHIS is your brain on DOS!
This is your brains on eggs... Any questions?
This is your computer on Windows 95...*&*%@#^8+H48"M~l4^#$#%NO CARRIER
This is your computer. I hate you. Quit touching me. Turn me off!!!
This is your computer. This is your computer on MS-DOS 6. Any ????
This is your creater speaking - Joel to Bots
This is your fortune.
This is your last chance, Orville. Free us or die!
This is your last chance, Walter. Free us or die!
This is your last packet of Taglines..time to reorder.
This is your last packet of recipes..time to reorder.
This is your mind: O; This is your mind on Rush: _______;
This is your modem - h s $ m M gs.
This is your modem on drugs!
This is your modem. *h** ** **** m***M ** ***gs. Any questions?
This is your official tag line donation receipt. Keep for tax purposes
This is your pizza. T++$ | YoUeg !zza ++i+X+ anc+O/e$
This is your recipe donation receipt. Keep for Tax Dept.
This is your sysop. ****s *s *ou* s*sop ** **ug*.
This is your sysop. +++|s is youI s+sop on dfuga.
This is your sysop. +++i$ !s a usEg on dgug$.
This is your sysop. +++|s is youI s+sop on dfuga.
This is your sysop. BC4-s s out sKsop "$ kgug .
This is your tagline donation receipt. Keep for Tax Dept.
This is your train. This is your train with Botchmann. Any questions?
This is your two minute warning.
This is... excuse my language... damn good coffee. -- Cooper
This isexcuse my languagedamn good coffee.
This isn't Anarchy, this is Chaos.
This isn't GROSS because there's less than 144 Taglines!!
This isn't GROSS because there's less than 144 recipes!!
This isn't Hell, but you can see it from here.
This isn't MAD MAX.....it's SAD MAX!
This isn't a Recipe, trust me.
This isn't a beer belly! It's a gas tank for a sex machine.
This isn't a computer, it's my archenemy! - O'Brien
This isn't a computer,it's a hyperspatial field generator.
This isn't a cyanide tablet is it? - Mike
This isn't a holodeck, darling, this is real. * O'Brien
This isn't a real tag line. I'm too poor to invest in one.
This isn't a recipe, but it plays one on TV
This isn't a tag line. It just looks like one.
This isn't a tag, it's the message
This isn't a tagline, but it plays one on TV
This isn't a tagline, but it plays one on TV.
This isn't a tagline, trust me.
This isn't a tagline. It's an after-thought....
This isn't a tagline; just highly coincidential line noise.
This isn't a very effective cemetary - Mike on zombie
This isn't a very good damnation sequence. - Crow T. Robot
This isn't about guts. She wants your head! - Duncan MacLeod
This isn't an Olympic event, there's no medal for coming in 2nd - DM
This isn't an arguement.Yes it is.No,it isn't.Yes it is...
This isn't blank, so it can't go anywhere.
This isn't brain surgery; it's just television.
This isn't hell but you can see it from here - The Crow.
This isn't hell, but I can see it from here.
This isn't hot. I mean it's hot but it's not HOT - Crow
This isn't much of a cheese shop, is it?
This isn't my pet, this is my lunch - Worf
This isn't my pet, this is my lunch.
This isn't my real name.
This isn't one of those kissing books, is it Grandpa?
This isn't real turtle soup, said Tom mockingly.
This isn't reality this is fantasy! -- Uhura
This isn't right. This isn't even wrong.
This isn't rocket science, it's brain surgery! - Monty Burns
This isn't some Deep Space franchise! Babylon 5 stands for something!
This isn't some Deep Space franchise! --Ivanova.
This isn't that Earl Grey stuff, is it?
This isn't the Right Stuff. Its just some STUFF - Mike
This isn't what it looks like, Keiko, I swear. O'Brien
This item is simply an echo from between my ears!OJW
This job don't pay half what it's worth.
This joke is closed captioned for the humor impaired.
This just in - GDW apologizes for Dangerous Journeys...
This just in: UFO steals Bill Clinton! More after the game.
This just in: Research causes cancer in rats!
This just in: UFO steals Bill Clinton! More after the game.
This just in: man attempting to walk around the world drowns.
This kangaroo's a lunatic, and his pouch is very full.
This kid has a +25 smile of charm that works overtime.
This kind of help we don't need. - Sinclair
This kinda' party isn't fun without heroin - Mike
This knob. I love to touch this knob! - Tom
This land is yours. You must protect it. Marlon Brando
This land, wrought by the tempest of the Galia... - Dalmar
This learnin to live again is killin me
This legend could've used some punching up - Mike
This letter fills a much-needed gap.
This life is a test. It is only a test.
This life is a test. It is only a test.
This life that lasts a thousands year, will soon be gone...
This line intentionally left blank.
This line intentionally left unjustified.
This line left blank so Jim Weller can insert a new tagline.
This line left blank so YOU can insert a new tagline.
This line noise via GTE of Illinois!
This line self explodes in 10 seconds.
This lion is a very fox for his valor. -- Shakespeare
This list was declared off-topic. At any rate it makes lousy Taglines.
This list was declared off-topic. At any rate it makes lousy recipes.
This little breach of security isn't going to affect my Xmas bonus?
This little piggy cried "weeweewee"... He's just plain nuts.
This little piggy had roast beef. He's a glutton.
This little piggy stayed home. He's agoraphobic. -SLR
This little piggy went to market. He's a kleptomaniac. -SLR
This little piggy went to market. He's a shopaholic.
This login session: $13.76, but for you: $11.88.
This login session: $13.99, but for you $11.88
This login session: $13.99, but for you, $11.88
This lonely tagline seeking a mate.
This looks like a discount for..Bartman! - Bart
This looks like a job for - DarkWing Decoy!
This looks like a job for Zimmerman! - Crow
This looks like a job for the Human Bullitt. Fire me, boy!
This looks like a job for...TV ACTOR! - Tom
This looks like a matter of mind over mallard - DarkWing Duck
This looks like the front door. Should we ring the bell? - Riker
This lot means it. They're even taking hostages.
This machine is an instrument of terror.
This machine kills liberalism.
This mail does not contain any tagline...
This makes you feel better??? <grin>
This makes you feel better??? <grin<
This malarkey brought to your computer by Orville Bullitt.
This malarkey brought to your computer by Orville.
This man has no <bleeping> neck!
This man is dangerous; he believes what he says.
This man is missing a nipple! - Crow
This man is no ordinary man. This is Mr. F. G. Superman...
This man's dying! Dammit, Jim, I'm a doctor, not a. oh, right.
This man's wearing a push-up bra! - Crow
This marks Logical End-Of-Message. Physical EOM follows.
This marks Logical End-Of-Message. Physical EOM follows.
This may just be my opinion.. Aren't you glad I'm Right ?
This may look like a tagline, but its really not.
This may or may not be relevant.
This may smell bad kid. - Han
This means sudden death! The coach warned in Thai.
This means war! - Mr. Tator I thought it meant touchdown? - Yakko
This means war! I thought it meant touchdown?
This means war, ya know.
This meat is hard to chew, Tom beefed jerkily.
This memo from Department of Redundancy Department memo writers.
This mess is a place!
This message 100% matter. Do not expose to antimatter.
This message Pagan Friendly.
This message and Tagline (C) Copyright 1994
This message and Tagline (C) Copyright 1994.
This message and recipe (C) Copyright 1994.
This message approved by Major League Baseball
This message base has become a rhetorical dumping ground.
This message brought to by The Wizzo Chocolate Company.
This message brought to you by 100% recycled electrons.
This message brought to you by PKZIP 2.04G and Blue Wave 2.12
This message brought to you by the Dept of Redundancy Department.
This message brought to you by the Wizzo Chocolate Company.
This message brought to you by the letters L & O and the number 69.
This message can be seen only on Pay-Per-View!
This message cleared by Iraqi censors.
This message comes to you on 100% recyclable electrons.
This message contains 100% post-consumer electrons.
This message created using 100% recycled phosphors.
This message cruelly tested on small furry animals.
This message didn't deserve one of my GOOD Taglines.
This message didn't deserve one of my GOOD recipes.
This message does NOT require Microsoft Windows.
This message does not in any way diminish the earth's topsoil.
This message doesn't NEED a tagline..sheez!
This message doesn't deserve one of my GOOD taglines!
This message encoded with Virtual Unreality.
This message entered before a live Studio Audience.
This message entered while onboard an alien ship...
This message for external use only.
This message from @TO was reformatted by TmNice !!
This message from another typical protoculture addict...
This message from the Presidential Committee on Lower Expectations.
This message from...THE WINDOWS FREE ZONE...
This message has AOL written all over it
This message has a brail tagline: ... .. ..... . ....
This message has been UNIXized for your protection.
This message has been [Stoned]
This message has been approved as being truly faithful by Kai Winn.
This message has been cruelly tested on cute furry little animals.
This message has been cruelly tested on cute little furry animals.
This message has been skipped for lack of naughty bits.
This message has no tagline.
This message interrupted by spouse with hot cupcakes w/lots of butter!
This message is $hareWare! To register, please send $20
This message is *not* off topic #@$(*&^& NO CARRIER
This message is SHAREWARE! To Register, send $5.
This message is a future echo - I haven't written it yet.
This message is best before: '06-Sep-94.
This message is brought to you by compeletly unnatural ingredients.
This message is closed-punchlined for the humor-impaired.
This message is crouched in language that is perfectly oblivious.
This message is environmentally friendly.
This message is for @N only!
This message is for YOU only!
This message is from Hooterville. I climbed a pole with laptop.
This message is in many different places at the same time.
This message is just bound to catch the moderator's attention.
This message is made from 100% recycled electrons.
This message is made of 100% recycled electrons
This message is not supposed to be here!
This message is part of the Borg. If in doubt, look up and left.
This message is printed with 100% recycled electrons.
This message is so old that it actually has mold on it.
This message is too good to pass up.
This message is totally nonfattening. Eat as much of it as you can.
This message made of recyclable electrons.
This message made possible by a grant from Jimmy Pearson
This message may have settled in shipping.
This message meets all 1998 federal safety guidelines.
This message never happened!
This message not cleared by censors.
This message paid for by SDFA: The Society for a Democrat Free America.
This message patented in the year 1994.
This message printed on 100% recycled bandwidth
This message printed on recycled photons.
This message produced with 100% recycled electrons.
This message protected by Smith and Wesson.
This message released to public domain. Use at your own risk. DDH
This message routed through @BBSID@!
This message sent VIA mind Implant ..............
This message sent by writing it on a golf ball that I lost.
This message sent to participating locations only.
This message sent to you using a highly trained dolphin named Sid.
This message smiley captioned for the humor impaired.
This message smiley captioned for the humour impaired.
This message smilie captioned for the humour impaired.
This message sponsored by Doug's Yummy Chunky Gristle Treats.
This message transmitted on 100% recycled electrons.
This message transmitted on 100% recycled photons.
This message was brought to you by my USR Sportster 14,400/FAX modem.
This message was brought to you by the genes 14 and 22.
This message was brought to you by the letters B & D and the number 69
This message was brought to you by the letters D & H and the number 3.
This message was brought to you by the letters D, H and the number 3.
This message was brought to you by the letters H & S and the number 69
This message was brought to you by the letters H & S and the number 69.
This message was created before a live studio audience.
This message was created using 100% genuine recyled electrons.
This message was cruelly tested on small, furry animals.
This message was cruely tested on cute little furry animals!
This message was hand-crafted in only the finest ASCII.
This message was inserted by mistake.
This message was made from Dolphin safe Ascii.
This message was not cleared by Iraqi censors.
This message was posted automatically by McFly.
This message was posted automatically with PostMaster
This message was posted on America's Least Wanted!
This message was prerecorded.
This message was produced using speech technology
This message was provided by the F.U.B.A.R. Racing Team.
This message was specially routed to you from Hell via FIDONet.
This message was specially selected for your viewing pleasure.
This message was typed on recycled phosphorous.
This message was typed on recycled phosphorus
This message was typed on recycled phosphorus.
This message was typed with recycled pixels.
This message was violently tested on cute, furry, lovable animals.
This message was written by pouring warm tea on an Ouiji board.
This message was written in the Key of H-Flat.
This message was written with recyclable keystrokes.
This message was written with recycleable keystrokes.
This message will catch the moderator's attention.
This message will self destruct in 2 seconds! Better Run!
This message will self destruct in 9 seconds. Press "N" to abort.
This message will self implode in 5 seconds.............
This message will self-destruct in 10 seconds.
This message will self-destruct in 5 seconds...
This message will self-destruct in five seconds four three ...
This message will self-destruct in five seconds, better cum now!
This message will self-destruct in five seconds.
This message will self-destruct in five seconds.....
This message will self-destruct...
This message worth 2 cents and darn well worth it!
This message written by Dolphin Boy.
This message written by Sandy. A highly trained dolphin.
This message written by Sandy. A highly trained dolphin.
This message written by Zippy the Dolphin.
This message's content may have settled during shipping.
This messages was prerecorded.
This meszage has bin spel chequed.
This method works fine for me.
This microdot contains the definition of SAMPO: .
This microdot contains the secret formula for SPAM: .
This microfiche goes back where it belongs, said Tom complacently.
This mind intentionally left blank.
This modem will now self destruct... 5... 4... 3... 2... 1... 0...
This modem will now self destruct...5..4..3..2..1..0..
This moderator has achieved nuclear delivery capability.
This morning I distinctly heard "Snap, crackle, f*ck you." - G. Carlin
This morning I distinctly heard snap, crackle %&*! you. -- G. Carlin
This morning I distinctly heard snap, crackle, f*ck you.
This morning I shot six holes in my freezer. -Buffet
This morning was a very good year. - Trapper, on Swamp hooch
This mouse is loaded, who's the designated driver?
This mouse is loaded. Where's the designated driver?
This mouse thing gets cursor and cursor.
This movie SUCKS! - Tom
This movie has a real Viewmaster quality - Crow
This movie has become abstract - Tom
This movie has deep meaning in some hoary dreamworld-Mike
This movie has deep meaning in some hoary dreamworld. - Nelson
This movie has severe Contra implications - Tom
This movie is a honk-shoo - Tom
This movie is fraught with meaningful looks - Tom
This movie just "faced" us - Crow
This movie looks like a dramatization of a movie - Crow
This movie needs another big bowl of fresh Peaches - Crow
This movie sucks - Tom cries
This movie was the 'JAWS' of its day - Crow
This movie's filled to the brim with chin - Mike
This movie's lost it's creaminess - Mike
This movie's low on linguistic synapses - Crow
This movie's really getting to me! - Crow
This movie's relentless - Tom Servo
This movie's too clever to let that drop - Mike
This must be Bart, Lisa, and, uh, 'expecting'.. - Mr. Burns
This must be Nebraska, Tom stated flatly.
This must be Thursday--I never could get the hang of Thursdays.-Dent
This must be a Thursday, I never could get the hang of Thurdays. ADent
This must be the Placezzzz...
This must be the high-voltage lead, said Tom crisply.
This must be the men's room. I don't see a Ladies sign.
This must be what it's like to be a COLLEGE GRADUATE!!|
This must be where pies go to die! --Agent Cooper.
This neighborhood is crawling w/sleazy chicks -Tom
This never happens on other systems I call!
This never happens on other systems I call.
This never would've happened if I were captain. Riker
This next tagline has a true story behind it.
This night methinks is but the daylight sick.
This nightlife's beating the daylights out of me.
This not a SPIFFY Tagline.. pathetic, isn't it..?
This note edited for the ironically impaired.
This nu yeer, I plann two werk on mi speling....
This off-topic post: Courtesy of Orville
This off-topic post: Courtesy of the *Tagline Addict*.
This off-topic thread needs a permanent vacation
This offer is too good to ignore!!!! Ring me asap!!! 8am-5pm NOW!!!!
This offer is void where prohibited, taxed, or otherwise restricted.
This old baby's crashed more times than a ZX-81! - Kryten
This one I've seen in other contexts (e.g., "... time spent
This one act of consecration is what i ask of you -- NIN
This one didn't grow; it exploded! :-)
This one feels like a suppository - Crow T. Robot
This one goes out to the one I've left behind...
This one is from Cambot & it is pinking shears! - Mike
This one is too serious for a cute, funny Tagline.
This one's called 'A Few Nude Men' -Mike
This one's gonna hurt you for a long long time.
This one's got good heft - Mike on pinking shears
This one: prototype for Richard Carpenter - Tom on teen
This only a test. Had this been an actual Tagline....
This ooo tagline has ooo some ooo bugs in it.
This open hand of desire wants everything.
This operation WILL be a failure IF WE ALL DIE!!
This ought to be good! - Calvin
This our security officer, Mr Worf. Would you like to beat him up?
This page *S*W*I*P*E*D* by the *TAGLINE ADDICT* & saved in a text file.
This page has been <drum roll> *S*W*I*P*E*D* by the *Tagline Addict*!
This pain is definitely going to linger -- Brain
This paragraph is reserved for future use.
This parrot is stone dead! This is an ex-parrot!
This parrot would go VROOM if you put 10 million volts through it
This parrot wouldn't "voom" if you put 4,000,000 volts through it!!!
This parrot wouldn't Vooom! if you put 40,000 volts through it.
This parrot wouldn't foom if you put 4000000V thru it!
This party is getting dirty, I'd better pull up my pants and go home.
This party is getting dirty, better pull my pants up and go home.
This past week have all been Murphy days. ::Sigh::...
This past week have all been Murphy days.Sigh
This person's qualifications have a solid basis for his answer.
This personal name is false.
This phone booth reserved for Clark Kent.
This phone is baroque, please call Bach later.
This phone is baroque. Call Bach later.
This phone is baroque; please call Bach later.
This photocopier is still not functioning - Picard.
This piece is chock full of omissions.
This place gives me the creeps. - Luke
This place has all the attraction of a lanced boil. - Henry Blake
This place has everything.
This place is a mineralologist's dream. Kirk
This place is crawling with Holly Hobbies - Crow
This place is just crawling with missle silos - Mike
This place is nuts. --Ivanova.
This place is so weird that the cockroaches have moved next door.
This place is so weird the cockroaches moved next door.
This place is so weird, The cockroaches have moved next door.
This place is too stinky... Even for me! - The Tooth Beaver
This place is turning devilish and scary!
This plan...will require no new taxes. Bill Clinton 8-92.
This plane was recently sexed. It's a boy! - Mike
This planet is FULL, you must make space for additions!
This planet's got a soggy diaper that leaks - Joel
This plant growing thing IS a science ya know!
This planwill require no new taxes -- Clinton
This portion of UTS II is a trade secret of Amdahl Corpor
This post deserves no tagline for @FN@ to read.
This post deserves no tagline for YOU to read.
This post has not been approved by Gloria Steinem.
This post inspected by #12.
This post is over my head. Yeah, it's under my butt. -Butthead
This post is so good, it doesn't even need a tagline!
This post rated I: too intense for some readers.
This post was [ ] Humorous [ ] Insightful [X] Just plain stupid.
This posting has been made with a flame retardant material.
This pre-recorded tagline is coming to you live from our on-location studio.
This president is going to lead us out of the recovery.
This principle [evolution] is not a law but a dogma, like every creed.
This probably doesn't help, but...
This probably won't come as a surprise but... you'll live - Duncan
This process will ultimately lead to the heat death of the universe.
This product contains minute charged particles going 500,000,000 MPH.
This product cruelly tested on defenseless furry animals
This product cruelly tested on defenseless furry animals.
This product has been cruelly tested on cute little furry animals.
This product is meant for educational purposes only.
This product sadistically tested on gerbils.
This product was cruelly tested on cute, furry animals!
This product was cruelly tested on small, furry animals.
This program doesn't work with DOS 1.0 or higher.
This program makes me look like a genius!!
This program makes me look like a genius.
This program requires MickyMouseSoft Windows.
This program will eliminate all mitsakes!!
This punishment is not boring and meaningless
This punishment is not boring and meaningless -Bart
This punishment is not boring and pointless
This punishment is not boring and pointless - Bart Simpson's lines
This punishment is not boring and pointless -Bart Simp./Epis. 8F24
This punishment is not boring and pointless -Bart Simpson/Episode 8F24
This punishment is not boring and pointless. --Bart Simpson.
This quote is umop apisdn.
This quote is worth $16 in a twisted, dememted way.
This reality is pretty crook. I think I'll dive into my book again.
This recipe (+ money) good for things in many stores...
This recipe Baked Fresh Daily In Our Own Ovens!
This recipe brought to you by the ACME recipe Company.
This recipe can be bought.
This recipe causes cancer take it, I dare you!
This recipe closed due to conditions beyond our co *#}
This recipe contains a virus - DO NOT READ!
This recipe contains an exploding dye pack.
This recipe contains no Polychlorinated Byphenals.
This recipe does not require Microsoft Windows.
This recipe followed me home-- can I keep it, Mom?
This recipe has a Limpet mine attached to it.
This recipe has been deleted.
This recipe has been recycled!
This recipe has nothing whatsoever to do with the message.
This recipe intentionally left blank.
This recipe is $hareWare! To register, please send $20
This recipe is Shareware. To register it, send me $10.
This recipe is a feeble attempt at an on-topic comment.
This recipe is a hologram, insuring message authenticity
This recipe is a virus. Kiss C:\*.* goodbye.
This recipe is bi-lingual. English and American.
This recipe is brought to you by the letter "O"
This recipe is confused - it thinks it's a message.
This recipe is currently out of order.
This recipe is dedicated to my bird friend..
This recipe is especially for kleptomaniacs!
This recipe is firmly etched in Jello!
This recipe is for sale. Call 1-800-TAG-THIS!
This recipe is identical to the one you are reading.
This recipe is inebriated.
This recipe is invisble to all whose I.Q. exceeds mine.
This recipe is low in salt.
This recipe is made especially for All
This recipe is off color.
This recipe is only for the living.
This recipe is self-referential.
This recipe is subject to an aboriginal land rights claim.
This recipe lacks content. Give it 2 stars.
This recipe made from reconstituted recipe concentrate.
This recipe may cause offline mail reader problems, Reboot now.
This recipe only uses recycled keystrokes.
This recipe protected by Acme Security, Inc.
This recipe recommended for mature readers
This recipe snagged by me, or was it you???
This recipe tastes good....<chomp>..<chomp>....
This recipe void where inhibited by law.
This recipe wants to tag ya, where are you?
This recipe was created from many little letters.
This recipe was made to be snagged!
This recipe was never here.
This recipe, like the message, is worthless.
This reply was foil wrapped for maximum freshness
This rerun due to Tagline Writer's strike.
This rerun due to recipe Writer's strike.
This rerun due to tagline writers' strike.
This road brought to you by Good Intentions Paving, Inc.
This rocket came from outer space, Tom said exorbitantly.
This room is so small I have to leave it just to change my mind.
This rope is all tangled up, Tom snarled.
This salad dressing has too much vinegar, said Tom acidly.
This sash is the wrong size! I said "Worf", not "dwarf"!
This scene isn't panning out like I'd hoped - Crow
This scene really needs Panavision - Tom
This scene sure brings the film into sharp focus - Tom
This scene was cut from 'The Program' - Crow
This score just in - Deep Space 9, Babylon 5.
This score just in! Deep Space 9, Babylon 5...
This score just in: Babylon = 5 Deep Space = 9
This score just in: Deep Space 9, Babylon 5. More at 11.
This score just in: DeepSpace-9, Babylon-5 and Earth-2.
This screen intentionally left blank.
This screen is microwave, dishwasher and fly safe.
This secret jet is password protected. To view type Ctrl-Alt-Del.
This seems like a good time to finish a message
This seems to be a good place to relaxPlanet Earth. Garfield
This sentance has threee errors.
This sentence contains ten words, eighteen syllables, and
This sentence contains thinly veiled political satire.
This sentence contradicts itself -- no actually it doesn't. -- Hofstadter
This sentence contradicts itself: no, wait, actually it doesn't.
This sentence is a !!! premature punctuator
This sentence is false.
This sentence is functioning as a recipe.
This sentence is functioning as a tagline.
This sentence is only true when it is false.
This sentence is shareware! To register, send $10 to...
This sentence no verb.
This sentense contains three errurs
This sentense contains three errurs.
This serene metropolis lies directly beneath the Hoover Dam... -Calvin
This shareware version contains no pornography.
This ship is on a collision course with a meteor the size of Florida!
This ship is on a collision course with a meteor the size of New Jersey!
This ship is two big... If I walk, the movie would be over!
This ship will self-destruct in 3 minutes.
This should be in the gun cozy - Crow
This should get interesting. Don't you agree?
This should work... All I have to do is conn..##*&%@@!! No Carrier
This shouldn't be over your head -- are you ducking?
This side of conference: "LESS DROOLING", Other side of...
This side up
This situation cannot be, Lennier. --Delenn.
This skein is the worsted one yet!
This smells like bat barf - Calvin
This smiley emoticon closed captioned for the humor impaired.
This soap is so strong it'll remove the spots off a Trill!
This soap's corrosive, Tom lyed.
This software will eliminate all misakes.
This software will eliminate all mitsakes!
This song contains satanic messages - Crow
This song's longer than INNNA GODDA DA VIDA! - Mike
This sort of humor just gills me.
This sounds like a fun place.......
This sounds like it looked all right
This sounds like it was recorded in someone's bathroom!
This sounds sinister & illegal. Tell me more.
This sounds sinister and illegal. Tell me more.
This space accidentally left blank.
This space available for advertizing.
This space available...call 1-900-TAGLINE ($10 per min)
This space for rent, just ask you sysop for info...
This space for rent.
This space for rent. Inquire without.
This space for rent. Send $50 to Cal Webster.
This space for rent. Send $50 to ROF.....
This space formerly used by a tagline.
This space intensionally left blank
This space intentionally left blank
This space is reserved. . . this space is not------>| |
This space is reserved. . . this space is not------<| |
This space left blankish.
This space never intentionally blank!!!
This space not left unintentionally unblank.
This space reserved for a GOOD Recipe. Any suggestions?
This space reserved for a GOOD tagline. Any suggestions?
This space reserved for future tagline theft.
This space reserved for handicapped taglines only.
This space reserved...this space is not -----> | |
This space unintentionally left blank.
This space unintentionally left filled.
This spacecraft makes wide right warps. -UFO sticker
This species has amused itself to death
This species has amused itself to death.
This spoiler brought to you by RTM Productions
This spoils my bronze look - Mike on Colossus' wound
This spot reserved for V.I.P.E.R.? - Mike
This starship brakes for black holes.
This starship breaks for black holes and temporal disunities.
This statement is a lie.
This statement is in no way to be construed as a disclaimer.
This station is a xenobiologist's dream. - Franklin
This station is now the ultimate power in the universe. - Admiral Motti
This station is now the ultimate power in the universe. -- Motti
This strange comment at the bottom of the message is illogical.--Tuvok
This structure is a nexus of significant enhanced power bioforms.
This stuff really attracts helicopters! - Mike on flair
This sucks! No medicine. No buzz - Butthead.
This sucks. Let's burn something. -- Butthead
This sucks. Let's get outta here. - Butthead
This sucks. No medicine. No buzz!
This summer journey the exotic River Styx on Charon cruise lines.
This sure beats doing the housework! Also gardening, painting, washing
This system protected by killer dustballs!
This system will self--destruct in five minutes.
This system will self-destruct in five minutes.
This tablet was created by forgers seeking to imitate Urza's works.
This tag brought to you by...they keep going and
This tag contains 6,666% U.S. RDA for this conference.
This tag does not compute.
This tag from Tacoma--Where it always rains on your parade.
This tag has been stolen 1 time(s).
This tag is copyrighted, sorry.
This tag is new, witty and stolen <6> times.
This tag is new, witty, and not yet stolen.
This tag is new, witty, and stolen <7> times.
This tag is new, witty, and stolen <7< times.
This tag is old, wore-out, and stolen 324 times!
This tag is old, wore-out, and stolen 325 times!
This tag is old, worn out, and stolen 325 times!
This tag is on medikashun....medicashun...... drugs!
This tag line exceeds Plate F
This tag line gets up and dances every time you look away!
This tag line intentionally left blank.
This tag line is "Bulletin Broad-proof"!
This tag line is mirrored | derorrim si enil gat sihT
This tag line is nailed down to prevent theft
This tag line was taxed by a liberal Democrat.
This tag was typed in manually.
This tag wastes your time and mine...
This tag-line is --- umop apisdn !!!
This tag-line is soooo dumb.....No one will steal it!
This taglin has three erors.
This tagline measures 7.2 on the Sphincter Scale
This tagline <cough> has <cough><cough> a virus! <cough><cough>
This tagline (+ money) good for things in many stores
This tagline Copyright (C) 1991 All rights reserved.
This tagline Copyright (C) 1992 Taglines-R-Us. All Rights Reserved.
This tagline Copyright 1991 (C) All rights reserved. :-)
This tagline Copyright 1994 by Bart Lidofsky
This tagline R-rated. This part is nude ->
This tagline SHAREWARE. Send $5.
This tagline advertises my BBS , The Quest BBS 1:271/490
This tagline also stolen by John Hancock & Night W
This tagline also stolen by John Hancock & Night Wind!
This tagline also stolen by Silly Little Mail Reader!
This tagline applies to you only if you're paranoid.
This tagline approved by the resident shoulder cockatiel.
This tagline belongs to Seymour Twat, gynaecologist.
This tagline belongs to Seymour Twatt, Gynochologist.
This tagline bites!
This tagline bought at the Boneless Chicken Farm.
This tagline brought to you by @LN@ Industries.
This tagline brought to you by Nygmatech....
This tagline brought to you by the ACME Tagline Company.
This tagline brought to you by the letters B & W, & the number 2.12!
This tagline came last in the `Original Tagline Comp.'
This tagline can be bought.
This tagline can be deleted by a simple keystroke.
This tagline can't be bought or sold for any price.
This tagline cancelled due to lack of interest
This tagline cannot be sold in this conference.
This tagline carefully handcrafted for... what was your name again?
This tagline censored by the Adult Conspiracy
This tagline censored by the moderator.
This tagline cloak captioned for the Romulan impaired.
This tagline closed due to conditions beyond our co *#}
This tagline compliments of the BatComputer ***
This tagline composed ENTIRELY of recycled bytes.
This tagline contains 100% un+nown (!beTs.
This tagline contains 37 characters.
This tagline contains a virus - DO NOT READ!
This tagline contains a virus. Please steal.
This tagline contains a virus: go ahead and copy me!
This tagline contains an exploding dye pack.
This tagline contains no Polychlorinated Byphenals.
This tagline contains no added preservatives or msg.
This tagline contans three errurs.
This tagline cross-posted from alt.rap.sucks.yo.yo.yo.yo
This tagline dates back to the twelfth century B.C.
This tagline dedicated to uh...ME!
This tagline deleted due to lack of interest.
This tagline deleted.
This tagline discontinued due to lack of interest.
This tagline does not exist.
This tagline does not refer to the GOOD TIMES email virus.
This tagline does not require Microsoft Windows.
This tagline edited by Lorena Bo
This tagline followed me home. Can I keep it, Mom? Can I?
This tagline followed me home. Can I keep it? Please?
This tagline goes Dead (and wounded) at last.
This tagline had been pre-stolen, for you convenience
This tagline had been pre-stolen, for your convenience.
This tagline hand-crafted by Colorado homosexuals.
This tagline hand-crafted by Melbourne homosexuals.
This tagline handcrafted in Canada.
This tagline has a Limpet mine attached to it.
This tagline has a alarm on it; so don't try to steal it!
This tagline has a p@$$word protected. To view type Ctrl+Alt+Del.
This tagline has an alarm and is invisibly identified!
This tagline has an underlying meaning
This tagline has been anvil-captioned for the Animaniacs impaired.
This tagline has been approved by the FDA.
This tagline has been approved by the Vedek Assembly for general use.
This tagline has been around the block more times than Madonna!
This tagline has been brought to you by Tony Baechler.
This tagline has been confiscated.
This tagline has been cruelly tested on cute furry animals.
This tagline has been cruelly tested on cute furry little animals.
This tagline has been cruelly tested on cute little furry animals.
This tagline has been cruelly tested on defenseless furry animals.
This tagline has been deleted.
This tagline has been electrified with 20,000 volts!
This tagline has been laminated to give it a longer shelf life.
This tagline has been lost in the NETWORK...
This tagline has been made expressly for @TO.
This tagline has been made expressly for Orville Bullitt.
This tagline has been made expressly for Orville.
This tagline has been paid for by a grant from IBM.
This tagline has been pre-owned, for your convenience.
This tagline has been quarrantined. Do not read.
This tagline has been recycled!
This tagline has been selected randomly from thousands of entrants.
This tagline has been taped before a live audience.
This tagline has been taxed by a liberal Democrat
This tagline has been taxed by a liberal Democrat.
This tagline has been unregistered 31 days!
This tagline has been unregistered for 15,863,774 days.
This tagline has expired
This tagline has no additives or preservatives!
This tagline has no honor! --Worf
This tagline has no meaning, just like life sometimes........
This tagline has nothing whatsoever to do with the message.
This tagline has violated system integrity. Please reboot system.
This tagline in SHAREWARE! To register, send me $10.00
This tagline in memory of Stephen Ceideburg...a friend.
This tagline inspected by number 17.
This tagline intentionally left blank
This tagline intentionally left blank.
This tagline intentionally left partially blank
This tagline invisible if stolen by a lurker.
This tagline invisible to all whose I.Q. exceeds mine.
This tagline is "Bulletin Board-proof"!
This tagline is $hareWare! To register, please send $20
This tagline is .umop apisdn
This tagline is 100% EZ-Reader compatible!!!!!
This tagline is 100% Topic Free.
This tagline is 100% WwWwWwWiIiIiIiEeEeErRrRrRrDdDdDdDdDdD!
This tagline is 100% environmentally friednly
This tagline is 100% fat free!
This tagline is 100% natural, and has no artificial ingredients.
This tagline is Cloak Captioned for the Romulan Impaired.
This tagline is FREE in specially marked messages!
This tagline is False---> <-----This Tagline is True
This tagline is MINE now!
This tagline is Mafiaware. You pay, or I breaka you legs.
This tagline is NMOP 3PISdn
This tagline is NOT shareware! Send me $20 anyway.
This tagline is OFF TOPIC!!!!! hehehehehehe
This tagline is Rusted.
This tagline is SHAREWARE! To Register, send me $10
This tagline is SHAREWARE! To Register, send me $10.
This tagline is SHAREWARE! To Register, send me $25!
This tagline is SHAREWARE! To register it, send me $10.00.
This tagline is SHAREWARE! To register, fax me $10
This tagline is SHAREWARE! To register, send $7 to me c/o this node.
This tagline is SHAREWARE! To register, send me $10 ___ Blue Wave/QWK
This tagline is SHAREWARE! To register, send me half of all your $$$.
This tagline is SHAREWARE! To register, send name of my ancestor!
This tagline is SHAREWARE! To Register, send me $25!
This tagline is SHAREWARE! To register, send me $@TL@.
This tagline is SHAREWARE, to register send me $10.
This tagline is SHARWARE! To Register, Send Me $20.00
This tagline is SWAPWARE. To Register send me your favorite tagline.
This tagline is Serial # 0415/CAW-9736.29..
This tagline is Serial # 0812/BTB-9593.50
This tagline is Serial # 0928/CAW-9645.53
This tagline is Serial # 1221/BTB-9729.35
This tagline is Serial # 2377/AFR-1104.991
This tagline is ShareWare, Please send $10 to registe\SLMR
This tagline is ShareWare, Please send $10 to register it
This tagline is Shareware, If you like it SHARE it!
This tagline is Shareware. Register : Send Me $25 At ...
This tagline is TRUE -> <- This tagline is FALSE.
This tagline is VOID where prohibited.
This tagline is a carefully packaged {{{HUG}}} from me.
This tagline is a charmer.
This tagline is a feeble attempt at an on-topic comment.
This tagline is a feeble attempt at an on-topic message.
This tagline is a figment of your imagination
This tagline is a hologram, insuring message authenticity
This tagline is a product of Klingon Science.
This tagline is a virus. Kiss C:\*.* goodbye.
This tagline is about to self-destruct, quick beam it into deep space !
This tagline is actually Constable Odo in disguise.
This tagline is actually Odo in disguise.
This tagline is also available in English.
This tagline is also shareware, to register, contact me.
This tagline is baroque; please call Bach.
This tagline is being guarded by Scotland Yard
This tagline is being shipped to our enemies overseas.
This tagline is bi-lingual. English and American.
This tagline is blank to save space.
This tagline is boring
This tagline is boring.
This tagline is brought to you by B & W and the number 2.12!
This tagline is brought to you by the letter "O"
This tagline is brought to you by the letters B & W & the number 2.20!
This tagline is brought to you by the letters B & W and the number 2.1
This tagline is but a dream within a dream...
This tagline is but a yielding dream.
This tagline is childish. Be adult! This country needs more dults.
This tagline is cloaked. You can't see it. Er, can you??
This tagline is closed-punchlined for the humor-impaired.
This tagline is closed-punchlined for the humour-impaired.
This tagline is confused - it thinks it's a message.
This tagline is copy protected
This tagline is covered in chocolate...eat and enjoy!
This tagline is currently out of order.
This tagline is dead, Jim......
This tagline is dedicated to my bird friend @F.
This tagline is dedicated to my bird friend Myra I.
This tagline is dedicated to my bird friend Orville.
This tagline is dedicated to my bird friend..
This tagline is dedicated to my imaginary friend...
This tagline is designed exclusively for Adi Flenner.
This tagline is designed exclusively for Gary Hull.
This tagline is designed exclusively for Martin Pollard.
This tagline is designed exclusively for you.
This tagline is designed to be stolen. So steal it.
This tagline is encouraged where prohibited
This tagline is especially for kleptomaniacs!
This tagline is false.
This tagline is firmly etched in Jello!
This tagline is fleeing for it's life.
This tagline is for adult audiences, viewer discretion is advised...
This tagline is for sale. Inquire within.
This tagline is for sale. Inquire within.
This tagline is for the humor impaired-and Fundies..
This tagline is freeware. For enhancements send 12.95 to:
This tagline is freeware. For enhancements send 12.95!
This tagline is functioning within normal parameters.
This tagline is guaranteed not to shrink or run.
This tagline is identical to the one you are reading
This tagline is identical to the one you are reading.
This tagline is identical to the one you're now reading.
This tagline is indecipherable!!
This tagline is inebriated.
This tagline is inoperative. Please try another.
This tagline is intentionally left blank.
This tagline is intentionally vague and suggestive.
This tagline is invisble to all whose I.Q. exceeds mine.
This tagline is invisible to all whose I.Q. exceeds mine.
This tagline is irrelevant. Please ignore.
This tagline is just one of the many by-products of Gritty Kitty.
This tagline is just taking up cyberspace.
This tagline is just too sexy for this conference
This tagline is listed for no good reason!
This tagline is listed for no good reason!!
This tagline is little more then an appendage
This tagline is looped on Heinlein's timeline.
This tagline is lost!
This tagline is lying.
This tagline is made especially for the Clinton Administration.
This tagline is made for everyone except @TO.
This tagline is made for everyone except Orville Bullitt.
This tagline is made for everyone except Orville.
This tagline is made from 100% recycled letters.
This tagline is made from 75% recycled ASCII.
This tagline is made from stainless steal.
This tagline is made just for @N@
This tagline is made just for @TO!
This tagline is made just for @fn@ @ln@
This tagline is made just for ALL SOUTH FLA. SYSOPS
This tagline is made just for Alasdair Sinclair
This tagline is made just for Alen Hess
This tagline is made just for All
This tagline is made just for Andrew Gall
This tagline is made just for Anne Bartl
This tagline is made just for Becky Stranberg!
This tagline is made just for Bob Morgan.
This tagline is made just for Brendan Reid
This tagline is made just for Brian Durham
This tagline is made just for Bruce Kniffen
This tagline is made just for Charity Hendress
This tagline is made just for Charles Robinson
This tagline is made just for Chris
This tagline is made just for Connie Sharlow.
This tagline is made just for Craig Humphrey
This tagline is made just for Dexter Fernandez
This tagline is made just for Gary Caplan..
This tagline is made just for HIS.
This tagline is made just for Heather Falconer
This tagline is made just for Jaysin Kwong
This tagline is made just for Jennifer Marlowe
This tagline is made just for Joshua Jeffery
This tagline is made just for Keith Scudder.
This tagline is made just for Kevin R. Davis
This tagline is made just for Lars Eighner
This tagline is made just for Michael Cooling
This tagline is made just for Mischief
This tagline is made just for Nigel Adler
This tagline is made just for Orville.
This tagline is made just for Paul Burrett
This tagline is made just for Peter Sabelis
This tagline is made just for Rich Bossard
This tagline is made just for Robert Tennent
This tagline is made just for STACY HUBBELL
This tagline is made just for Sandy Spadaccino
This tagline is made just for Stefan Mohr
This tagline is made just for Steve Cox
This tagline is made just for Sue Rykmans
This tagline is made just for Ted Howell
This tagline is made just for Tom Woodfin
This tagline is made just for Tracy Hemenover
This tagline is made just for Vampyra.
This tagline is made just for Waterfall
This tagline is made just for Zackary Tippett..
This tagline is made just for me!
This tagline is made just for you.
This tagline is made only for 386 machines.
This tagline is malfThis tagline is malfThis tagline is malfThis tagli
This tagline is new, witty, and stolen.
This tagline is no threat to your death.
This tagline is not blank, it's just politically correct !
This tagline is not considered suitable for any purpose.
This tagline is not in service at this time.
This tagline is not upside-down.
This tagline is not worth stealing.
This tagline is now nuked. Ka-bloop!
This tagline is offensive
This tagline is old, dull, and not worth stealing.
This tagline is on medikashun...medicashun......drugs!
This tagline is on vacation.
This tagline is only for the living.
This tagline is part of your twisted imagination
This tagline is password protected. To view type Ctrl-Alt-Del.
This tagline is password protected. To view type Ctrl-Alt-Del.
This tagline is property of the Starfleet Academy Athletic Department.
This tagline is protected by "the club"! /\------\+
This tagline is protected by Armourguard. DON'T STEAL!
This tagline is protected by TNT Anti-Theft Devices.
This tagline is protected by a Goddess.
This tagline is protected by an attack cat!
This tagline is really Constable Odo...
This tagline is really Odo in disguise.
This tagline is really Odo.
This tagline is registered to Orville Bullitt.
This tagline is registered, if you read it you must send me $10
This tagline is self-referential.
This tagline is shareware! To register, please send me $10!
This tagline is shareware! To register, send $10 to...
This tagline is shareware, register it for $10.00.
This tagline is shareware. To rester, send me $10.
This tagline is so bad, even @FN@ won't steal it!
This tagline is so bad, even YOU won't steal it!
This tagline is so boring even you wouldn't steal it!
This tagline is so old it has whiskers!
This tagline is so old, I don't know why I stole it.
This tagline is spreading viruses at this moment. :)
This tagline is stolen....
This tagline is subject to an aboriginal land rights claim.
This tagline is symbolic of my struggle with reality!
This tagline is the legal property of Orville
This tagline is tri-lingual. [English, Canadian and American]
This tagline is tri-lingual. [English, NZ and American]
This tagline is umop apisdn
This tagline is umop apisdn (Spaszoid Strikes!)
This tagline is umop apisdn and stupid, too.
This tagline is umop apisdn!
This tagline is umop apisdn.
This tagline is under repair. Thank you.
This tagline is void where prohibited
This tagline is void where prohibited by law.
This tagline is way, way, way too big for this progr
This tagline isn't as good as the last one!
This tagline isn't stolen --- it just looks that way !!
This tagline isn't stolen, I just borrowed it.
This tagline just keeps going and going and going and going and going
This tagline kept blank to avoid bringing humor to a sour subject.
This tagline known to cause cancer in some laboratory animals.
This tagline lacks content. Give it 2 stars.
This tagline left blank to avoid Clinton tagline tax!
This tagline left intentionally blank.
This tagline left void as a gesture of contempt.
This tagline looked good, so I ate it.
This tagline luxuriantly hand-crafted from only the finest ANSI.
This tagline made backwards by Tag O' The Day
This tagline made from 100% recycled electrons! Recycle your taglines!
This tagline made from 100% recycled electrons.
This tagline made from reconstituted tagline concentrate.
This tagline made just for people who don't keep backups.
This tagline makes no mention of Twin Peaks
This tagline manufactured by sadistic little elves.
This tagline manufactured with 100% new materials.
This tagline may cause offline mail reader problems, Reboot now.
This tagline may only be removed by the consumer.
This tagline mutilated by a demented nerd.
This tagline no verb.
This tagline not sponsored by Pepsi in any way.
This tagline not valid in NZ.
This tagline not valid in New Jersey.
This tagline now supports Soundblaster!
This tagline on strike, in sympathy with the NHL referees
This tagline only uses recycled keystrokes
This tagline owned by a little old lady who only drove to....
This tagline paid for with various sexual favours.
This tagline predated the Wheel...
This tagline printed with 100% recycled photons.
This tagline produced at Le Studio, Toronto -RUSH
This tagline produced by Yoyodyne, Inc.
This tagline prohibited by @TO...
This tagline prohibited by Orville Bullitt...
This tagline prohibited by Orville...
This tagline prohibited by sane people. Their loss.
This tagline property of GrandMaster B.
This tagline protected by "The Club"
This tagline protected by *TagAlert*.....
This tagline protected by Acme Security, Inc.
This tagline protected by Smith and Wesson Security,
This tagline protected by THE CLUB(tm).
This tagline protected by Viper. Stand back!
This tagline protected by a pit bull with AIDS.
This tagline protected by an attack cat.
This tagline protected by an attack cat. Gggrrrrr!
This tagline recommended for mature readers
This tagline recycled by Tagline Xpress.
This tagline requires 486 DX2 66 or higher.
This tagline requires Microsoft Windows to run.
This tagline requires Microsoft Windows.
This tagline requires a VGA monitor.
This tagline restricted to day VFR use only.
This tagline rules <pokes out tongue>
This tagline says nothing new
This tagline self destructs when you hit <ENTER>
This tagline self-destructs when U <ENTER>
This tagline self-destructs when U <ENTER<
This tagline shaves as close as a blade or your money back.
This tagline space available - CHEAP
This tagline stickes it tongue out when you're not looking.
This tagline stinks. (Scratch N Sniff)
This tagline stolen from Silly Little Mail Reader!
This tagline stolen by AmigaETag!
This tagline stolen by BlueWave!
This tagline stolen by KWQ Mail/2.
This tagline stolen by MikeMayl!
This tagline stolen by Off-Line Xpress!
This tagline stolen by Q-Blue [Amiga] v2.1!
This tagline stolen by Silly Little Mail Reader
This tagline stolen by Silly Little Mail Reader!
This tagline stolen by Tag Line Xpress!.
This tagline stolen by Tag-X Professional!
This tagline stolen by Total Recall BBS!
This tagline stolen by me, or was it you?
This tagline stolen by me, or was it you???
This tagline stolen by my stupid cat!
This tagline stolen by the Academic Lesbian Mafia.
This tagline stolen from Mad magazine.
This tagline stolen from Rasta's private collection.
This tagline stolen from Wesley Pitts' private collection.
This tagline stolen from the Rush to Excellence 1995 Tour.
This tagline stolen from the Rush to Excellence `@DY@ Tour.
This tagline stolen from: GA State Prison
This tagline subject to Federal taxes.
This tagline sucks.
This tagline supplied by a Silly Little Male Reader!
This tagline supports Adlib/Soundblaster/Roland MT-32
This tagline survived the Great Spring Dupe Storm of `93.
This tagline tastes good....<chomp>..<chomp>....
This tagline tax free in 49 states - sorry Tennessee!
This tagline thought up by Dr. Stupid.
This tagline to be removed only by consumer
This tagline uses advanced Object Oriented technology.
This tagline utterly lacks class, but is very cute
This tagline vibrates if you rub it the right way!
This tagline vibrates if you rub it the right way.
This tagline violates all known laws!!!
This tagline void except where prohibited by law.
This tagline void in any other conference.
This tagline void where prohibited by common sense.
This tagline wants to tag ya, where are you?
This tagline was ALWAYS meant for @TO.
This tagline was ALWAYS meant for Orville Bullitt.
This tagline was ALWAYS meant for Orville.
This tagline was NOT stolen...
This tagline was added after I selected the one below
This tagline was blank before you looked at it.
This tagline was created from many little letters.
This tagline was created with 100% recycled electrons.
This tagline was created with 85% recycled pixels.
This tagline was cruelly tested on cute little animals.
This tagline was cruelly tested on small, furry animals.
This tagline was eagerly awaiting Orville to come and collect it.
This tagline was filmed before a live studio audience.
This tagline was filmed before a studio audience.
This tagline was filmed before live a studio audience.
This tagline was found FREE in a specially marked box of disks.
This tagline was funny -But it's been 'morph'ed !
This tagline was invented 5 minutes ago on a different continent.
This tagline was made by a computer junkie, then swiped by me.
This tagline was made just for Etta-Michele Bos
This tagline was made on the <Oe>
This tagline was made to be stolen!
This tagline was made up entirely by ME alone just for YOU!
This tagline was made up entirely by me alone.
This tagline was missing, so I filled something in...
This tagline was never here.
This tagline was not stolen from Ken Freeman.
This tagline was reclaimed and is not yet re-stolen.
This tagline was reclaimed and is not yet stolen.
This tagline was recorded before a live audience
This tagline was recorded before a live audience for delayed posting.
This tagline was recorded before a live audience.
This tagline was recorded before a live studio audience.
This tagline was recorded using Dolby Pro-Logic.
This tagline was specially made for (fill in the blank): _____________
This tagline was stolen by BEASTMASTER!!!
This tagline was stolen by a Commodore C128.
This tagline was stolen from Dan QuaylE.
This tagline was taped before a dead studio audience.
This tagline was tested on small, innocent, fluffy, and cruel animals.
This tagline was written while high on M&Ms
This tagline wasn't stolen by *any* mail reader!
This tagline will auto-destruct in 30 minutes.
This tagline will be assimilated. Resistance is futile.
This tagline will explode in 15 seconds....you just TRY swiping it!
This tagline will re-format hard drive in 15 seconds!
This tagline will self destruct in 15 seconds.
This tagline will self destruct in Orville seconds.
This tagline will self destruct in ten seconds 10. 9. 8.
This tagline will self-destruct in 10 seconds.
This tagline will self-destruct in 10 seconds. 1 if you steal it.
This tagline will self-destruct in 15-million nanoseconds.
This tagline will self-destruct in 5-million nanoseconds
This tagline will self-destruct in five seconds.
This tagline will self-destruct in five...four...three...two...one...
This tagline will selfdestruct in 10 seconds!
This tagline with best enjoyment or discotech is made from Taiwan.
This tagline would be cooler if it had a toilet, huh huh
This tagline would be cooler with naked chicks, huh huh huh
This tagline's confused-thinks it's a message.
This tagline's for all of us who are *SICK* of alternative music!
This tagline's for all of us who saw Batman Forever for CHRIS O'DONNEL!
This tagline, like the message, is worthless
This tagline. Written by. Uh. Admiral Orville.
This taglines is subject to .07% sales tax, unless you steal it.
This talgine meats all U.S. Guvermnint Standerds.
This terror is clipping along just fine - Mike on monster
This the pilot for the 'Better Sex' videos - Mike
This theme song is hard to hum - Crow
This thing bled acid. Who knows what it's gonna do when it's dead.
This thing doesn't compile in time. Need a new 486
This thing is slowly taking me apart -- NIN
This thing is slowly taking me apart.
This thing working???
This thread has a lot of potential for yarns.
This time around the revolution will not be televised.
This time around, the revolution will not be televised.
This time it will surely run.
This time let go your consious self and act on instinct. - Obi Wan
This time you're dead wrong. --Ivanova.
This time, *I* drive - Joel as trucker's dog
This tip courtesy Dr Bob's Guide to Accessing the Internet
This to me is the very definition of gettting lucky -Mike
This too is meaningless, a chasing after the wind.
This tooth extraction could take forever, said Tom with infinite wisdom.
This town ain't big enough for both of us. Damn surveyors
This town desperately needs a leather bar - Crow
This town is so dull, when the tide goes out it refuses to come back in.
This town really DID need porn - Mike
This town's got nothing for you and me.
This transfer via DSZ ver...say, what day is it anyhow?
This try, try again stuff gets to be a REAL bore after a while!
This tsgline is owned and operated by Frobazz Magic Co.,
This uniform doesn't fit and you know it -- Ensign Ro
This unit ... must ... survive.
This universe is BORING without the Romulans!
This universe is just a test. The real one starts soon.
This universe is mine! I am GOD here! - The Lawn mower Man
This video is like...complicated.
This video needs more explosions and close-ups of butts - Butthead.
This video needs some car accidents. Yeah, with lots of FIRE! - B&B
This video needs some car accidents. huh Yeah, with lots of FIRE! huh
This video needs some more car accidents. "Yeah, with lots of fire!"
This virtual reality is fantastic. No,I really am in jail.
This virus requires Microsoft (R) Windows <tm> 3.x
This virus requires Microsoft Windows 3.x.
This virus requires Microsoft Windows 95!
This virus requires Microsoft Windows.
This virus requires Microsoft(R) Windows(tm) 3.x
This virus requires Windows v3.1x
This virus requires Windoze
This voice told me to be agolf pro. -- Johnny Fever
This was *never* between us, MacLeod! - Mako
This was a great war until you guys showed up.-Burns, to Trap & Hawk
This was a nice tagline, but it got scensored for obscene contents
This was because reason was in fact out to lunch - HHGTTG
This was because reason was in fact out to lunch.
This was entered with a real QWK reader.
This was his 'batch' - Tom after guy falls to his death
This was no boating accident!
This was no bowling accident! Those are shark bites!
This was not my Keiko -- O'Brien
This was only a test; if this had been a real emergency, you'd be dead
This was only a test; if this had been a real emergency, you'd be dead.
This was really a chick film - Crow
This was supposed to be a hobby not work!!
This was supposed to be so easy...
This was taken with the new Crotch-Cam!
This was the feel good movie of 1956 - Crow
This was the product of a deranged imagination.
This was too easy. I didn't get to shoot near enough people.
This was written by an infinite number of monkeys.
This was written with consent of Major League Baseball
This way! - The Cat
This week at K Mart: Ladies clothing, Half off!
This weeks hottest hits belong to....after this message.
This whole operation could use a weekend retreat - Crow
This whole party'll be for nothing if they see us. - Han Solo
This whole place is off its rocker! - Frank Burns
This whole sleazy chick thing - Mike
This will be a day long remembered. - Darth Vader
This will be a memorable month -- no matter how hard you
This will be a memorable month -- no matter how hard you try to forget it.
This will be a test of my leadershipmanship. - Col. Henry Blake
This will be an unusual log entry. - Picard
This will end your Windows session. Load another Abomination? Y/n
This will get me into the royal bedroom, said Tom kinkily.
This will mess up your screen... [1H
This will not look good on a resume!
This will take slightly more time than we have.
This woman sucks the joy out of it - Tom
This won't do you any good senor Martino!
This won't help our mission.
This won't hurt a bit. Don't worry, I'm only a hologram. - Picardo
This won't hurt, I promise!
This won't hurt, I promise.
This won't take long. - Richard Franklin
This wonman sucks the joy out of it - Tom
This world aint fit for *US* decent folks!
This world was produced entirely using Amigas
This would also be recognized as a tagline.
This would be a good one for the daquiri swilling tractor manufacturer
This would make a fine tagline.
This would really be exciting if I understood what was going on.
This would really be handy if I had that tech manual.
This year I'm definitely going to attend more cultural events.
This year I'm definitely going to be nicer to people.
This year I'm definitely going to get more exercise.
This year I'm definitely going to go on a diet.
This year I'm definitely going to make larger charitable contributions.
This year Oliver Stone exposes BBSs and networking!
This year give "The Gift That Keeps On Giving!" (a stray cat in heat).
This year in Arizona, winter is scheduled for Wednesday.
This year in Colorado, summer is scheduled for Wednesday.
This year's Middle Class Twit of the Year is...
This years theme is Spaceballs! He's dressed as Helmet. Not Luke.
This your last packet of taglines... Time to reorder.
This'd be a Limbaugh flame, but he bores me now.
This'd turn k.d. lang hetero - Tom on girl wrestlers
This'll be a great show if we survive the rehearsals.
This'll never stand up in court! [Peewee Herman]
This'll put the crappies down for a while - Mike
This((kiss me))is a((kiss me))subliminal((kiss me))tagline!
This, that, these, those, and such, said Tom demonstratively.
This, too, shall pass.
This... is Rikki. I include her in all my holoprograms. - Paris
This...is...easy. Comedy...is...hard -Crow on death scene
ThisIsAnExampleOfInterCapping.
ThisMessageWasSentOnRecycledElectrons
Thisisatesttaglinehaditbeenarealtaglineitwouldhavebeenattheendnothere
Thisisatesttaglinehaditbeenarealtaglineitwouldhavebeenonthebottom..
Thisisazippedtagline.
ThistaglinecompressedwithARJ.
ThistaglinecompressedwithLHA.
Thistaglinecreatedusingpkzip2.04
ThistaglinecreatedwithPKZip2.04g!
ThistaglineiscompressedbyPKZ1.199%.
ThistaglineiscompressedbyPKZip2.04g.
Tho' I understand not, I do not criticize! :-)
Tho' the guy's a pig, we know what he wants -- TMBG
Thomas Edison invented the "Light Emitting Resistor".
Thomas Jefferson was killed by ferrets!
Thomas Murphy Sysop, The PosterBoard Network NYC, NY
Thomas The Rhymer by Ellen Kushner
Thomas answered and said unto Him, My Lord and my God. - John 20:28
Thompson's Theorem: When the going gets weird, the weird turn pro.
Thongs [n], What Thinatra things.
Thor shows his might, and the rhinohide yells, "Light!"
Thoreau's Law: If you see a man approaching you with the
Thorn Thallid: Jean-Luc on mushrooms
Thoroughly sexperienced
Those 'crazy noises' are computer signals! - Nerd
Those 3 little words that mean so much: 'Klaatu barada nikkto'
Those Alanas need all the help they can get... -Quickling
Those B***ards Spaced all the prisoners!
Those Carival Cruises were rustic back then - Mike
Those Founders.. they're an insidious bunch!
Those Funny Dogs: Joe Kur
Those PAJAMAS are impossible; THIS actually happened. - Det. Kellaway
Those acting classes are really paying off! - Yakko Warner
Those ants sure tasted good.
Those are probably smutty Hummels on the wall - Mike
Those are the lotto numbers - Crow on computations
Those aren't fortune cookies. -- Indiana Jones
Those aren't weeds - those are native wildflowers.
Those arrogant sons of... Take them down! - Ivanova
Those arrogant sons... Take 'em down. - Ivanova
Those at war with others are not at peace with themselves
Those birds are swallows, Tom gulped.
Those bright lights called my name.
Those butts are ripe for kicking - Mike
Those cars we shipped have a defective part, Tom recalled.
Those child psychology books we bought were a waste of money.
Those darn Christian upstarts! What was wrong with *our* religion?
Those darn Unitarians burned a question mark on my lawn!
Those default taglines are just too wacky for me.
Those guys are agressively incompetent - Tom
Those guys are marked clearly POISON-Joel on skull jacket
Those guys will NEVER be under control no matter WHAT.
Those hookers are putting notices in the personals, Tom advised.
Those kids with their chinos. Ahhhh! - Mike/#606
Those little black insects will never get in here, Tom said defiantly.
Those little yellow Reds! - Frank Burns, on the Chinese
Those mirrors in your pants? Because I can really see myself in them.
Those moon rocks are made outta charcoal briquettes -Crow
Those of us who hold the Priesthood are the Lord's agents.
Those of us who quietly lurk may prove you wrong someday. (G)
Those of you who think you know everything annoy those of us who do.
Those of you who think you know everything are annoying
Those of you with children are excused.
Those old Bulgarians that eat yogurt aren't 150; they just look that way
Those on the cutting edge bleed a lot.
Those people who don't value their own lives will die.
Those ringside seats are worth the $700 bucks - Tom
Those rowing the boat usually don't have time to rock it.
Those stupid aliens keep making circles in my wheat field.
Those that can't do, criticize.
Those that have the firepower make the rules.
Those that live by the sword KILL those who don't
Those that live by the sword get shot by those that don't
Those the English public never forgives - youth, power & enthusiasm
Those to be subjugated, must first be disarmed.
Those white hairs mean that I have have a teenager.
Those who *would* govern us are enemies.
Those who aim at great deeds must also suffer greatly. - Plutarch
Those who aim at nothing always hit it.
Those who are about to die salute you.....:)
Those who are at war with others cannot be at peace with themselves.
Those who are easily offended, should be! Often!
Those who are going to abuse drugs are already abusing drugs.
Those who are not governed by God will be ruled by tyrants.
Those who are prepared to die for any cause are seldom defeated.
Those who beat their guns into plowshares will plow for those who don't.
Those who beat their sword into plowshares'll plow for those who don't
Those who can admit weakness are strong in the Lord
Those who can do nothing else become administrators.
Those who can do. Those who can't become left-wing liberal.
Those who can do. Those who can't join the Democratic Party.
Those who can do; Those who can't become left-wing liberal.
Those who can do; Those who can't join the Democratic Party
Those who can't handle adulthood become born-again.
Those who can't laugh at themselves leave the job to others.
Those who can't teach, administrate.
Those who can't write, write help files.
Those who can't write, write manuals.
Those who can, Do. Those who can't, Criticize.
Those who can, do. Those who can't, get paid twice as much.
Those who can, do. Those who can't, simulate.
Those who can, do. Those who can't, supervise!
Those who can, do. Those who can't, write.
Those who can, do. Those who cannot, teach. Those who cannot teach, HACK!
Those who can, do. Those who can't, simulate.
Those who can, do. Those who can't, write the manual.
Those who can, do... those who can't, get promoted to management.
Those who can, do...those who can't, get promoted to management.
Those who can, do; those who can't, Simulate.
Those who cannot remember the past are condemned to repeat it.
Those who compare Stern to Limbaugh are intellectually bankrupt.
Those who deserve love the least need it the most
Those who do good will get their Just Punishment!
Those who do not complain are never pitied.
Those who do not follow will be dragged.
Those who do not know their history are doomed to keep stepping in it.
Those who do not learn from History ... get an F.
Those who do not think do not deserve to have a brain.
Those who do not want to learn will lead enterprises.
Those who don't learn from history are doomed to repeat it.
Those who don't remember history are doomed to vote for Liberals.
Those who don't remember taglines are doomed to repeat them.
Those who expect nothing are never disappointed..
Those who fail to repeat history are doomed to study it.
Those who fight and run away, live to fight another day.
Those who flee temptation generally leave a forwarding address
Those who follow like sheep are bound to be fleeced!
Those who forget the pasta are condemed to reheat it.
Those who forget the pasta are condemned to reheat it.
Those who fought for it know the true taste of freedom!
Those who give up liberty for security, deserve neither. B Franklin
Those who go to college and never get out are called professors.
Those who hate Windows have slow computers!
Those who hate and fight must stop themselves
Those who have a problem with thier modem complain that others suck.
Those who hear them seldom live to tell the tale!
Those who ignore history are doomed to repeat it...
Those who ignore history have no future. -- Heinlein
Those who in quarrels interpose must often wipe a bloody nose.
Those who in quarrels interpose, must often wipe a bloody nose.
Those who know don't tell; those who tell don't know -Lao-Tze
Those who know me, despise me.
Those who learn not from history are doomed to repeat it.
Those who live are those who fight. - Victor Hugo
Those who live be the sword get shot by those who don't.
Those who live by the dragon die by the dragonlance.
Those who live by the knife, get shot by those of us who don't.
Those who live by the nit, die by the nit
Those who live by the sea, shall die by the sea.
Those who live by the spam get shot by those who don't.
Those who live by the sword ... kill those who don't.
Those who live by the sword KILL those who don't.
Those who live by the sword are shot by those who don't.
Those who live by the sword die by dragon breath.
Those who live by the sword die by the arrow.
Those who live by the sword die by the crossbow bolt.
Those who live by the sword die by the fireball.
Those who live by the sword die by the lightning bolt.
Those who live by the sword die by the phaser.
Those who live by the sword die by the photon torpedo.
Those who live by the sword die by the shotgun blast!
Those who live by the sword get shot by those that don't.
Those who live by the sword get shot by those who do not.
Those who live by the sword get shot by those who don't
Those who live by the sword get shot by those who don't.
Those who live by the sword must die by the sword.
Those who live by the sword shall be shot by those who don't
Those who live closest arrive latest.
Those who live in glass houses should get dressed in the basement.
Those who live in grass houses shouldn't stow thrones!
Those who live in paper houses should not play with flamethrowers.
Those who live in the lord never see each other for the last time.
Those who never make mistakes are those who never do anything.
Those who play with cats must expect to be scratched.
Those who post unwisely are unable to post
Those who pun should be drawn and quoted.
Those who race toward Death, those who wait, those who worry. -JM
Those who run are enemy. Those who don't are well trained enemy.
Those who run are enemy; those who don't are well trained enemy.
Those who say "I hate to ask this of you..." usually don't.
Those who say cats have no soul have never gazed into their eyes...
Those who scream for equality know they're not.
Those who soil a Wellington put their foot in it..
Those who speak do not know; those who know do not speak.
Those who speak loudest always have the least to say.
Those who stand for nothing fall for anything.
Those who talk don't know. Those who don't talk, know.
Those who testify in the name of Christ are going to their Hell
Those who think they know everything annoy those of us who do.
Those who think they know everything annoy us that do.
Those who think they know it all upset those of us who do.
Those who think they know it all, bother those of us who do!
Those who think they know it all, often upset those of us who do.
Those who throw dirt are just losing ground.
Those who trade liberty for security have neither.
Those who trade liberty for security will likely end up with neither.
Those who want political power probably don't deserve it.
Those who want to learn WILL learn.
Those who wish to *be* must put aside the alienation...-Rush
Those who won't think will have it done for them.
Those who won'tn't think will have it done for them.
Those who work with computers have terminal problems.
Those who would be enslaved, must first be disarmed.
Those who would repeat the past must control the teaching of history.
Those who would sacrifice liberty for security deserve neither.
Those who would seek the path of @IDIC throw no stones...
Those who write the manuals, don't use the hardware.
Those whom God wishes to destroy, are first made mad.
Those whom the gods love grow young.
Those whom the gods would destroy they first make liberal.
Those wings of yours are pretty nice,whadaya think they're worth used?
Those with fancy foods must be careful with knives, said Tom delicately.
Those with no sense of humor become Moderators.
Those with no sense of humor become moderators.
Those with sensative noses can come back out now, Bullitt has gone.
Those with the weapons make the rules.
Those without heads do not need hats.
Thou Shalt Covet Thy Neighbor's Tagline.
Thou Shalt Not Talk About Thy Rod To Thy Staff
Thou art God(dess).
Thou art full of shit!!!
Thou art so leaky, that we must leave thee to thy sinking.
Thou art the book, the library whereon I look. * King
Thou canst not touch this. M.C. Hamlet.
Thou hast besquirted me, O leotarded one!
Thou hast besquirted me, Oh Leotarded One! - Sheriff of Dodge City
Thou hast seen nothing yet.
Thou shall flirt shamelessly with all members of the opposite sex!
Thou shall flirt shamelessly with all members of the opposite sex.
Thou shall not covet thy neighbor's tagline.."Borrow it!" ;-)
Thou shall not kill, unless it's for dinner!
Thou shall not kill.
Thou shall not sleep within an interrupt handler.
Thou shalt Honor thy SysOp.
Thou shalt flirt shamelessly with all members of the opposite sex
Thou shalt honour thy bean and thy grinder. - Jalapeno
Thou shalt kick butt.
Thou shalt kick thy neighbor's butt.
Thou shalt log on properly and in accordance with thy SysOp's wishes.
Thou shalt love thy BBS with all thy heart and all thy bytes.
Thou shalt not _____ <-insert favorite vice
Thou shalt not ________. <- Insert Favorite Vice.
Thou shalt not ________. <- Insert Favorite Vice.
Thou shalt not admit adultery.
Thou shalt not bear false witness against thy neighbor - Ex. 20:16
Thou shalt not commit adultery... unless in the mood.
Thou shalt not covet thy neighbor's tagline
Thou shalt not covet thy neighbour's taglines.
Thou shalt not kill (unless you're in DEATHMATCH mode).
Thou shalt not kill? What about Deuteronomy 22:22?
Thou shalt not kill? What about Exodus 22:18-20?
Thou shalt not kill? What about Leviticus 20:9-16?
Thou shalt not kill? What about Numbers 31:17?
Thou shalt not kill? What about the Death Penalty?
Thou shalt not let..moochers into thy..hut.
Thou shalt not miss adultery.
Thou shalt not post messages while drunk.
Thou shalt not rape the land, for that would be "Sod-omy."
Thou shalt not suck. - Butthead
Thou shalt not tempt the Lord thy God - Matthew 4:7
Thou shalt not try to herd cats; be they users or sysops.
Thou shalt pay homage to the god favored by the majority or die.
Thou shalt pay homage to the god favored by the majority...
Thou shalt remember the 11th commandment and keep it wholly. L. Long
Thou shalt remember the Eleventh Commandment and keep it Wholly.
Thou shalt speaketh to the SysOp thy real name.
Thou wast not born for death, immortal bird!
Thou whoreson Z! Thou unnecessary letter! -- Shakespeare
Thou whoreson Z! Thou unnecessary tagline! -- Tagspeare
Thou whoreson Z! Thou unnecessary letter! - Shakespeare
Though God cannot alter the past, historians can. -- Butler
Though God cannot alter the past, historians can. -- Jack Butler
Though I never left, I'm back. :-)
Though deepening trials throng your way, Press on, Press on ye saints of
Though his mind is not for rent, don't put him down as arrogant -Rush
Though the leaves are many, the root is one.
Though the patient had never been fatally ill before, he woke up dead.
Though they say, The Lord liveth; surely they swear falsely.-Jer.5:2
Though they'll never fathom it behind my sarcasm desperate memories lie
Though this be madness, yet there is method in it. -- Hamlet
Though this be madness,yet there is method in't...Shakespeare, Hamlet
Though this tagline be madness,yet there is method in't. Tagspeare
Though we share so many secrets, there are some we never tell...
Though you may disappear / you're not forgotten here.
Thought Crimes, Political Cleansing and Gun Control go hand in hand.
Thought Frankie Avalon was fully versed in English - Crow
Thought I wouldn't notice you sneaking off, eh?
Thought I'd been through this in 1919, counting the tears of 10,000 men.
Thought for the Day - Have you hugged your Dragon today?
Thought for the day: What if there were no hypothetical situations?
Thought is action in rehearsal
Thought is the blossom; language the bud; action the fruit behind it.
Thought links corrupted Reformat brain? (Y/N)
Thought of the day ... To QuaWK or not to QuaWK?
Thought pattern currently blocked....please hold!
Thought promotes thought.
Thought this looked like your work. -True Lies
Thought you were an atheist.-Mulcahy. Gave it up for Lent.-Klinger
Thought you'd be packed and on a plane to somewhere. - Methos
Thought: Why does sour cream have an expiration date?
Thoughts in this message are weirder than they appear.
Thoughts of the day....... To QuaWK or not to QuaWK?
Thousands of Americans are trying to find peace in a pill.
Thousands of centuries I will endure, tyrant of all prophecies
Thousands of journeys have a start but no end.
Thousands of times. Well, hundreds. Maybe fifty. - Neelix
Tho{jad of the Just-Happy-Enough-To-Piss-Everyone-Else-Of
Thrashing is just virtual crashing.
Thread is ripping the knot is slipping --U2
Threadbearer: The kid in 3rd grade who can thread the film projector.
Threads will die if left unfed. --Second Law of Echo Physics.
Threads? Where? All I see is text!
Threats are illogical, and payment is usually expensive.
Threats are illogical.
Three Hundred Baud Tagline.
Three Golden Rules for speakers: Stand up, Speak up, Shut up
Three Jews go into a bar and buy it!
Three Months In The Saddle : by Major Assburn
Three Scottish sizes: Wee, Not-So-Wee and Friggin' Huge!
Three Stages of Sex Tri-Weekly, Try Weekly, Try Weakly
Three ambulances take BLAST victim to hospital.
Three blondes in a V.W....Farfromthinken
Three blondes in a Volkswagen = Farfromthinking!
Three boxes keep us free: Ballot, Jury, and Cartridge.
Three boxes keep us free: ballot, jury, and ammo.
Three bucks?! I'm gonna buy a french fry, Pop! - Tom
Three can keep a secret - if two are dead.
Three can keep a secret, but only if two are dead.
Three can keep a secret, if two are dead.
Three can keep a secret, if two of them are dead.
Three can keep a secret, if two of them are dead.
Three can keep a secret...if two are dead.
Three categories of work: to be done, in process, & not quite done.
Three certainties in life: 1) Death; 2) Taxes; 3) Gas in church.
Three chickens short of a henhouse.
Three chocolate sundaes please ... I'm in a really bad mood!
Three daughters and a wife, VACATION? WHAT VACATION?!?
Three dots...SOS. Hold fire! That's the Captain! - Ivanova
Three down football.......it'll make ya squirt!
Three dreaded words when making love: Ignore the rash.
Three dreaded words: hard disk failure
Three dreaded words: hard disk failure.
Three drinks: The difference between a dog and a fox.
Three free thugs set three thugs free.
Three glories of speech: steadiness, wisdom, brevity.
Three hundred bps - faster than a speeding Windows!
Three it's a magic number, oh yes it is.
Three jacks for handsome young Ensign Bullitt. --Troi.
Three jacks for handsome young Ensign Orville. --Troi.
Three jacks for the handsome young Ensign -- Deanna
Three kinds of lies: Lies, damned lies, and statistics!
Three kinds of mini-skirts: mini, maxi, and don't bend over!
Three locations - Crow
Three may keep a secret if two are dead. -- Franklin
Three may keep a secret if two of them are dead.
Three may keep a secret, if two of then are dead. --Franklin.
Three more neurons and you'd make a good mollusk!
Three more screw ups on my part and I could pass for a Bajoran.
Three most dreaded words for a man to hear: "Honey, I'm pregnant."
Three mouse buttons may be too many, but one is sure not enough.
Three on an elevator! Bad luck! - Crow
Three options: Die. Die painfully. Drink Pepsi.
Three out of five people aren't the other two.
Three out of four Rottweilers prefer Jehovahs Witnesses!
Three out of four people... make up 75% of the population.
Three quarks for Muster Mark, sure it's all beside the bark.-James Joyce
Three ring circus: engagement ring, wedding ring, suffering
Three rings for the Elven Kings under the sky,
Three second recharge before firing. --Ivanova.
Three shall be the number of the counting...
Three signs of a brehon: wisdom, information, intellect.
Three simple words: @FN@ started it!
Three simple words: YOU started it!
Three stages of Sex: Tri Weekly, Try Weekly and Try Weakly.
Three stages of Sex: Tri Weekly, Try Weekly and Try Weakly...
Three syllables?! - Crow as Kathy Ireland reads letter
Three thieves and a bard. What a pitiful group.
Three things a BBSer needs - Disk Space, Memory, Money
Three to beam down to Wayne's World.
Three weeks ago I couldn't spell EMT, now I is one......
Three white rabbits commented: "Oh, No! A Gray Hare!!"
Three wise men? You've got to be kidding!
Three words for Regis Philbin: Prozac, Prozac, Prozac!
Three words that quell riots: "Shoot to Kill."
Three words women love to hear -- no prenupital agreement.
Three worst words when you're making love? 'Honey, I'm home.'
Three-in-a mind beats a paranoid.
Three. Hundred. Baud. Tagline.
Threek - A fork with a bent tine.
Threek: a fork with a bent tine.
Thrickle: Itch in the back of the throat scratched by making noises.
Thrift is a great virtue in an ancestor.
Thrift is a wonderful virtue - in an ancestor.
Thrift shock - Spotting previously owned items at a Salvation Army.
Thrift shock: spotting previously owned items at a Salvation Army.
Thrifty means spending other people's money.
Thrill as they exit - Mike
Thrill me, then leave.
Throne? How do you lift the lid? -Wako Like you lift the lid. -Dot
Thronie: Jiggle you give a toilet handle to make it stop.
Thronie: Jiggle you give the handle of a toilet to make it stop running.
Through me the way among the FidoCON below.
Through nonaction, nothing is left undone. -- Lao Tzu
Through our dreams, we go further ...
Through selfless action, he attains fulfillment.
Through the eyes of a child the whole world is new...
Through the looking-glass, Commander.. - Kira
Through the transitive nightfall of diamonds..
Throw 'em into this aircraft's jail! - Blowski (Animaniacs)
Throw Axe! Throw Shield! Throw DWARF! - beserk Minotaur
Throw Limbaugh from the Train! (well, it sounds like Mama.)
Throw Papa down the stairs his coat.
Throw _ME_ the coat, _I_ want to die!
Throw a wrestling match? Nooo! - Tom
Throw another Beach Boy on the fire...
Throw another Ken on the Barbie!
Throw another Ken on the Barbie.
Throw down your hotdogs - Crow
Throw grammar to the wynds! Who done care anywho?
Throw it into the raft...<HISSSSS> - Tom
Throw keyboard out window to continue.
Throw me the lemur, that's all I want - Crow as dinosaur
Throw paint on my fur coat, and you'll be as dead as these rabbits!
Throw rocks at birds...Leave no Tern unstoned.
Throw rocks at sea-birds; leave no tern un-stoned.
Throw some wings on her, you sly boots - Tom to Mike
Throw the ferret & shout "GO AWAY, BAD THINGS!!!"
Throw the keyboard out the window to continue.
Throw the rascals out! Good god, they did!
Throw up under the bleachers - Mike sings
Throw your spear at the monster stock footage - Crow T. Robot
Throw your windows out of the windows
Throw yourself on the floor, so I don't have to beat you down!
Throw yourself on the ice, so I don't have to get a penalty!
Thru eternity ring Vivat! Life to the everlasting cat!
Ths s n xmpl f syntx rrr.
Thtimatithm! Thath' what it ith! Th-th-thhhhtigmatithm!
Thuffering Thuccotash!
Thufir's a Harkonnen now.
Thuggees do it with a silk rope.
Thumb tax - An excise tax on hitchhikers.
Thump! Thump! Bang! Bang! Thump! Bang! Thump! Bang!
Thunder? I didn't hear any thunA*(&#@ NO CARRIER
Thunder? I don't hear any thu^%@#* NO CARRIER
Thunderbolts and lightning, very VERY frightening.
Thunderclap - an extremely violent form of VD.
Thunderheads are rumbling in a distant overture..... -RUSH
Thursday I don't care about you
Thursday never looking back
Thus He said sadly. <Big Sigh>
Thus conscience does make cowards of us all -- Hamlet
Thus ends another wit-filled message.
Thus quoth the Raven OLR: "Nevermore!"
Thus spake Kalmoth the Vile, Slayer of the Seven Pigs of the North.
Thus the Sisson tradition of culling was born.....
Thy brains are useless, boiled within thy skull! - Shakespeare
Thy freddled gorgonaut is crulish to the jello- Vorgon Poet.
Thy little centuries go by so swiftly. -- Q
Thy logick, like thy locks, is disarrayed;
Thy output come, thy input done. On disk as it is in memory.
Thy strength, oh Lord, is made perfect in my weakness.
Thy taglines are useless, boiled within thy skull! -- Tagspeare
Thy word is a lamp to my feet. Ps 119:105
Thy word is a lamp unto my feet, and a light unto my path.
Ti imas boziji dar na usnama, zato poljubi me i to sto god mozes bolje
Ti imas pokvareno plave uvojke i znak Lune u ocima
Ti nemas vise prava, pitati za mene, nekad sam te voleo, patio zbog tebe
Ti si meni sve, ti mi dajes sve, i kad tebe nema, tesko mi je...
Ti si moja cokolada i da nema onog gada, ja bih te ljubio
Ti si moja cokolada i da nisi tako mlada, ja bih te ljubio
Ti si nas idol Super Ajde sad' idi ...
Ti si prava sizika, ljubav je u tvojim ocima i na usnama punim osmeha
Ti si savrsenstvo bez mane, ti se deo vojnickih snova,
Ti si slatka, al'ja sam na dijeti.
Ti si u tjelu punom zelja sa usnama zednim iznenadjenja
Ti volis jedino svog zeca od plisa svog malog belog misa i rodjake
Ti znas, ja znam prezivecu i sve je u redu je,
Tia Carrera! We may have to pay attention! - Crow leers
Tia mi aven Moridion isainde vadlin <Horn of Valere>
Tiamat ... Bite me .... uh ... let me rephrase that.
Tiamat, Goddess Mother, True Source of Life.
Tiassa dreams and plots are born.
Tibet: The last hostage nation of the cold war.
Tibia -- country in North Africa
Tibia: Country in North Africa.
Tibia: a country in North Africa
Tic Tac Toe and way to go
Tick - Tock, Tick - Tock. Time is wasting away...
Tick, 5'll get ya 10, 10'll get you 20, 20'll get ya a million zillion.
Ticking away the moments that make up a dull day.. - Pink Floyd
Tickle Patrol! - Mike
Tickle monster! Tickle monster! - Crow as heroes fight
Tid-Bits: What you get when you blow up a Tid.
Tides are caused by clams burping in unison.
Tie 2 birds together and they can fly, if they become One. D Carradine
Tie 2 birds together-and though they have 4 wings they cannot fly.
Tie 2 birds together;Though they have 4 wings they cannot fly.Ah Sahm
Tie a cat to a Ferrari. Drive fast, watch cat split.
Tie a yellow fighter to the ol' oak tree!
Tie a yellow ribbon around Jane Fonda's neck..
Tie m'kangaroo down sport, tie m'kangaroo down!
Tie me kangaroo, down, sport, tie me kangaroo down...
Tie me up, beat my ass...
Tie me up, tie me down, anyway you tie me is fine!!!
Tie two birds together & tho they have four wings, they cannot fly.
Tied to a cage of canaries in a Pet Shop: For Sale, Cheep!
Tiefright: The fear of turning the twist-tie in the wrong direction.
Tiger In The Outhouse - By Claud Balls
Tiger, tiger, burning bright, how you save electric light
Tigerman!
Tigers' tummies are solar cells. Yeah, right.
Tigers' tummies are solar cells. Yeah, right. - Calvin
Tigger kept saying I didn't listen to her, or something.
Tigger not found. Enter forbidden topics? [Y/N]
Tigger of Borg: ASSIMILATING! That's what Tiggers do best!
Tigger of Borg: ASSIMMILATING! That's what Tiggers do best!
Tigger of Borg: A Tigger can assimilate anything.
Tigger of Borg: ASSIMILATING! That's what Tiggers do best!
Tigger of Borg: Assimilatin' is what Tiggers do best!
Tigger, your checks are no good. They always bounce!
Tight Situation: Leah Tard
Tighten 'til it cracks, then back off 1/2 turn.
Tighten it until it cracks, then back off a half turn...
Tighten it until it cracks, then back off a half-turn!
Tighten it until it cracks. Then back off half a turn.
Tighten till it cracks ... then back off 1/2 turn.
Tighten until it cracks, then loosen slightly.
Tighten until it cracks... then back off 1/2 turn.
Tighten your seatbelt, I want to try something!
Tightpants from sky appear. Bring much cargo, feed redshirt to monster
Tika today, Borg tomorrow.
Til we cross-references again.....
Till all at once it's half past three.
Till death do us part, I'll love you with every beat of my heart.
Till she trades her PC in on a wheelchair?
Till the cats set us free.
Till the soils of ignorance before you plant the seeds of knowledge
Tilt your chair back, your breath is effecting my RAM!
Tilt'a'whirl - Crow on wrestling hold
Tilting at windmills hurts you more than the windmillls. - Heinlein
Tilting at windmills hurts you more than the windmillls. - L. Long
Tilting at windmills hurts you more than the windmills.
Tilting at windmills hurts you more than the windmills. -- RAH
Tim "The Toolman" Taylor...The "Don't-Do-It-Yourself" Man.
Tim Fall Down Go Boom: Rocket Launcher
Tim Forty is to moderators what mosquitoes are to campers..
Tim Forty joins the echo. Moderator has a link cut party.
Tim Forty strikes with +2 Dagger, +8 Holy Avenger for the moderator
Tim On A Stick: Rod of Ruin
Tim Takes A Cruise: Pirate Ship
Tim Taylor Pakled: It is broken. It needs MORE POWER!
Tim is to moderators what mosquitoes are to campers..
Tim's Brother: Tor Wauki
Tim's Evil Stepsisters: Coumbajj Witches
Tim's Mother-In-Law: Witch Hunter
Tim's Pet: Thorn Thallid
Tim's Sister: D'Avenant Archer
Tim: Jean-Luc
Tim: Prodigal Sorcerer
Timber Wolves, one heck of a Beautiful Animal!!!!!
Time & Tide Melts the Snowman. -The 7th Doctor.
Time - just one damn thing after another
Time - the only thing to keep all from happening at once.
Time Can Change Me - But I Can't Change Time
Time Flies Like the Wind, House Flies Like sh!t.
Time Stand Still -- I'm not..... -RUSH
Time Stands Still! Film at 11:00, or whenever.
Time Stands Still! Film at 11:00, or whenever.
Time Stops for no man. Except me.
Time Travel Seminar-Two weeks ago, Thursday
Time Warp? Nahh, Just WaRpEd!
Time accelerates with age. A Yugo sport sedan accelerates with gravity.
Time and Genealogy wait for no man.
Time and Genealogy waits for no man.
Time and place for everything! My place at 8..everything!
Time and space are reeaaly easy.
Time and space is a bitch!
Time and tide, nothing and no one can stop us now...
Time at a keyboard does not count against your life
Time available to go fishing shrinks as fishing season draws near.
Time cancels young pain. Euripides (431 BC)
Time don't matter to me.
Time eases all things. Sophocles (406 BC)
Time eases all things.<Sophocles (406 BC)>
Time exists so that everything doesn't happen at once.
Time exists solely to prevent everything from happening at once.
Time flies like an arrow - Fruit flies like a banana
Time flies like an arrow - Fruit flies like a banana.
Time flies like an arrow - fruit flies like a banana.
Time flies like an arrow and fruit flies like bananas!
Time flies like an arrow but fruit flies like a banana
Time flies like an arrow, Fruit flies like bananas
Time flies like an arrow, but fruit flies like a banana
Time flies like an arrow, but fruit flies like a banana.
Time flies like an arrow, but fruit flies like pears!
Time flies like an arrow, fruit flies like a banana.
Time flies like an arrow. Fruit flies like a banana. -- Groucho Marx
Time flies like an arrow; fruit flies like a banana.
Time flies like arrows, fruit flies like banannas.
Time flies like the wind but fruit flies like bananas.
Time flies like the wind, but fruit flies like bananas.
Time flies like the wind, fruit flies like a banana...
Time flies like the wind, fruit flies like bananas.
Time flies like the wind. So do farts.
Time flies like wind, fruit flies like pears!
Time flies like wind. Fruit flies like pears.
Time flies likes wind. Cheeeiit. Fruit flies likes pears.
Time flies when you don't know what you're doing.
Time flies when you're alive.
Time flies when you're dazed and confused.
Time flies when you're having a panic attack.
Time flies when you're having bugs.
Time flies when you're having fun.
Time flies when you're in a coma.
Time for Timer!
Time for a nice, long walking sequence - Tom
Time for a quick adventure, then back for tea.
Time for another Boston Teaparty! DUMP THE INCUMBENT!!!
Time for another tea party; at Washington this time!
Time for culture -- Gone CHOPIN, BACH in a MINUET.
Time for culture, gone Chopin, Bach in a minuet
Time for culture, gone Chopin, Bach in a minuet.
Time for lust, Time for lie, Time to kiss your life goodbye
Time for me to post the rules again...
Time for my morning SysEx dump.
Time for the penguin on your telly to explode
Time for the penguin on your telly to explode.
Time goes? Alas, no - time stays, we go.
Time goes? No. Alas time stays, we go.
Time had somehow divorced itself from my reveries.
Time has a way of making changes in all things.
Time has a way of taking time; loneliness is not only felt by fools.
Time has a wonderful way of weeding out the trivial.
Time has claimed you--Jim Morrison
Time has packaged my best friend into a goddess of love. -- Al
Time he peeps she's wearing her most demure outfit - Mike
Time heals all wounds, but the belly button remains.
Time heals everything? Try waiting in a doctor's office.
Time hurries on, and the leaves that are green have turned to brown.
Time is Money! Steal some today!
Time is NOT currently one of my problems. "Hitchhikers' Guide"
Time is a dressmaker specializing in alterations. <Faith Baldwin>
Time is a fool's best friend.
Time is a great teacher but kills all its pupils.
Time is a great teacher, but it kills all its pupils.
Time is a great teacher, but unfortunately it kills all its pupils.
Time is a gypsy caravan, steals away in the night.. -N.P., Rush
Time is a gypsy caravan, steals away in the night..... -RUSH
Time is a leading factor in death from old age.
Time is a luxury you don't have -- Khan
Time is a merciless filter.
Time is a storm in which we are all lost.
Time is a stream we fish in
Time is always faster than your watch
Time is an illusion (lunch time doubly so).
Time is an illusion -- especially while modeming!
Time is an illusion created by Marvel Comics!
Time is an illusion perpetrated by the manufacturers of s
Time is an illusion perpetrated by the manufacturers of space.
Time is an illusion perpetrated by the manufacturers of space. - Graffiti
Time is an illusion, lunchtime doubly so.
Time is an illusion. Lunch time, doubly so. - Ford Prefect
Time is an illusion. Lunch, doubly so.
Time is an illusion. Lunch-time doubly so.
Time is an illusion... especially while modeming!
Time is an illusion....especially while modeming!
Time is an illusion; lunchtime, doubly so. -- Ford Prefect
Time is but a stream we go a'fishing in Thoreau
Time is but the stream I go a-fishing in. --Henry David
Time is but the stream I go a-fishing in.<Thoreau>
Time is forever -- a diamond is only temporary
Time is fun when you're having flies- Kermit the Frog
Time is important; try to answer as quickly as possible.
Time is just an illusion perpetuated by the manufacturers of space.
Time is just nature's way of keeping everything from happ
Time is just nature's way of keeping everything from happening at once
Time is like a fuse, short and bruning fast..
Time is money and money I serve.
Time is money, and many people pay their debts with it.
Time is money, as many merry widows have proven.
Time is money. Especially if you make clocks.
Time is nature's way of keeping everything from happening all at once.
Time is nature's way of keeping everything from happening at once.
Time is nature's way of making sure that everything doesn't happen at once.
Time is natures way of keeping everything from happening at once.
Time is never wasted, if you're wasted all the time.
Time is not a line, but a series of now-points. <Taisen Deshimaru>
Time is not currently one of my problems. - Arthur Dent
Time is of the essence, so close the door!
Time is only God's way of keeping everything from happening at once.
Time is precious, but truth is more so.
Time is so everything doesn't happen at once.
Time is something we don't have. - Connor MacLeod
Time is the best teacher, but it kills off all its students.
Time is the best teacher. Unfortunately, it kills all its pupils. -- Berlioz
Time is the best teacher; unfortunately it kills all its students.
Time is the best teacher; unfortunately, it kills all its students.
Time is the dressmaker specializing in alterations.
Time is the fire in which we burn. Soran, Generations
Time is the wisest of all counselors.
Time is what keeps everything from happening at once ...
Time it was, and what a time it was...
Time just slipped away.
Time keeping everything from happening at once.
Time keeps on slippin slippin slippin into the future
Time keeps on slippin', slippin' into the future...
Time keeps on slippin', slippin', slippin' into the future.
Time keeps on slippin',slippin',slippin' into the future
Time machine, my foot. Why, it couldn't tell you the time, much less..
Time management begins with a very large wastebasket.
Time may be a great healer but it's no beauty therapist
Time may be a great healer, but it's a lousy beautician.
Time meant nothing, never would again.
Time on your hands? Get Windows.
Time passed, which, basically, is its job.
Time passes?! No, TIME stays - WE pass on.
Time really flies when you don't know what you're doing.
Time shall unfold what pleated cunning hides - Cordelia, King Lear
Time slows if you're on the outside of the bathroom door.
Time sneaks up on you like a windshield on a bug. -Jon Lithgow
Time spent at Cons does not count against your lifespan
Time spent at SF Cons does not count against your lifespan.
Time spent at Sci Fi Cons does not count against your lifespan.
Time spent petting your cat is not deducted from your lifespan.
Time spent playing with your cat is not deducted from your life span.
Time stands still, baby when I touch you...
Time sure flies when you're married and have no life. - A. Bundy
Time takes time.
Time to Iraq'n'roll.. make Baghdad bounce..
Time to breed der master race! - Crow on viking couple
Time to die! Hahahaha! - Frank to Dr. Forrester
Time to die. --Roy Batty.
Time to drown the lemur - Crow as couple get into raft
Time to failure: 3 Hours, 9 minutes, 10.7 seconds...aproximately!
Time to give the United States back to the.... People.
Time to go have better sex than you have ever had - Crow
Time to inject the "I worship Rasta Virus" into your TLX database.
Time to lock and load, Time to take control...start again...-Bob Seger
Time to make like a baby and head out.
Time to make like horse sh!t and hit the trail.
Time to pester the sysop into picking up the Wilderness echo!
Time to put out the cat...<<BLAM!>>
Time to spellcheck the Tagline file.
Time to spellcheck the recipe file.
Time to start diet when you stop running and parts of you keep moving.
Time to stop writing an wait for more questions.
Time to take the Christmas lights down...naw, next year.
Time to talk to `the judge'. Booiiinnnggg!
Time travel gives me nosebleeds. - LaForge
Time travel instructions: "Fold along the dotted plane"
Time travel seminar next week. Did you attend?
Time waits for no man and very few women.
Time waits for no one at all, not even you.
Time was in a distortion phase.
Time was invented so relatives could be found, one by one.
Time will tell on a man, particularly a _good_ time.
Time wounds all heels.
Time you enjoy wasting is not necessarily wasted time.
Time's a b*tch, isn't it? - LaCroix
Time's a bitch, isn't it? - LaCroix
Time's fun when your having flies. :)
Time's so near, you can almost taste the freedom...
Time, said Arthur weakly,is not currently one of my problems.
Time, the subtle thief of youth
Time, time, time: see what's become of me.
Time--it's just one damn thing after another.
Time-Travelling Tagline v1.0 = Copyright (C) January 1, 2097
Time. Thought I'd made friend with time. - Tori Amos
Time: a true supply-and-demand problem!
Time: A descending scale of intelligence.
Time: an illusion brought to you by the makers of space.
Time: an illusion perpetrated by the makers of space.
Time: nature's way of keeping events seperated.
Times approximate.
Times are changing nothing stays the same for this jukebox generation.
Times are so hard that even those who won't pay aren't buying!
Times fun when you're having flies.
Times like this I wish I practiced voodoo. - Don Schanke
Times when you're all alone, all you do is think.
Timing is everything, ask your car.
Timmy! I never saw Lassie do THAT before!
Timothy Leary is dead, No he's on the outside looking in.
Timothy Leary is dead, Timothy Leary is dead.
Timothy Leary's dead.
Timothy Van Patton is NOT the type for a gerbil! - Tom
Timothy: A DNA sequencing error between a dinosaur and a Slug.
Timothy: What happens when you feed a smurf after midnight.
Tin Man call your flock, the steel wool is rusting on the sheep.
Tin cans and a string....
Tin soldiers and Nixon comingWe're finally on our own.
Tina Turner - something Jim Henson dreamed?
Tina Turner brought some hot dish - Tom on voodoo girl
Tini saw drawer, a reward was in it.
Tinker Bell is having Elmer Fudd's baby. - Outland
Tinker Bell is having Elmer Fudd's baby. --Outland.
Tinker gnomes do it with tools.
Tinker gnomes invented Uzis?
Tinker, Tailor, Soldier, Sysop - John Le Carrier
Tinkering with time is always a bad idea. <The Doctor>
Tinkering with time is always a bad idea. <The Doctor<
Tinnitus: the sound of synapse links snapping.
Tinsel is really snake mirrors.
Tinsel is really snakes' mirrors. - s.w.
Tinseltown Tales: Holly Wood
Tiny Tim: Icatian Javelineer (also called Tim's Cheap Uncle)
Tiny Toon Adventures starring Buster and Babs Bunny with Ross Perot.
Tiny Toons are to Reality what Barney is to Entertainment
Tioc Faidh Ar La!
Tip #1 for eating seafood--If it fights back it just means it's fresh!
Tip #1 for eating seafood: If it fights back, it just says it's fresh!
Tip #5: The light at the end of the tunnel is a train.
Tip #9: Add DEVICE=FNGRCROS.SYS to CONFIG.SYS
Tip #9: Add DEVICE=FNGRCROS.SYS to CONFIG.SYS
Tip for aliens in NY: Land anywhere... no one will care or even notice
Tip of the day: Never fry bacon when you're naked!
Tip of the hat to our beloved Moderator.
Tip of the hat to our beloved sysop. - Mycroft
Tip the world and everything loose lands in Los Angeles.
Tip the world over on its side and everything loose will
Tip: If you let the smoke out of a component, it won't work anymore.
Tip: Don't get OS/2 infected. Chances are, you couldn't make backups.
Tip: Never pet a burning dog.
Tipoes?.... What Typpos?
Tipper Gore is a closet Dittohead!
Tipper Gore is a closet ditto-head!
Tips: Wages we pay other people's hired help.
Tips: Wages we pay other people's hired help.
Tips: Wages we pay to other people's hired help.
Tips: wages we pay other people's hired help.
Tipsy & pink! Doughy guys roamed the land freely! - Tom
Tire tracks cross yo back-I can see ya'had yer fun - Hendrix
Tired of cleaning yourself? Let me do it
Tired of cleaning yourself? Let me do it.
Tired of the same old crap? Eat more corn!!
Tired, stressed out & worried sick. But thanks for asking.
Tis a pity thy mouth be mantled with teeth to spoil the perfect arsehole
Tis a pleasure doing business with you, Cal!
Tis an ill wind that blows no minds.
Tis as rare as a Republican in a Social Service agency.
Tis better to be hunter than hunted.
Tis better to fail on a glorious quest than to succeed in mediocrity.
Tis better to have loved and lost than just to have lost.
Tis better to have loved and lost, than never to have loved at all..
Tis better to live than to conceive...
Tis brief, my lord. As a woman's love. -- Hamlet
Tis but a flesh wound...
Tis but a scratch!
Tis distance that lends enchantment to the view.
Tis merely a flesh wound!
Tis strange but true; for truth is always stranger than fiction..Byron
Tis the season for mirth, merriment, and manslaughter.
Tis the season of al-tru-is-m fa-la-la-la-laa la-la-la-la
Tis time to fear when tyrants kiss and angels sneer.
Tish! You spoke French!!!
Tish, pishaw, and nonsense! - Ace Rimmer
Tit Tac Toe...Playing footsy with breasts.
Tit, more than a baby feeder, it's for the paw.
Title Puns, I love 'em! -Tom after making joke on credits
Title of a Gulf WAR Book: Lines In The Sand --- by Peter DRAGON
Title of the second DS9 movie? "The Wrath of Morn!"
Titleist Tango: The wiggles some golfers make before every shot.
Titles by Fredrick's of Hollywood - Crow
Tito se rodio,nas narod vodio,Ti-to je zemlju oslobodio
Titration shows BS concentration at 18M...
Titration shows reality concentration at .001M...
Tits: seen one, you seen 'em both.
Tko tebe kamenom, ti njega streamerom!
TmNice? Nice....
Tng Your Way to the Top" by Hillary Clinton.
To <g> or not to <g>, that is the question!
To <g< or not to <g<, THAT is the question.
To 'shake your booty' means 'to wiggle one's butt'. - Homer
To *GOD* be the glory, great things *HE* hath done!
To All Virgins: Thanks for nothing.
To B-2 or not to B-2? That is the Air Force question.
To BBS or not to BBS...what a question!?!
To BBS or not to BBS? What a stupid question.
To Baldly go where no one has gone before. - Robert Picardo
To Be Continued......
To Be Politically Correct You Are Not Allowed To Talk.
To Be is To Do - Socrates
To Be... Or What ?
To Bean or not to Bean? That IS the question- Chef Shakespeare
To Bill Clinton, truth is more of a stranger than fiction.
To Black Jack Pershing. - Potter. Inventor of '21'. - Hawkeye
To Boldly Probe Where No Man Has Probed Before!!!
To Boldly go where no one in there right mind has ever gone before!
To Burglar: STOP!!! Please read this HCI brochure while I call 911!
To Clinton an enemy is anyone who tells the truth.
To Continue Please wait... Sysop has exited to DOS...
To Dan Quayle, sex is a four letter word.
To Do Is To Be: Socrates To Be Is To Do: Plato DoBeDoBeDo: Sinatra
To ERR is human. To blame others is politics.
To ERR is human. To blame others is Politics...
To Each Cat His Own Rat.
To Err is Human - And so much Fun!
To Err is Human -- To Assimilate is BORG!
To Err is Human To Assimilate is BORG!
To Err is Human, to really foul up requires a politician.
To Err is Human. With blondes it's mandatory.
To Err is Human...with blondes, it's mandatory.
To Err is Human; with blondes it's mandatory.
To Err is Humanwith blondes, it's mandatory.
To Filter or not to Filter; That is the question...
To Freud, the world consists of housewives only
To HELL with the Prime Directive...FIRE, Mr Worf!!
To Hell with War - Let's dance instead.
To Hell with the odds! We'll show them we know how to die!
To Hillary Clinton, truth is more of a stranger than fiction.
To IRS: Unfortunately, I can't find those particular documents.
To Live long and Prosper, always carry a charged phaser
To Lorena, I leave stocks, bonds & penile implant: /s/ John Bobbitt.
To Lorena, I leave stocks, bonds & penile implant: John Bobbitt.
To Master Fishing, first you must Master Baiting the Hook
To Post, or Not To Post....that is the question!
To Register send $100,000,000,000 to U.S. Treasury c/o U.S. Defecit.
To Ross Perot...You can't EAT pie charts !
To See the Florida State Bird: Blow your Horn!
To See the New York City Bird. Just cut anyone off.
To See the New York State Bird: Blow your Horn
To Serve Man- at better booksellers.
To Shame A Mob Guy - Crow
To Ski or Not to Ski THAT is the Question!
To Smokers: Frankly, I'd prefer if you'd fart.
To Smokers: How `bout I rip a stinky in your face?
To Smokers: I didn't know that they were forecasting fog this morning.
To Smokers: I don't mind if you smoke just so I can crap in your cup.
To Smokers: I don't mind if you smoke just so I can piss in your cup.
To Smokers: If you smoke, may I fart in your face?
To Smokers: If you smoke, may I rip a stinky in your face?
To Smokers: Look at all the money you save if you killed yourself now.
To Smokers: Look at all the money you'd save if you killed yourself now.
To Split, or not to Split: that is the question.-Amoeba
To Strive, to Seek, to Find and to never yield.
To TAG or not to TAG - that is the question!
To TWIT = AUTOMATIC <N> KEY ENABLED.
To Whom It May Concern: YOU're a special person.
To Windows lovers: "Get a MAC!"
To YOU I am an atheist; to God, I'm the Loyal Opposition.
To YOU I'm an atheist; to GOD, I'm the loyal opposition. (Woody Allen)
To YOU I'm an atheist; to God, I'm the Loyal Opposition
To a Fundie, "family values" means bigotry and intolerance
To a Genealogist, a relative is everything!
To a Klingon warrior, beheadings *are* romantic.
To a Kzin, "NO!" means "Attack ME!"....
To a Parrott, "NO!" means "Not while I'm looking."
To a Pentium, the sum is 1.332887 or something like that....
To a Real Woman, every ejaculation is premature.
To a blonde - What's long and hard? - grade 4!
To a blonde: "No, rain is not caused by giants crying"
To a brat, "NO!" means "Not while I am looking."
To a cat "No!" means "Not while I'm looking"!
To a cat (or a child) "NO" means "Not while I'm looking."
To a cat, "NO!" means "Not while I am looking"
To a cat, "NO!" means "Not while I'm looking!"
To a cat, "NO!" means "Not while I'm looking."
To a cat, "NO!" means not while I'm looking.
To a cat, "No!" mean "Not while I'm looking!"
To a cat, "No" means "not while you're looking"!!
To a cat, 'NO!' means 'Not while I'm looking'.
To a caterpillar, the end of the world; to the Master, a butterfly.
To a dentist, the Batman symbol looks like dirty, yellow teeth.
To a dog (or a child) "NO" means "Not while I'm looking.
To a dog EVERYTHING smells like bacon. --Dukster.
To a dog his owner is Napoleon; hence their popularity.
To a dog his owner is king, hence the popularity of dogs.
To a dog, "Sit!" means: "Why? What've you got for me?"
To a dragon, "NO!" means, "Not while I'm looking"
To a feminist, circumcision doesn't go far enough...Yeooowww!
To a friends' house, the road is never long.
To a genealogist, EVERYTHING is relative!
To a genealogist, everything is relative. And a relative is everything
To a kat 'NO!' means "Not while I'm looking"
To a liberal, only liberals have a right to free speech.
To a little fish, the waters are always deep.
To a photon - the universe moves at 300k km/sec.
To a small mind a nit is an elephant.
To a surprised lawyer: "I'd like to sue a lawyer."
To accept a benefit is to see one's freedom.
To accept faith because it is customaryis to be lazy. - Nietzsche
To achieve the impossible, attempt the absurd
To add a recipe or not add a recipe . . .
To add a tagline or not add a tagline . . .
To all moderators, this is an appology and not ment to be OFF-TOPIC.
To all my friends I leave kind thoughts.
To all things there is a time, perhaps this is theirs. - G'Kar
To all things, there are an end. --Delenn.
To all things, there is an end. Delenn
To all virgins - THANKS FOR NOTHING!
To all virgins. Thanks for nothing
To an elf, a toadstool makes a fine umbrella
To any objective person it'd be obvious that I'm right.
To apologize is to lay the foundation for a future offense.
To appreciate the flower, understand the root.
To appreciate your job, imagine yourself without one.
To ask advice is in nine cases out of ten to tout for flattery.
To ask well is to know much.
To assume makes an ass out of YOU. Leave ME out of this.
To assure being loved, be a person worthy of love.
To attract a vegetarian, make a noise like a wounded vegetable.
To avoid covetousness is to conquer a kingdom. Publilius Syrus
To avoid covetousness is to conquer a kingdom.<Syrus>
To avoid criticism: Do nothing, say nothing, be nothing.
To avoid duplication, make three copies.
To avoid hitting the bumper of the car ahead, I struck the pedestrian.
To avoid off-topic warnings, start conversations with the moderator.
To avoid seeing a fool, break your mirror.
To avoid that run down feeling--cross streets carefully.
To baldly go where no on has gone before : Picard
To baldly go where no one has gone before : Picard
To bawdily go where no man has gone before.
To be * AND * not to be = Zen Shakespeare
To be Frank, I'd have to change my name...
To be Honest: Frank Lee
To be Honest: Frank Lee(a)
To be STrek or not to be StarTrek!!?
To be a Californian means to have faults others don't.
To be a Californian means to have faults that no one else does.
To be a Redneck, you must have been a 'snipe' hunter more than once!
To be a great fisherman, you have to think like a fish.
To be a human without passion is to be dead.
To be a lesbian, or not to be a lesbian, that is the question.
To be absolutely blunt, you're worried about your enormous hooter.
To be acknowledged, madam, is o'erpaid.
To be an elf is to think like one. - J. R. R. Tolkien
To be and not to be, that is the contradiction
To be angry is to revenge the fault of others upon ourselves. A. Pope
To be blunt, you're not that important. -Q to Picard
To be born rich is an accident; to die rich is a miracle.
To be capable of respect is almost as rare as to be worthy of it.
To be different is often a wonderful thing.
To be great is to be misunderstood.
To be honest I was in a pail at the back of my office -Odo
To be honest, one must be inconsistent. - H.G. Wells
To be human is also to seek pleasure.
To be human without passion is to be dead.
To be ignorant of one's ignorance is the malady of the ignorant.
To be ignorant of one's ignorance is truly ignorant.
To be intoxicated is to feel sophisticated but not be able to say it.
To be is to do - Sartre
To be is to do*Socrates To do is to be*Sarte Do be do be do*Sinatra
To be is to do.
To be is to do. Descartes
To be is to do. I.Kant
To be is to do. J.P.Sartre
To be is to do. Descartes
To be is to do. I.Kant
To be is to do. J.P.Sartre
To be is to do. -- I. Kant
To be is to do: Plato
To be is to program.
To be moderate in sin is no more possible than to be moderate in death
To be natural is such a very difficult pose to keep up.
To be or Not is the Result!
To be or not to be - Shakespeare
To be or not to be What a stupid question.
To be or not to be, that always confused me!
To be or not to be, that is the congestion, consumption be done about.
To be or not to be, that is the split infinitive.
To be or not to be, those are the parameters.
To be or not to be. William Shakespeare
To be or not to be.<Shakespeare>
To be or not to be... What a stupid question.
To be or not to be: that is a silly question.
To be or not to be; that is the root of 4b^2.
To be paranoid & Wrong is Sick;to be paranoid & Right is to be Cautious!
To be positive is to be wrong at the top of one's voice. - Ambrose Bierce
To be rather than to seem.
To be righteous, one must first be right.
To be smart requires an attitude, to be dumb requires a brain.
To be too clever is to be stupid.
To be trusted is a greater compliment than to be loved.
To be uman is to be complex.
To be wise, the only thing you need to know is when to sa
To be wise, the only thing you need to know is when to say nothing.
To be, or not to be, those are the parameters.
To be, or not to be... Only cats really know, and they won't tell.
To be, or not to beWhat was A again?
To be, or what? - Sylvester Stallone
To beat to a pulp on a Saturday night!
To beer or not to beer? --Shakesbeer.
To begin your cat collection, simply open a can of tuna.
To believe only possibilities is not faith, but philosophy.
To believe possibilities is not faith, but philosophy. - Nietzsche
To believe with certainty we must begin by doubting.
To believe with certainty, we must begin with doubting. -Stanislaus I
To boldly annoy, in ways none have annoyed before.
To boldly call where no modem has called before.
To boldly code what no one has coded before!
To boldly glow, where no man has glowed
To boldly go and watch Star Trek re-runs.
To boldly go where everyone's already been, at a cheaper rate...
To boldly go where no *THING* has gone before.
To boldly go where no Klingon has gone before...Deanna's panties.
To boldly go where no man has gone before.
To boldly go where no man has gone before; the ladies bathroom!
To boldly go where no one else is dumb enough!
To boldly go where no one has gone before.
To boldly go where no one has gone off topic before!
To boldly go where no one wants to...
To boldly go where no one was stupid enough to go before
To boldly go where no sane man has any business!
To boldly go where no sane person has any business
To boldly go where no tagline has gone before...
To boldly go where... Ouch! I've just wreck my car!!
To boldly go(This porcelain's cold!)were no one has gone...recently
To boldly orbit Bajor like no station has orbited before!
To boldly sit here and wait for it all to come to us: DS9!
To boldly sit here and wait for the universe to come to us!
To boldly split an infinitive at the start of every show...
To boldly split infinitives that no man has split before.
To boldly split infinitives that no man has splut before.
To boldly stay here and wait for it all to come by ... - DS9
To boldy go where no one's gone before...accidentally.
To boldy go where no sane person has any business.
To boldy stay here and wait for it all to come by...* DSN
To bore new worlds, to freak out new life, to smugly go
To breathe is a beatitude. H.F. Amiel
To brighten up your boyfriend's evening, sit with him in the dark.
To bring up a child in the way he should go, travel that way yourself.
To bring up the DOS task list press CTRL-ALT-DEL
To build a temple of sadness.
To build an nuclear weapon is to sin against God.
To call a man an ass is to insult one of God's more honorable beasts.
To calm me down, hit CTRL + ALT + DEL
To catch a Sasquatch is no small feet!
To catch rabbits, hide behind a bush & do carrot calls.
To catch rabbits, hide behind a bush and do carrot calls.
To cats, all things belong to cats!
To clean-up Windows'95 use WIND.EX
To clear screen, press [Ctrl] [Alt] [Del].
To climb a ladder, you begin with the bottom rung.
To climb a ladder, you begin with the first rung.
To clone a felon, do I use the COPY CON command?
To clone a felon, should one use the COPY CON command?
To complete a dream, I start with a vodka.
To complete tagline fill in the blanks ____ ______ _____ _____.
To compute or not to compute, that is the question. County
To conclude our deal, we will have sex human style
To confuse children with angels is a dangerous thing.
To congratulate Bill Clinton, send candy - he already got Flowers!
To contine, enter any 10-digit prime number.
To continue press CTRL+ALT+DELETE
To continue press CTRL-ALT-DEL now.
To continue, Press the PANIC key.
To continue, enter any 10-digit prime number.
To continue, hit <CTL><ALT><DEL>
To cool off a Beer, all you have to do is put it in the ice box.
To correct any problem, type Del *.*
To create is to boggle the mind and alter the mood.<S.A. Ebaugh>
To criticize the incompetent is easy; it is more difficult
To cure insomnia, get lots of sleep.
To curry favor, favor curry.
To days without the chill at morning!.. Draw another goblet! -Rush
To deceive a diplomat speak the truth; he has no experience with it.
To defend, this is the pact.
To define reality is nothing other than pure hypothesis. - Kant
To define recursion, we must first define recursion.
To demolish ruins is an oxymoron, I believe. - Selma
To deny the facts would be illogical, Doctor.
To deter crime, place a gun nut behind every dead bolt.
To die by taglines were but to die in jest. -- Tagspeare
To die by thee were but to die in jest. - Shakespeare
To die defending one's ship is the dream of every Klingon.
To die for.
To die is bad, but to lose my sense of humor...? - Riker
To die is landing on some distant shore.
To die would be an awfully big adventure.
To disarm detonator, cut the red wire. But first, cut the blue one.
To discover my past is to blueprint my future.
To discover one knows nothing is the beginning of wisdom.
To discover proper respect for any authority, ask a cat.
To discover proper respect for authority, ask any cat.
To discover proper respect for authority, twit your sysop
To dispose a soul to action we must upset its equilibrium. E. Hoffer
To diverse gods do mortals bow-Holy Cow and Wholly Chao.
To do is to be - Nietzsche
To do is to be.
To do is to be. J.P.Sartre
To do is to be. Nietszche
To do is to be. Plato
To do is to be. J.P.Sartre
To do is to be. Nietszche
To do is to be. Plato
To do is to be. -- A. Sartre
To do it: Hire someone, or forbid your kids.
To do nothing is also a good remedy.
To do nothing is in every person's power.
To do two things at once is to do neither
To download H Anime pics, hit ALT+H now.
To download Hentai Anime, press Alt-H NOW!
To dream the impossible dream.
To drums that pulse out echoes of darkness, moving to the pagan sound.
To dungeons deep and caverns old.
To each his bone.
To each his clone!
To each his own ca-ca smells sweet - but don't be fooled by this.
To each, his own ca-ca smells sweet. -- Forrest Gump
To eat bread without hope is still slowly to starve to death
To eat is human, to digest, divine.
To eat is human. To digest divine. Mark Twain
To eat is human; to digest, divine.
To eat more, is to become more.
To eat one is to know one.
To eat or not to eat, the question is whom to eat!
To eat, perchance, to barf.
To endure, be obscure.
To enjoy the flavor of life, take big bites. Moderation is for monks.
To envelope it's prey below, deliver to the light. -Megadeth
To err is Human, to assimilate is Borg!
To err is Human. To blame someone else is politics.
To err is Human. To blame someone else is politics.
To err is Humman
To err is Pentium, to forgive, divide.
To err is human - To Assimilate BORG!
To err is human - to moo, bovine.
To err is human -- to blame it on a computer is even more
To err is human and stupid.
To err is human but mostof us never make mistake
To err is human but to really foul things up require a computer.
To err is human but to really foul things up requires a computer.
To err is human but to really foul things up takes a computer!
To err is human! To do it at 40 MHz is automation!
To err is human!! To foul things up you need a computer.
To err is human, but really foul things up requires a computer!
To err is human, but sometimes so devine!
To err is human, but to REALLY muck up takes a computer.
To err is human, but to really foul things up requires a computer.
To err is human, but to really stuff it up requires a computer.
To err is human, to Moo bovine
To err is human, to bark, canine.
To err is human, to blame someone else is PC.
To err is human, to blame someone else is politics.
To err is human, to bleat, ovine.
To err is human, to eat Jello, is messy.
To err is human, to flip a car 6 times and kill someone, is DRUNK
To err is human, to forgive is Not Company Policy.
To err is human, to forgive is against FIDONET policy!
To err is human, to forgive is against FidoNet policy!
To err is human, to forgive is against FidoNet policy.
To err is human, to forgive is against company policy
To err is human, to forgive is against company policy.
To err is human, to forgive is against my policy
To err is human, to forgive is against my policy
To err is human, to forgive is against my policy.
To err is human, to forgive is against sysop policy!
To err is human, to forgive is not Company Policy.
To err is human, to forgive is not company policy.
To err is human, to forgive is out of the question.
To err is human, to forgive is unthinkable.
To err is human, to forgive is unusual!
To err is human, to forgive is... unlikely.
To err is human, to forgive, against FIDO policy.
To err is human, to forgive... unlikely.
To err is human, to forgive....$5.00
To err is human, to hiss, serpertine.
To err is human, to laugh at errors even more so
To err is human, to meow, feline.
To err is human, to moo Bovine.
To err is human, to moo boovine.
To err is human, to moo bovine.
To err is human, to not admit an err is totally male.
To err is human, to oink, porcine.
To err is human, to purr feline.
To err is human, to really foul things up requires a computer.
To err is human, to really foul up you need a computer!
To err is human, to really mess, buy an Amiga
To err is human, to really screw things up requires a computer.
To err is human, to really screw things up you need a computer.
To err is human, to really screw up requires a computer.
To err is human, to star in a John Waters film, DIVINE!
To err is human, to truly foul things up is bureaucracy.
To err is human. And stupid.
To err is human. It takes a computer to really screw things up!
To err is human. To admit it is a blunder.
To err is human. To blame someone else for your errors is even more human.
To err is human. To error is just as human.
To err is human. To forgive is against company policy.
To err is human. To forgive is unusual.
To err is human. To give milk, bovine.
To err is human. To moo, bovine.
To err is human. To purr feline
To err is human. To really screw up it takes a computer!
To err is human. To really screw up it takes a computer.
To err is human. To screw up at 100 megahertz you need a computer.
To err is human. . .to blame it on the other guy is genius!
To err is human. As an elf, I should KNOW.
To err is human. Divine screwups require a computer.
To err is human. To blame it on someone else even more so.
To err is human. To blame someone else is politics.
To err is human. To forgive is against FidoNet policy!
To err is human. To forgive is against Fidonet polices.
To err is human. To forgive is against company policy.
To err is human. To forgive is not in a computer's nature!
To err is human. To forgive is unusual.
To err is human. To moo bovine
To err is human. To moo is bovine.
To err is human. To moo is bovine.
To err is human. To moo, bovine.
To err is human. To purr feline.
To err is human. To purr is feline.
To err is human. To really screw up it takes a computer!
To err is human. To really screw up it takes a computer.
To err is human. To really screw up requires a computer!
To err is human. To really screw up takes Windows.
To err is human. To really screw up takes a computer.
To err is human... To really screw something up requires a computer.
To err is human... to blame it on someone else is even more human.
To err is human....To blame others even more so.
To err is human...To ignore Bill Gates is pure folly.
To err is human; to really foul things up requires a computer.
To err is human; blaming it on others is more human.
To err is human; more than that takes a government.
To err is human; to REALLY foul up requires a computer.
To err is human; to blame it on someone else is politics
To err is human; to blame it on the other party is Republican.
To err is human; to forgive codependent.
To err is human; to forgive is NOT company policy.
To err is human; to forgive is against FIDO policy.
To err is human; to forgive is against FIDONET policy!
To err is human; to forgive is against university policy.
To err is human; to forgive, beyond the scope of the Operating System.
To err is human; to forgive, divine.
To err is human; to forgive, infrequent.
To err is human; to forgive, unusual
To err is human; to forgive... codependent.
To err is human; to moo bovine
To err is human; to purr, feline. Pets are fun.
To err is human; to really botch things requires a MODERATOR.
To err is human; to really botch things requires a sysop.
To err is human; to really foul things up is BUREAUCRACY.
To err is human; to really foul things up requires a computer.
To err is human; to really foul things up takes a computer.
To err is humanUse Windows to really screw things up.
To err is to screw up....
To error is human, to blame it on others is politics.
To establish contact, please yell into keyboard.
To establish voice contact, please yell into keyboard.
To every Ph.D. there is an equal and opposite Ph.D. -- B. Duggan
To every exception there is a rule.
To every exception there is a rule.
To every rule there is an exception, and vice versa.
To every rule there is an exception, except this one.
To every rule there's an exception & vice versa.
To every rule there's an exception, and vice versa.
To everything, turn turn turn, there is a season, turn turn turn....
To excel at what you do, you must love doing it.
To excel when you try, always reach for the brass ring.
To exit Chat Mode, press the `POWER' key.
To explain the world, imagine God as a comedian.
To explore strange new CPUs...
To face the Wyrm without, one must face the Wyrm within.
To fear DOS is the beginning of wisdom.
To feel the warm thrill of confusion.. - Pink Floyd
To feel the warm thrill of confusion...
To feel the warm thrill of confusion..That space cadet glow..
To fight Vader in MKII, insert 50 quarters and reset the machine
To fight Vader in MKII, insert 50 quarters and reset...
To fight the power you have to master the power.
To find a legless woman, follow the slime trail...
To find a policeman in a hurry, double-park.
To find a two-legged man...trace back over Lorena's trail.
To find out a girl's faults, praise her to her friends.
To find out a girl's faults, praise her to her girl frien
To find out a girl's faults, praise her to her girl friends.
To find out about paranoids, follow them around...
To find the easiest way to do something, ask a lazy person to do it...
To find the truth I've even lied - Brad Majors "Superheroes"
To finish first, first one must finish.
To fix a fried modem: Sautee some onion in olive oil..
To fix a fried modem: Sautee some onion in olive oil..
To fix a fried modem: sautee some onion in olive oil...
To fix: 1) Take Hammer 2) Strike a defective monitor when ready!
To forget one's ancestors is to be a brook without a source.
To forgive is divine. But getting even is Heaven!!
To forgive is unusual... but forgiveness FEELS so good !
To free oneself is nothing it's knowing what to do with the freedom.
To free your body, you must first free your mind.
To gain a good reputation, endeavor to be what you desire to appear.
To generalize is to be an idiot. -- William Blake
To get a drink out of a Vogon - stick your finger down his throat.
To get a loan you must prove you don't need it
To get a loan you must prove you don't need it.
To get a loan you must prove you don't need it.
To get a man to do sit-ups, put the remote between his toes.
To get ahead and stay ahead, use your head.
To get back on your feet, miss two car payments.
To get my respect you must get down in the dirt and beg for it.
To get really stoned, drink wet cement!
To get rid of a pain in the neck, try yawning.
To get rid of an enemy, one must love him.- Leo Tolstoy
To get the point, rub a porcupine backwards.
To get the point, rub a porcupine backwards.
To give happines is to deserve happiness.
To give happiness is to deserve happiness.
To go where no clusters have gone before...
To go where no man has gone before... BBSing!
To go where no man has gone before.........
To grow old is preferred to the only other option.
To hardly know him is to know him well. Cary Grant
To have a friend you must first be one.
To have died once is enough.
To heck with Frisco ! Let's go to Montana with all the other weirdos !
To heck with Sampo, who's got the recipie for a Killer Shrew?
To hell and back again.
To hell with 0 to 60: It's 95 to 55 that counts!
To hell with Bill Clinton, get me Phil Hartman!
To hell with Ross Perot, get me Dana Carvey!
To hell with StarFleet! They're 75 years away at warp 9.975!!
To hell with StarFleet! The're 75 years away at warp 10!!
To hell with StarFleet! They're 75 years away at warp 10!!
To hell with Willie!...He's only a fish!
To hell with World opinion: Kick the shit out of our enemies!
To hell with computer chips; track ME with chocolate.
To hell with criticism. Praise is good enough for me.
To hell with criticism. Praise is good enough for me.
To hell with justice...I want blood!
To hell with justice...I want blood...
To hell with safe computing! I love to (B)BS!
To hell with the Nurses!! I'll take the Docs any day!! - Bunny
To hell with the Prime Directive -- FIRE!
To hell with the Prime Directive! FIRE!!!!!!
To hell with the Prime Directive, let's kill something!
To hell with the starGet that camel off my lawn!
To hell with the truth! Robert Ryan
To hell with user friendly. Will it keep beer cold?
To hell with user friendly. Will it keep beer cold?
To help other people at all times-- portion of Scout Oath
To help your bones to keep your shape 'most every time you bend 'em!
To hide a feeling is to increase its force a thousand times.--Caine
To him who is in fear, everything rustles. Sophocles
To him who is in fear, everything rustles.<Sophocles>
To immitate is the greatest form of flattery.
To impeach, type: DEL CLINTON.* DEL RODHAM.*
To improve any conversation reply with: I don't know.
To improve any conversation reply with: Why?
To improve your memory, loan people money.
To increase speed add lightness
To insure good luck, he always carries a rabbi's foot.
To interfere or not to interfere; _that_ is the question!
To invent, you need a good imagination and a pile of junk. -- Thomas Edison
To invent, you need a good imagination and a pile of junk. -Thomas Edison
To iterate is human - to recurse, divine.
To iterate is human, to recurse divine.
To iterate is human, to recurse is divine.
To iterate is human, to recurse, divine.
To iterate is human; to recurse, divine.
To iterate is human; to recurse, divine.
To iterate is human; to recurse, divine. - Robert Heller
To iterate is human; to recurse, divine. -- Robert Heller
To join Princess Vespa and Prince Valium in the bonds of Holy Moley!
To judge perfection is to render a worthless verdict.
To keep another caveman from stealing your woman, use "THE CLUB".
To keep from falling, keep climbing.
To keep from receiving a fruitcake, send 25 cookies to...
To keep myself physically strong-- portion of Scout Oath
To keep myself...mentally awake-- portion of Scout Oath
To keep myself...morally straight-- portion of Scout Oath
To keep your character intact you cannot stoop to filthy acts. <K. Hep
To keep your expressions convergent, allow no degrees of freedom.
To keep your friends treat them kindly; to kill them, treat them often.
To keep your milk sweet, leave it in the cow.
To keep your teeth in good shape, mind your own business.
To kidnap a Kzin is probably a mistake.
To kidnap a Kzin is usually a mistake....
To know Tao, be still and look within. <365 Tao>
To know a culture you must dirty your feet in its soil.
To know is nothing at all; to imagine is everything.
To know me is to love me.....and I do!
To know nothing is bad, to learn nothing is worse
To know recursion, first you must know recursion.
To know recursion, you must first know recursion.
To know the road ahead, ask those coming back.
To know the road ahead, ask those coming back.
To know the world one must construct it.
To know the world one must construct it. - Cesare Pavese
To know what is right and not do it is the worst cowardice.
To know what we do not know is the beginning of wisdom ...
To know yourself is the ultimate form of aggression.
To laugh at men of sense is the privilege of fools
To laugh at persons of sense is the privilege of fools.
To learn a foreign language get a 'Sleeping' dictionary.
To learn new words, phone your moderator at 3 a.m.
To learn to listen to that which is not spoken. <The Silent Flute
To learn, you must listen to that which is not spoken.
To leave a message, press *7123#85621, or wait for the beep.
To let politics become a cesspool & then avoid it is a double crime.
To live alone, to be both beast & god: a philosopher. - Nietzsche
To live in hearts we leave behind is not to die.
To live in the hearts we leave behind is not to die.
To live in the hearts we leave behind is to not die.
To live in the hearts we leave behind, is not to die.
To live is always desirable.
To live is to die!
To live is to make a mess. Great Aunt Beatrice
To live long and prosper...avoid lawyers. - Spock
To live long, it is necessary to live slowly.
To live now, first come to terms with your past.
To live well, know the difference between good and evil.
To live without hope is to cease to live. Dostoevsky
To live-is to risk dying.
To look like the cat that swallowed the canary." ...Yiddish Saying
To love another person is to see the face of God.
To love her was a liberal education. Steele
To love is to be vulnerable.
To love is to find pleasure in the happiness of the person loved.
To love is to place our happiness in the happiness of another.
To love ones self is the begining of a life-long romance. -Oscar
To love oneself is the beginning of a lifelong romance.
To make MS DOS truly multiTasking-use several machines!
To make Murphy's Law fail - try to prove it to someone.
To make Windows multitask type ECHO Y|FORMAT C:
To make a Kleenex dance, blow a little boogie in it.
To make a blonde laugh on Saturday you must tell her a joke on Tuesday..
To make a long story short there's nothing like the boss coming in.
To make a speech immortal you don't have to make it everlasting.
To make a success of old age, you have to start young!
To make an elephant fly, use a >HUGE< zipper
To make it work, you have to DO the work.
To make modem fly: ATGO+2+TALL+BUILDING+THROW+MODEM^M
To make pleasures pleasant, shorten them.
To make political contributions call 1-800-KIS-AWAY.
To make shepherd's pie: take one shepherd, a large grinder...
To make the Fates laugh, tell them that you have a plan.
To make up for being late this morning, I am leaving early.
To make war with the saints and overcome them. - Rev 13:7
To make your children capable of honesty is the beginning of education
To make your children capable of honesty is the beginning of education.
To make your dream come true, you have to stay awake.
To many a dumb blonde is a smart Brunette.
To marry is to halve your rights and double your duties -Schopenhauer
To marry is to halve your rights and double your duties.
To me personally, it's nothing personal to me.
To me, "due tomorrow" means just that: Do tomorrow.
To me, absolutes are found only in finite algebra and taxes.
To me, every morning is the dawn of a new error.
To me, imagination is a place all by itself. Edmund Gwenn
To me, socks are like sex. Tons of it about but I never seem to get any.
To measure a circle, begin anywhere.
To millions of kids, you're like...like this fire here...
To moderate or not to moderate. That is the question.
To mold a new reality, Closer to the Heart..... -RUSH
To mom: "Calvin? Who's Calvin? I'm *Stupendous Man*!" - - Calvin
To mortal fields say farewell, Middle-Earth forsaking! ...
To most people, moderators are nice people.
To much Free memory cluttering up your computer? Try Windows
To much thinking only leads to delay!
To my embarrassment I was born in bed with a lady.
To my embarrassment I was born in bed with a lady. - Wilson Mizner.
To my embarrassment, I was born in bed with a lady.
To nije kraj idemo dalje!
To nisu jedra moje brodice,vec to su gacice moje Marice
To non-collectors, we're just pack rats....
To not discern the important, makes you unimportant.
To obey is better than sacrifice.
To our sweethearts and wives. May they never meet!
To our sweetheats and wives - may they never meet.
To page sysop; Press <Ctl>-<Alt>-<Del>!
To perform magic you must desire change. The complacent have no magic.
To play billiards well is a sign of an ill-spent youth.
To play billiards well was a sign of an ill-spent youth
To poldly bow air mobius gumby four <-- Trek on novocaine
To poldly bow air mobius gumby four: Trek on novocaine.
To poldly bow air mobius gumby four: Trekker on Novacaine.
To preserve wildlife: catch a squirrel and pickle it.
To prevent carpal build-up...use PAM on your keyboard.
To prevent splatter, cover dish before microwaving cat.
To prevent splatter, cover dish before microwaving hamster.
To process or not to process that is the question!
To prove their mousy worth, they'll overthrow the Earth!
To publish is to appear in public with your pants down.
To put it plain and simple...I'm not into one-night stands.
To quit reading messages, strike here with hammer ----> [*]
To quote Alfred E. Neuman: "What! Me worry????"
To quote the Librarian at Unseen University, "Oook!"
To quote, "Crea$ion Cons are boring and overpriced"
To re cover you need to take the old cover off.
To reach port you must sail... not drift.
To read tagline. Please enter password: _
To read those Illuminati conspiracy books start by licking a stamp.
To read, perchance to DeChancie.
To really "tax" your system, enter: DEVICE=CLINTON
To really appreciate me, you gotta see me shop!
To really know a relative, divide an inheritance with him
To really live, you must almost die.
To reflect on all of my sins and the death of the whale.
To reform a man, begin with his grandmother.
To reformat CD disk, use steel wool & heavy pressure.
To reformat a CD-ROM use steel wool and apply light pressure.
To reformat a CD-ROM use steel wool and heavy pressure.
To reformat a CD-ROM use steel wool and light pressure.
To reformat a CD-ROM, use steel wool & heavy pressure
To reformat a CD-Rom, use steel wool & a lot of pressure
To refuse praise is to seek praise twice.
To refuse to decide is a decision.
To refuse to decide is a decision. - Peter Brent
To register this complaint, send $35 to moderator.
To register this tag line, simply send 25 cookies to...
To register this tagline, send $29 to ....
To reject the Deliverance ....is to invite Destruction...
To remove dust from the eye, pull the eye lid down over the nose.
To remove this message, push Red Button
To repel attackers, instead of mace you have your face!
To reply to message: Press: CTL + ALT + DEL
To reply, send a self-abused, stomped antelope to...
To resist is futile: you will be deseminated.... (Lady Borg)
To respond to this message, press "R"...
To respond to this message, press "R"....
To restart Windows, click on Program Manager with a 20 Oz hammer
To return home, you must walk backwards in time & space.
To risk nothing is to risk everything.
To save a single life is better than to build a seven story pagoda.
To save a single life is better than to build a seven story pagoda. True
To save this message, please press CTRL-ALT-DEL.
To save your sanity, don't play DOOM!!!
To seal or not to seal, that is a ziplock.
To search an anthill, you need a warrANT.
To see God, look into the eyes of a baby parrot.
To see hidden secret tagline,enter a 27 digit prime #.
To see hidden tagline, enter a 27 digit prime number
To see more Taglines hit <CTRL>-<ALT>-<DEL>...
To see more recipes hit <CTRL>-<ALT>-<DEL>...
To see the California State Bird: Blow your horn!
To see the future, one must first look at the past.
To see the universe in a grain of sand..Blake
To seek new data, coding procedures, to boldly code where no one...
To seek out new data, and new coding procedures...
To seek out strange, new Taglines to BOLDLY quote
To seek out strange, new taglines... to BOLDLY quote...
To sell is to own - Clive Barker
To share it's life, it's death.-Bram Stoker's Dracula
To shoot a mime, do you use a silencer?
To sleep and perchance to dream.
To sleep, perchance to Dream
To snag this recipe press <CTL> <ALT> <DEL> now.
To some it's a six-pack. To me it's a support group.
To some it's just a six pack. To me it's a support group.
To some its a six pack; to me its a support group.
To some lawyers all facts are created equal.
To some of us, taglines are an important part of the mail!
To some, it's a six pack. To me, it's a support group.
To some, sex is second best to power.
To speed is human; to get caught, de fine.
To spell out the obvious is often to call it in question - Hoffer
To start your cat collection, simply open a can of tuna.
To start your cat collection, simply open a tuna can.
To steal this TAGLINE press <CTRL< <ALT< <DEL< now..
To steal this TAGLINE press <CTRL< <ALT< <DEL< now...
To steal this tagline press <CTL> <ALT> <DEL> now.
To steal this tagline press <CTL< <ALT< <DEL< now.
To steal this tagline press <CTR><ALT><DEL> now.
To steal this tagline, press <CTRL><ALT><DEL>.
To stir Navy coffee, you need a Teflon spoon.
To stop your computer from going down, marry it!
To strive, to seek, to find, and not to yield.
To strive, to seek, to find, but not to yield.
To study a subject best, understand it thoroughly before you start.
To study a subject bet, understand it thoroughly before you start.
To subdue the enemy without fighting is the acme of skill. Sun Tzu
To subdue the enemy without fighting is the acme of skill.Sun Tzu
To succeed first learn to fake sincerity.
To suppress a truth is to give it a force beyond endurance.--Kan
To survive, one must be able to adapt to changing situations. T.REX
To suspect a friend is worse than to be deceived by him.
To tag or not to tag,that is the question.
To take a flower apart is easy, but to put one together - ??
To take arms against a C of troubles.
To take the Genesis online IQ test: press Alt/H
To take the Lair's Online IQ Test: Press Alt-H
To take the online IQ test: press <Alt><H>.
To talk goodness is not good - Only to do it is.
To talk without thinking is to shoot without aiming.
To tankers the infantry are "Crunchies".
To taste anew the fruits of life, the last immortal man.
To teach is to learn twice...
To teach is to touch a life forever
To tell if a Canadian senator is alive:wave a pension check!
To tell if a senator is alive: Wave a pension check under nose.
To tell the sex of a chromosome, pull down its genes.
To tell....alas, I may not be original, but I found something to post.
To test a man's character, give him power.
To test a man's character, give him power.
To the British, George Washington was a terrorist!!
To the Caliph I am dirt, but to dirt, I am Caliph.
To the Emerald City..! As fast as lightning..!
To the Mystery Machine!
To the Torgo System, where we will rendezvous withdestiny.
To the X-Men, then! Who never die the old fashioned way! --Storm.
To the ancient laws adhere, prospers thus the Dragonweyr!
To the back of the boat, Tom said sternly.
To the best of my knowledge, Agent Mulder is dead - Dana Scully
To the best of my recollection, Senator, I can't recall.
To the blond:Hurry, dial 911! Blond:OK,what's the number?
To the calvary, the infantry are "Crunchies".
To the children and the innocent, it's all the same. -- Kerouac
To the curious incident of the dog in the night-time. --Holmes.
To the driver's seat, Pink-Wonder! - Brain
To the forces known as God, we give unspeakable gratitude.
To the gods I am an ant, but to the ants, I am a god.
To the greater glory of God.
To the inattentive and brainless layman, yes. -Calvin
To the jungle floor fell a monkey. Kerplunky.
To the late night double feature picture show, in the back row
To the living we owe respect; to the dead we owe the truth.
To the mind that is still, the whole universe surrenders. -- Lao Tzu
To the mind that is still, the whole universe surrenders. -- Lieh Tzu
To the old cat, the tender mouse.
To the stars through difficulties.
To the timid and hesitating everything is impossible, cuz it seems so.
To the whole world you show a smiling face.
To the young cat, a quick son of a &*^%& mouse
To thine own self be true or you will spoil the game. -- Heinlein
To thine own self be true or you will spoil the game. L. Long
To thine own self be true, to all others - improvise.
To think he's getting $4.35 an hour -Crow on Tom as guard
To think on your level means grunting to myself a lot.
To think too long about doing a thing often becomes its undoing.
To those who can see, a picture is a wordless poem.
To tolerate everything is to teach nothing.
To touch the dreams i'll never know, with your warm arms around me.
To tribble or not to tribble? That is the *
To try and fail is not wrong. It is wrong to not try.
To try may be to die, but not to care is never to be born.
To turn your back on love is to turn turn your back on life.
To understand a program you must become both the machine and the program.
To understand other's miseries, look at their pleasures.
To understand we must grasp the whole. - Isaac Asimov
To us, a bee is a pain. To a flower it's Don Juan!
To us, killing is murder, even for revenge.
To us, violence is unthinkable.
To use the driver with Win3.x, install MISSDAISY.
To wake a stick, use a long tiger. Did I get that right?
To wake a tiger, use a long stick.
To want peace and quiet above all else is to hope for death.{Asimov}
To watch a storm with all its wonder in her lover's eyes.
To what drivest thou not man's heart, O lust of gold accursed?
To whom should I apply for permission to be hungry?
To whom should I go for self-help?
To whom should I go to for some self-help?
To whom the Gods destroy, they first teach Windows.
To whom the gods destroy, they first teach Windows...
To win without risk is to triumph without glory.
To women men are like big dogs that talk!
To write a history of St. Joan would take LOTS of paper, Tom ream-Arc'd.
To you I'm an atheist, to God I'm the loyal opposition
To you it may be a holy war, to her it's only Tuesday - Eric Bogle
To you, O Lord, I lift up my soul; in you I trust, O my God.
To, to be Frank, I'd have to change my name.
To-GA! To-GA! To-GA! To-GA!!!
To: All
To: DONN SARTAIN
To: Ripper Bonegrinder from David Anthony Olenick San Antonio, TX (-8
To: TINKERBELLMortician" - by Phil Degraves
ToGive t' yo' friends and lend t' yo' enemies.
Toad (n.): What happens to an illegally parked frog.
Toad--what happens to an illegally parked frog.
Toad: in the direction of - "Turn left an' take I85 TOAD Atlanta."
Toad: what happens to an illegally parked frog.
Toads are faster than frogs. You never see "Toad Legs" on a menu!
Toast the Sugar Gods! Fructose, Sucrose and Saccharine!
Toaster of Borg: It is useless to resist my offerings of toast.
Toaster of Borg: Resistance is useless. You will eat toast.
Toaster of Borg: Would you like some toast before you're assimilated?
Tobacco and alcohol: how to screw up your life - legally.
Tobacco is Canada's leading cause of statistics.
Tobacco sales training:1st find a real sucker, the rest is too easy.
Tobacco smoke really ruins the taste of human flesh.
Tobacco: Canada's leading cause of statistics.
Toboggan Hagen: A very large ice-cream sundae.
Today I am feeling ept, ane and sipid.
Today I am feeling ept, ane, and sipid.
Today I can live in God's will. -S. E. Parkins
Today I do more than spend my time. I invest it.
Today I grasp the Federation's throat!
Today I have grown taller from walking with the trees.
Today I shot the best golf game of my life!
Today I'm older than my age, the only gift I have is rage
Today I've grown taller from walking with the trees.
Today IS July 8, 1965, isn't it? <looking at chronograph>
Today IS July 8, 1965, isn't it? <looking at chronograph<
Today Today I am feeling ept, ane, and sipid.
Today has been a long year!!!!!!!!!!
Today has been a long year.
Today has been a really long year!!!
Today has been one *hell* of a week!
Today is "Red Shirt Memorial Day".
Today is Monday, cleverly disguised as Tuesday.
Today is National Existential Ennui Awareness Day.
Today is TFW's birthday! Welcome....7/29/94
Today is a "Honey do day" Honey do this, honey do that..
Today is a day for firm decisions .. Or is it?
Today is a day for making firm decisions!!!!! Or is it?
Today is a good day for you to jump in a lake.
Today is a good day for you to jump in a lake.
Today is a good day to bribe a high ranking public official.
Today is a good day to bribe a high--ranking official.
Today is a good day to bribe a high--ranking official.
Today is a good day to bribe a high-ranking public official.
Today is a good day to die, but Thursday would be better.
Today is a good day to die, but the day is not yet over.
Today is a good day to die, but tomorrow may be better!
Today is a good day to die.... Native American saying.
Today is always better than yesterday.
Today is an excellent day to have a rotten day.
Today is canceled due to lack of interest!
Today is cancelled due to lack of interest!
Today is cancelled due to lack of interest!
Today is dedicated to Uranus! Well thanks! I'm flattered--huh?
Today is just a point in time between ice ages
Today is not your lucky day. You won't have one this year
Today is one of a kind and will only happen once - so make it great!
Today is only yesterdays tomorrows - Uriah Heep
Today is the Tommorrow you worried about Yesterday
Today is the Tomorrow you worried about Yesterday
Today is the best day of my life, until tomorrow.
Today is the day to bribe a high-ranking public official.
Today is the first day after yesterday.
Today is the first day of the rest of the mess
Today is the first day of the rest of the mess.
Today is the first day of the rest of this mess.
Today is the first day of the rest of your life.
Today is the first day of the rest of your life.
Today is the first day of the rest of your lossage.
Today is the first day of the rest of your mess.
Today is the last day of your life so far.
Today is the last day of your life, so far.
Today is the scene of the accident.
Today is the tomorrow that we worried about yesterday.
Today is the tomorrow you worried about yesterday
Today is the tomorrow you worried about yesterday.
Today is tomorrow's yesterday.
Today on Geraldo:Talk Show Audiences Who Can Sit Through This #$%^.
Today on Larry King: The President, and her husband...
Today on Mime Time... lifing an imaginary barbell. <KLANG>
Today on Mime Time... running for your life!!!
Today on Mime Timelifing an imaginary barbell.
Today on Orville'S World: Stalking the wild veggie.
Today on Wide Wonderful World of Sports we have the Mail Toss.
Today on the Gourmet Channel... Cooking with the Pentium.
Today on the menu we feature: pi of the day.
Today the sidekick community mourned the loss - Mike
Today the sun, tonight the MOON! WHEN WILL IT END?
Today we discuss the pleasures of assimilation.
Today we learned that resistance is futile. --Barney of Borg.
Today we're going to play the role of sane people.
Today we're talking about Wimpy Vedeks and the Women Who Love Them.
Today your past is one of your greatest assets.
Today's "Politically Correct" = Yesterday's McCarthyism
Today's "politically correct" = yesterday's McCarthyism.
Today's Politically Correct = yesterday's McCarthyism.
Today's Sesame St Satan was brought to you by the number 666
Today's Sesame Street Pooh Bear was brought to you by honey B
Today's Sesame Street Wicca was brought to you by Blessed Be.
Today's Special: Asphalt Armadillo
Today's Tom Sawyer he gets high on you..... -RUSH
Today's a good day to bribe high-ranking public officials.
Today's abortion could destroy the entire world if left alone...
Today's been one heck of a week!
Today's been one hell of a week!
Today's better than yesterday and not as good as tomorrow.
Today's forecast: Tonight, with a chance of tomorrow.
Today's health care special: assisted suicide (lifetime guarantee!)
Today's motto: It's fun when you don't have to do it.
Today's newspapers will be wrapping tomorrow's fish.
Today's oxymoron - Dr. Elders' solution.
Today's oxymoron: Assisted suicide.
Today's oxymoron: cruel and unusual punishment.
Today's safety meeting will be right after the game of russian roulette.
Today's scientific question is: What in the world is electricity?
Today's secret word is 'assimilation'" - PeeWee of Borg
Today's sermon: What a f iend we have in God.
Today's special is all the caviar you can eat for $600.
Today's special: Misspelt words at no extra charge.
Today's subliminal message is .Thank You.
Today's subliminal message is . Thank You.
Today's subliminal message is .
Today's subliminal message is .
Today's subliminal thought it:
Today's tagline is brought to you by: All!
Today's tagliners are tomorrow's sages.
Today's toupees really fool people, but only those who wear them.
Today's woman has one reason for divorce: marriage.
Today's word is "legs". Help spread the word!
Today's youth. Hopped up on crack - Tom on teen hangout
Today, St. Canard...tomorrow, THE WORLD! - MegaDuck
Today, St. Canard...tomorrow, THE WORLD! - NegaDuck
Today, he's drinking people's blood! Tomorrow, he could be smoking!
Today, take an astronaut to launch.
Today, we're teaching poodles how to fly YIIIIIiiiiipppp<THUD>
Today: Yesterday's effect and tomorrow's cause.
Todays Moral: Aliens are people too.
Todays assembler command : EXOP Execute Operator
Todays assembler command: EXOP Execute Operator
Todays book-> Bigger monitors for Win3.1 by Seymor I. Cons
Todays book-< Bigger monitors for Win3.1 by Seymor I.Cons
Todays book--> Computer Coma - by I.M. Crashed
Todays forecast is huge boulders mixed w/volcanic ash-Tom
Todays subliminal message is .
Todays subliminal message is " "
Todd Charlton: The third Warner Brother on Animaniacs.
Todd makes his move! - Tom as hero kisses girl
Todd scratched his head.
Todd's the Littlest Viking - Joel on wimpy viking
Toddler vocabulary #1: why, why, why?
Toddler: An indoor tornado
Todlitter: Food debris under high chair after an attempted feeding.
Toe: A part of the foot used to find furniture in the dark. -- Rilla May
Toejectile: Clipped toenail.
Toes (Front View)...ooooO Ooooo
Tofu! The other white meat!
Toga - Toga - Toga - Toga - TOGA!!
Toga Toga.. see ya then (hopefully!)
Toga toga party in the near future
Toga! Toga! Party to be held Sept 30 in Apopka<that's outside O'town<G>>
Toga-Toga party Sept 30! Be there!
Toga-Toga party, Bring your bird feeders!
Together we stand, divided we fall.
Together we stand, we won't take no for long, 'cause were winners.
Together, we made enough noise to keep the wolves awake.
Togetherness: The ability to agree on which TV channel to watch.
Toil is most pleasant when done.
Toilet paper will tear on any line but the perforated one.
Toilet paper: another fine abrasive by 3M.
Toilet seats. Now in 49 wonderful flavors. Just ask Orville Bullitt.
Toilet seats. Now in 49 wonderful flavors. Just ask Orville.
Tok #TN#. Bo Ka Goo Pa En At A-Awn-Awn-Aw.
Tok Bullitt. Bo Ka Goo Pa En At A-Awn-Awn-Aw.
Tok Orville. Bo Ka Goo Pa En At A-Awn-Awn-Aw.
Tokers local 101, We smoke till we croak!
Tokyo Disneyland really sucks! - Crow
Tolchetomethuenicazit -The Innumerable Names Of Tom Servo
Told the Doc I had a pain in the neck, He said "Your married right?" _
Told you the Moderators wouldn't find m.NO CARRIER
Toledo in 2020... I can see it now.
Tolerance -- often recommended by those who don't practice it.
Tolerance is the apex of any civilization.
Tolerance: Suspicion the other person is right!
Tolerant, of course I'm tolerant. You're just stupid.
Toleration is the greatest gift of the mind.<H. Keller>
Toliko zena koje uzdisu tiho
Tolkein is hobbit-forming.
Tolkien Ring is the LAN most preferred in Middle Earth.
Tolkien Ring is the promised LAN for hobbits.
Tolkien did it with hobbits.
Tolkien is Hobbit forming!
Tolkien is hobbit-forming.
Tolkien? No thanks... I'm trying to kick the hobbit!
Tom & Crow have planned something - Mike
Tom & Mike: We didn't do it * Crow: Another unruly crowd
Tom (on apes) They look like bad puppets * Crow: Huh?!?!
Tom Arnold? Soupy Sales? Idi Amin? Abe Vigoda? - Tom
Tom Baker-4th Doctor-Now There's a REAL Hairstyle!
Tom Baker: the jelly-baby pusher of the universe.
Tom Cerbo - The Nine Billion Names of Tom Servo!
Tom Cryveaux - The Nine Billion Names of Tom Servo!
Tom Foley: Did they finish the vote count yet?
Tom Gries, dialogue writer extraordinaire - Crow
Tom Have a Happy and Safe Holiday
Tom Ruddy doesn't do drugs...he's naturally paranoid! *
Tom Serbo - The Nine Billion Names of Tom Servo!
Tom Serbol - The Nine Billion Names of Tom Servo!
Tom Serve - The Nine Billion Names of Tom Servo!
Tom Servo "Hey, there's Ronald McDonald shakin' his mcbooty!!"
Tom Servo & Grommet the Wonder Dog - Crow
Tom Servo! Tom Servo! Glorious Tom Servo-o-o-o -Tom sings
Tom Servo's dead! It must have been that movie! --Joel.
Tom Servo, oh my God! Tom Servo is dead! - Joel
Tom Servo: Ed Wood agonized over this scene * Crow T. Robot: Now we are
Tom Servo: Voice of Kevin Murphy, body of a gumball machine
Tom Sir - The Nine Billion Names of Tom Servo!
Tom Sirbol - The Nine Billion Names of Tom Servo!
Tom Sirvio - The Nine Billion Names of Tom Servo!
Tom Sirvol - The Nine Billion Names of Tom Servo!
Tom Surbo - The Nine Billion Names of Tom Servo!
Tom Survo - The Nine Billion Names of Tom Servo!
Tom Syble - The Nine Billion Names of Tom Servo!
Tom T. Hall, add Roy Clark & a little Donna Fargo - Crow
Tom Woodfin's WWWpage http://genesis.nred.ma.us/twoodfin/woodfin1.html
Tom blanched as he cried "There's no print on the paper!"
Tom has been diagnosed with Blue Wave Fever. It's catching too.
Tom said recursively, "Tom said recursively, 'Tom said recursively...
Tom's just another inmate in this insane world.
Tom's research on sperm was his seminal acheivement.
Tom, I don't get you. Nobody does. I'm the wind, baby.
Tom, You and Maria made quite a combination!
Tom, lemme wrap up some of that chicken salad - Mike
Tom, maybe we're not ready for marriage - Crow
Tom, this is a hand phaser. Stunning, isn't it?
Tom, you get the flashlight - Gypsy during fire drill
Tom: "Hamster who wrote a *really* harsh letter to the Times."
Tom: (After bad joke) Oh, you kill me! * Crow: I've tried
Tom: (On repetitive stock shot) Mount Fuji * Crow: Again?
Tom: (To Crow) Beak nose! * Crow: Hey!!!
Tom: (boredly) Huh-zah * Crow: (boredly) Hi-Kee-Bah
Tom: (dogs) They licked her to death! * Crow: I knooowww!
Tom: A T. & A. film * Crow: Terrible & Awful?
Tom: A bunch of yahoos * Crow: From the planet Scuzz-ball
Tom: A salad bar! * Crow: With a decorative snot guard!
Tom: And you work for the Devil? Crow: And it's the 50s?
Tom: Are you gonna come with? * Crow: Come with WHAT?
Tom: Bite down, pleae * Crow: Bite me, please
Tom: Boing everybody! * Crow: Boing all around
Tom: Bomb Bobby McFerrin & Robin Williams * Crow: Yayyy!
Tom: Booger * Crow: Nimbus * Gypsy: Poopy * Crow: Dink
Tom: Borgnine * Crow: Air bag * Tom: Raisin Loaf
Tom: Boys 2 Men * Mike: 2 Women
Tom: C'mon Cornjob! Help her! * Crow: New, Cornjob Helper
Tom: Calgon, take me away! * Crow: Looks like it did
Tom: Cantina * Crow: CAN too!
Tom: Carry me Joel * Crow: Carry me!
Tom: Computer * Comp: wOrKiNg * Tom: It sounds like Torgo
Tom: Ed Wood agonized over this scene * Crow: Now we are
Tom: Funny cars! * Mike: Well* Crow: Nude bots!
Tom: He needs more facial hair * Crow: Yeh, less face
Tom: He's like a Micheal Landon * Crow: He's a bedwetter?
Tom: He's spurting dish washer liquid Crow: Pepto Bismol
Tom: Hey Crow! * Crow: You rang?
Tom: His face is collapsing * Crow: It's a sinkhole
Tom: It's Delta! * Crow: He who smelt'a, Delta!
Tom: J.G.Williams * Crow: Jerky Guy! * Joel: Just Goofy!
Tom: Lake Fuji * Crow: Mr. Fuji * Tom: Kung Fuji
Tom: Mother ship * Joel: One mother of a ship!
Tom: My God, it's Dorka! * Joel: The Killer Premise
Tom: Really? * Mike: No, I was just killing time
Tom: Say 'The Master' * Computer: tHe mAsTeR!
Tom: Say 'The Master' again * Gypsy: Belay that order!
Tom: Say it! * Mike: I can't build robots.
Tom: See you deck * Crow: What?! * Tom: I said DECK!
Tom: Senorita Gamera? * Joel: Hirrohito Gamera!?
Tom: Stinky-butt * Crow: Curb Feeler * Tom: Nimrod
Tom: Stop with the slang! * Crow: It's better'n scatting!
Tom: Stupid Batman costume * Crow: What? It was great
Tom: Wait! Wait! What was the plot here? * Crow: Plot?!?
Tom: Where'd the bee go? * Crow: It BE gone!
Tom: Where'd the monster come from? * Crow: PMS!
Tom: Who's bad?!? Joel & Crow: Tom Servo!
Tom: Whoah! * Mike: (on Crow's computer) Locked up tight!
Tom: Worse than Bobby Knight * Crow: No, it's BOB!
Tom: You shut up! * Mike: Shut up * Crow: Shut up!
Tom:(On Lee Majors) He's no dummy * Crow:Just a bad actor
Tom:A planet of Tweakies * Crow:Ugh, what could be worse?
Tom:Have'ta pick up Mamie Van Doren * Mike:That'd be hard
Tom:Honk honk! Crow:Beep beep! All: Government gridlock!
Tom:Made a little nest * Crow:He used his own secretions
Tom:Robert Reed is Buford PUSSer * Crow:IN Prancing Tall
Tom:Thats beautiful Crow. Shakespeare? * Crow:Burma Shave
Tom:They're talking about sex aren't they? * Mike:Really?
Tom:What stage of grieving is this * Mike:The goofy stage
Tom:Who'd argue w/Shelly Winters? * Crow:Ernest Borgnine
TomBakerDOS 4.01: Floppy hat support added
TomBakerDOS 4.0: (G)rin, (O)ffer a jellybaby, (T)rip on scarf
TomBakerDos 4.02: (O)ffer a jelly baby; (C)onfuse 'em; (S)earch pocket
TomBakerDos 4.03: (T)eeth, (H)air, (S)carf
TomDOS 4.0- (G)rin, (O)ffer a jellybaby, (T)rip on scarf
TomDOS 4.01: Floppy hat support added.
TomDOS 4.0: (G)rin, (O)ffer a jellybaby, (T)rip on scarf.
Tomahawk - When you care enough to send best!
Tomahawk Cruise Missiles - When you care enough to send the very best!
Tomahawk Cruise Missiles - When you care to send best!
Tomahawk. When you care enough to send best!
Tomahawk. When you care enough to send best!
Tomato Juice + Vodka + Cherry Jello = Blood Clot
Tomato paste - what you use to fix broken tomatoes.
Tomato paste: What is used to fix broken tomatoes.
Tomato paste: What you use to fix broken tomatoes.
Tomato paste: used to fix broken tomatoes...
Tomato paste: what you use to fix broken tomatoes.
Tomato soup-plain-hot....and in a bowl this time please?
Tombstone Designer. It's a grave job
Tombstone designing is a grave job.
Tommorow he would sing his first war song - Hendrix
Tommorrow is as good a day to die as today was yesterday.
Tommy Lee Jones! - Mike on zombie
Tommyknockers, Tommyknockers, Knocking at my door...
Tommyknockers, Tommyknockers, knocking at your door...
Tomorrow & tomorrow & tomorrow creeps in this rutabaga...
Tomorrow I'll start procrastinating...
Tomorrow I'm gonna see if I can have sex with something. -The Cat
Tomorrow has been cancelled due to lack of interest. (Sjoerd Verweij).
Tomorrow he would sing his first war song - Hendrix
Tomorrow is all we have. The rest is history to learn from...
Tomorrow is another day, but it'll probably suck too.
Tomorrow is another day, but it'll suck too.
Tomorrow is the First Day of the New Diet.
Tomorrow is the first day of the rest of your life!
Tomorrow is the second day of the rest of your life.
Tomorrow the world will know about Immortals. - Saltzer
Tomorrow we seize the day, and throttle it! - Hobbes
Tomorrow we start dieting!
Tomorrow will be canceled due to a lack of interest.
Tomorrow will be canceled due to lack of interest.
Tomorrow will be yesterday soon enough.
Tomorrow, I'll be in the future.
Tomorrow, I've got to quit procrastinating
Tomorrow: One of the greatest labor-saving devices of today.
Ton the' t'a-t'il ote' ton toux? (Did the tea cure your cough?)
ToneupMaster...We service all laser printers.
Tong, did you meow? - Mike
Tongue covered eyetooth - couldn't see what I was saying.
Tongue embedded deeply in cheek. Surgical removal needed.
Tongue in cheek is better than foot in mouth.
Tongue tied & twisted, just an earthbound misfit I.
Tongue wrestling! - Tom on lengthy love scene
Tongue-tied and twisted, just an earthbound misfit, I! - Pink Floyd
Tongue-twisting taglines truly take typically tons of time to type
Tonguetied and twisted, just an earthbound misfit, I.
Tonight I feel like a million - but one at a time.
Tonight TV: Jaques Cousteau discovers barnacles on his dinghy.
Tonight a dark menace will complete it's task - Course of Empire
Tonight at the fights, a hockey game broke out.
Tonight is the night to set you free.
Tonight on BBC1...Ethel the Frog.
Tonight on Double-Wide Hospital - Mike on trailer house
Tonight on ESPN2, Hayloft Rope Swinging! - Tom
Tonight on Generic TV Movie - Mike
Tonight on Letterman....Bill inhales, America gags!
Tonight on Lou Jacoby Playhouse - Mike
Tonight on Medical Senator - Crow
Tonight on Monk TV: Gregorian Chant Unplugged!
Tonight on Postal Inspector - Tom
Tonight on Star Search in the lab technician category-Tom
Tonight on TBS: The colorized version of "Schindler's List"
Tonight on a very special Ravi Shankar, P.I. - Crow
Tonight on a very special episode of TJ Hooker - Joel
Tonight on the gourmet channel, cooking with the new Pentium
Tonight only: Cokes a dollar ten! - Mike
Tonight the city's full of whores, all the toilets are overflowing.
Tonight we just might fall in love again.
Tonight we're gonna be closer than close, part of one another....
Tonight we're having Chocolate Tribble Surprise. Worf, you first
Tonight yer taking no hostages, and I'm taking no prisoners.
Tonight's Episode brought to you by -- SAMPO!
Tonight's episode 'No Soup With Buffet' - Tom
Tonight's episode - Drop Personal Pronouns or DIE!
Tonight's episode: A Bicycle Built For Death!
Tonight's episode: Beer Barrel DEATH - Crow
Tonight's episode: The Dead Go Fishing - Crow
Tonight's episode: `A Bicycle Built For Death!' --Joel.
Tonight's feature movie is:"Breast Monsters From Jupiter"
Tonight's forcast....Dark.
Tonight's forecast: dark, followed by light.
Tonight's mud wrestling event: MENSA vs. Hee-Haw
Tonight's the night we make history.
Tonight's the night: Sleep in a eucalyptus tree.
Tonight's the night: Sleep in a eucalyptus tree.
Tonight's weather report: 100% chance of dark, with clearing in 8 hours
Tonight's weather: Dark with continued darkness til dawn.
Tonight, Hell sends an angel bearing gifts... - Eric Draven (The Crow)
Tonight, Itchy & Scratchy discuss Yugoslavia.
Tonight, K-E-Double L-O-Double Dead! --Tom Servo.
Tonight, Love & The Landing At Normandy - Crow
Tonight, let us drink wine..
Tonight, no hostages for you and no prisoners for me.
Tonight, we dance - Mike as girls wrestle
Tonight... Tonight I am a GOD!! - Dr. Renhoek-enstein
Tonight..on Medical Senator......
Tonight: The Revenge of the Baby-Sat.
Tonight: The Revenge of the Baby-Sat.
Tonight: Wet T-Shirt Contest! Sorry, Klingons Only.
Tonights forcast....Dark.
Tonka buys out Toyota, no changes expected. News at 11.
Tonkin's Rule: In any program, there are always more PUSHes than POPs.
Tons o' snot.
Tonsils cure cancer!! Want to buy some?
Tony Orlando & Dawn - Crow on girl wrestlers & referee
Tony Randall meets Harry O - Crow on geeky guy
Tony attacks with a Longsword +1, +5 vs. Moderators.
Tony the Tiger Assassinated! Cereal killer suspected!
Tony the Tiger does it, and thinks it's G-R-R-E-A-T!
Tony the Tiger found dead, police suspect cereal killer.
Tony the Tiger found dead- Cereal Killer is suspect.
Tony the Tiger killed; police think it was cereal-killer.
Tony the Tiger slain: police suspect a cereal killer.
Tony's Yin and Yang are no longer on speaking terms.
Tony, never trust a dog with orange eyebrows.
Tonya Harding & Lorena Bobbitt Drink: A club soda with a slice.
Tonya Harding Movie-Of-The-Week: 'Looking For Mr. Crowbar'.
Tonya Harding and Lorena Bobbit - The Wack and Hack troop...
Tonya Harding and Lorena Bobbit - The Whack and Hack troop...
Tonya Harding drink: CLUB soda on ICE.
Tonya Harding has been named new spokesperson for "The Club".
Tonya Harding is named new spokesperson for "The Club".
Tonya Harding left Gilooly because he was hitting on another skater.
Tonya Harding opens new night spot in Portland: "Club Nancy."
Tonya Harding shoe laces for sale -- cheap.
Tonya Harding weds Buddy Ryan... photo at 11.
Tonya Harding's been made president - yeah, of The Club!
Tonya Harding's favorite soft drink - CRUSH!
Tonya Harding, for the Club, theft deterant
Tonya Harding-New Spokesperson for "The Club"
Tonya Harding...a lead-pipe cinch for the Gold Medal!
Tonya Harding: Amy Fisher on ice.
Tonya Harding: new spokesperson for "The Club"
Tonya Rodham Bobbit: Meanest woman on earth
Tonya after the Olympics: "I'm going to Euro-Disney!!!"
Tonya's club sandwiches will knock your socks off.
Too Many Cooks Spoil The Broth -- Let Me Do It
Too Much of a Good Thing Can Be Wonderful.
Too Nice A Day To Be Stupid Indoors - Ren.
Too Rough: Soren Redd
Too Sexy For My Pants - by Harry P. Ness
Too Telix or not too Telix .. nah, it ain't even a question!
Too bad Han does it solo, it's much more fun with a partner!
Too bad I can't castle now! said Tom in Czech.
Too bad about your Rectocranial Inversion. Get well soon
Too bad beer and donuts don't go together better. Pity.
Too bad criminals don't give advance notice..
Too bad ignorance isn't painful!
Too bad life doesn't have INSERT and DELETE keys...
Too bad my brain doesn't work in real time.
Too bad some US citizens are so blind to reality.
Too bad stupidity isn't painful
Too bad stupidity isn't painful.
Too bad that stupidity isn't painful
Too bad that stupidity isn't painful...
Too bad the gene pool has no lifeguard.
Too bad the true quote is a few characters too long for a qualified tag
Too bad this isn't the Wide World Of Sports.
Too bad this man can't take his own taglines for face value.
Too bad women don't have pull-down menus and online help!
Too bad your modem isn't context correcting.
Too bad, Bob , but you know too much.
Too bad, Orville Bullitt, but you know too much. ... AARRGGHH!!!
Too bad, but you know too much.
Too busy now to get married ...
Too busy to laugh? Then you are too busy.
Too chaste an adolescence makes for a dissolute old age. Andre Gide
Too chicken to get in harm's way.
Too clever is dumb <German proverb>
Too clever is dumb. -- Ogden Nash
Too close for missles, switching to guns.
Too dumb to be crooked
Too early for a beer? ...No, for stupid questions.
Too err is human. To moo, bovine.
Too err is human....Computers are always RIGHT!
Too few Americans know the difference between "right" and "privilege".
Too few of the bucks stop here.
Too hip for Taglines.
Too hip for recipes.
Too hip for taglines
Too hot to go to church? What about Hell?
Too hot to hoot.
Too humble is half proud. Yiddish Proverb
Too ignorant, too.
Too late for a game of Stratego? --Sam. 22 years too late. --Mulder.
Too late, Peri. Time to say goodbye. -- The Doctor
Too late, Peri. Time to say goodbye.-- The Doctor
Too late, you are both devoured - Tom the Dungeonmaster
Too lazy to head out to the library and find out! :-)
Too little sex makes you repeat yourself redundantly.
Too long? Do I qualify? Or am I once again inadequate? - Keepers
Too many "What ifs..." & "Yeah, buts..." not enough answers!
Too many authors spoil a book.
Too many authors spoil the book.
Too many bells and whistles
Too many bigots for my liking / Too many critics, too few writing
Too many birds on her antenna.
Too many boards, not enough phone lines.
Too many children have died in the name of Christ.
Too many cooks spoil the broth.
Too many cooks, so little meals.
Too many digital irons in the virtual fire....
Too many fingers on keyboard error!
Too many foreign countries are living beyond our means.
Too many have dispensed with generosity to practise charity. Camus
Too many hobbies, NEVER too many birds!!
Too many hobbies, but *never* too many birds!
Too many hobbies, too little time!
Too many irritations. Please access help file BACARDI.151
Too many jokers and not enough aces in his deck.
Too many kooks soil the brothel.
Too many messages posted today.
Too many messages, not enough Rock 'n' Roll.
Too many of your enemies would delight in your death, Doctor. -Turlough.
Too many pages make a tome.
Too many people confuse free speech with loose talk.
Too many people have the government confused with parents
Too many people have the government confused with their parents.
Too many people miss the silver lining because they're expecting gold.
Too many pieces of music end too long after the end.
Too many pray for peace with their fists clenched.
Too many want a government that will give them more than they deserve.
Too many wild asses are not yet extinct.
Too many years fighting back tears, why can't the past just die?
Too much DOOM ][: You fire a Rocket into Dark rooms.
Too much DOOM ][: You've started to side step into rooms.
Too much DOOM ][: Your clock seems to be fast.
Too much DOOM ][: Your coffee has frozen.
Too much DOOM ][: Your fingers start to shake.
Too much DOOM: You fire a Rocket into Dark rooms.
Too much DOOM: You've started to side step into rooms.
Too much DOOM: Your clock seems to be fast.
Too much DOOM: Your coffee has frozen
Too much DOOM: Your fingers start to shake.
Too much DOOM: You fire a Rocket into Dark rooms.
Too much DOOM: You leap off tall buildings thinking it's not gonna hurt.
Too much DOOM: You've started to side step into rooms.
Too much DOOM: Your clock seems to be fast.
Too much DOOM: Your coffee has frozen.
Too much DOOM: Your fingers start to shake.
Too much FREE space? Keep *.BAK files!
Too much Pascal: You finish all your typing with semi-colons;;;;;;;;;
Too much Stuff? Time to buy a BIGGER house!
Too much Trek: You name all your cats after Starfleet Admirals.
Too much broth can spoil the cook.
Too much coffee distorts your uo|s|^.
Too much confusion, I can't get no relief - Hendrix
Too much ego, not enough brains ....... <sigh>
Too much free time? Become a SysOp
Too much garlic is a contradiction in terms!!
Too much glory can be half disgrace.
Too much infinity. -SLR
Too much is never enough.
Too much is never enough...
Too much love is dangerous
Too much love will kill you, just as sure as none at all.
Too much message, too few taglines!
Too much modeming: "What's that big shiny thing?" "It's the sun."
Too much money? Get married or run a BBS!
Too much money? Run a BBS or get married!
Too much month at the end of the money.
Too much month at the end of your money?
Too much month left at the end of the money
Too much of @FN@ is wonderful.
Too much of YOU is wonderful.
Too much of a good thing can be wonderful.
Too much of a good thing is WONDERFUL, Mae West
Too much of a good thing is WONDERFUL.
Too much of a good thing is WONDERFUL. - Mae West
Too much of a good thing is WONDERFUL. -- Mae West
Too much of a good thing is wonderful! - Mae West
Too much of a good thing is wonderful.
Too much of a good ting can be wunnerful...
Too much of anything, even love, isn't necessarily a good thing.
Too much of everything is just enough. -- Bob Wier
Too much sex can cause memory loss... what was I talking about?
Too much sex makes b(((bl(((luurre((edd vv((iissii((oonn.
Too much shareware, not enough registration $$$.
Too much time on your hands? Plant some Zucchini...
Too much virus talk is making you squirrelly !!
Too much wrestling - Tom
Too much yardage between the goal posts.
Too naive to even know how to spell naive? :^> -Dodger
Too nice a place for a deadly game of cat & mouse - Mike
Too often justice is incidental to law and order.
Too old to cry
Too old to know better, too young to resist!
Too old to rock & roll; too young to die......
Too old, and too crypto-fascist! - Young Lister
Too sexy for your cat.
Too stupid to know what I'm involved in.
Too stupid to know what you're involved in, huh?
Too tired to think up a new recipe!
Too tired to think up a new tagline!
Too wiks aygo, aye cudt spll geeneollojist an now i r wun!
Too. Much. COBOL:. You. Put. Periods. Everywhere.
Toodleoo, go with God, and don't take any wooden nickels.
Took a drive in the dirty rain --U2
Took an hour to bury the cat - damn thing kept moving.
Took an hour to bury the cat. Silly thing kept moving
Took an hour to bury the cat. Silly thing kept moving...
Took an hour to bury the cat. Wouldn't stop moving!
Took an hour to bury the cat. Damn thing kept moving.
Took an hour to bury the cat. Damned thing kept moving.
Took an hour to bury the cat. Silly thing kept moving!
Took an hour to bury the cat. Silly thing kept moving.
Took an hour to bury the cat. The silly thing kept movin'
Took an hour to bury the cat. The thing kept moving.
Took an hour to bury the cat...damned thing kept moving
Took an hour to bury the cat...wouldn't stop moving....
Took down some names...and sent me to the county home.
Took me an hour to bury @FN@. Silly thing kept wiggling.
Took me an hour to bury YOU. Silly thing kept wiggling.
Took me an hour to bury the catwouldn't stop moving.
Took the mage's brain? Stupid orcs, just get the spellbook!
Took your car, drove to Texas.
Tooling through the Universe,we are just electrons flow'n
Toonces the Cat drive a Dodge Tradesman?
Toot. Tee. Toot. Toot. - Mike hums to lame jazz music
Tootsietail: A untied shoelace.
Top 6% income folks will pay 75% of all new taxes!
Top Cash paid for good Taglines!
Top Cops - Everything else is just fiction.
Top Secret Destroy Before Reading !!!
Top Secret Message: Please Read, Print, and Eat.
Top Secret message - please read, print and eat.
Top Sirloin - The Nine Billion Names of Tom Servo!
Top Ten Epitaphs On My Gravestone: >2. R.I.P. graphics now available!<.
Top Ten Epitaphs On My Gravestone: >7. What, me dead?<.
Top male models make 1/10 of what top female models get.
Top o' the food chain to ye!
Top paddock is full of rocks.
Top secret! Burn before reading!
Top that, sugar britches! - Dr. Forrester to Joel
Topic Cop being held hostage: Send 10 Taglines or he gets it!
Topic Cop being held hostage: Send 10 recipes or he gets it!
Topic Cops don't do SLMR.
Topic police... have mercy! :)
Topic unknown: (A)bhor, (R)etch, (F)lail, (I)gnite
Topic.
Topic: Stuff that forms on the top of hot chocolate.
Topics? We don' need no steekin' topi.... NO CARRIER
Topics? There are separate topics?
Topics? We don' need no steekin' topi**** NO CARRIER
Topo Gigot was an Italian black art rod puppet - Tom
Topologists DO IT on rubber sheets.
Topping tonight's stories - chocolate fudge! . Buster Bunny
Topping tonight's stories -- chocolate fudge!
Torak's Tooth!
Tori Amos is a *babe*! - Gary Layton
Tori Amos, Alice Cooper, Danzig (a lot of them), Extreme, Faith No More
Tori Amos, Alice Cooper, Danzig (alot of them), Extreme, Faith No More,
Tori Amos, Crucify and God, respectively.
Tormented preachers hail the twisted cross.
Torn between two airplanes - Mike sings
Torn out books are most used books.
Toronto Blue Jays - 1992 World Series Champions
Toronto Blue Jays 1992 World Series CHAMPIONS!
Toronto Blue Jays @X00@X0E "0 down - 4 to go - GBJ!" @XFF
Toronto Blue Jays @X00@X0E "World Series Champeens!" @XFF
Toronto as the Centre of the Universe would be a very good choice.
Toronto? Wasn't he the partner of the Lone Ranger?
Tororororororo: A lawn mower that won't start.
Torpedo in the wat#$%^ NO CARRIER
Torpedoes offline-<A>bort <P>hasers <B>eg for Mercy?
Torpedoes? I don't see any torpe**)%@@$&^&&^&#$NO CARRIER
Torpedos Offline, (A)bort, (T)ry phasers, (B)eg for mercy
Torpedos Offline: <A>bort <P>hasers <B>eg For Mercy
Torpedos Offline: (A)bort (P)hasers (B)eg For Mercy
Torpedos Offline: (A)bort, (T)ry Phasers, (B)eg For Mercy??
Torpedos Offline: (A)bort, (T)ry Phasers, (B)eg For Mercy
Torque... Torque is the answer.
Torquemada of Borg: NOBODY assimilates the Spanish Inquisition!
Torres has great legs, for a Klingon.
Torro! -- The Mask
Tortilla: Lawyer's lunch choice.
Torture a Jehovah's Witness! Tie them up and talk about your religion.
Torture numbers and they'll confess to anything.
Torture the numbers and they'll confess to anything.
Torture: The Ultimate Art Form.
Torvil & Dean knows how the USA boxing team felt in Korea
Tossing Bestseller: Bulimia for Blonde Beginners by Chuck M. Up.
Tossing dwarfs, bashing twits It's all the same to me.
Tossing, turning, nightmares burning, dreams of swords in hand.
Total Confusion: The Power Source of the Future !!
Total HOST hard drive error, logoff and send money...
Total Paranoia IS Total Awareness!
Total Spiritual Enlightenment helps me score with babes.
Total Spiritual Enlightenment helps me score with the babes.
Total face - Mike after fooling Dr. Forrester
Total lack of ethics? Become a Christian lawyer!
Total mondo double way, or your money back!
Total paranoia IS really only 100% awareness.
Total paranoia is perfect awareness.
Total security is slavery; total freedom is anarchy.
Total spiritual enlightenment helps me score with chicks.
Total stangers need love too, and I'm stranger than most.
Total strangers need love too, and I'm stranger than most
Total strangers need love too; I'm stranger than most.
Totalitarians remove all traces of my existence! said Tom unpersonably.
Totally Spam...Lubricated. Well, I'm Phasing.
Totally illogical, there was no chance.
Totally non-offensive recipe. G-rated.
Totally non-offensive tagline. G-rated.
Totally non-offensive tagline. G-rated.
Totally random tagline for the day.
Totally unencumbered by orthodox reality concepts....
Totaly unencumbered by orthodox reality concepts.
Toto! Don't go into the Deadly Desert! $!&^/( NO TERRIER!
Toto! Don't bite into that electrical wi$^%& NO TERRIER
Toto! Don't go into the Deadly Desert! $!&^/( NO TERRIER!
Toto! Get off that power line...^%& NO TERRIER
Toto! Stay off that EPS power tap$^%& NO TERRIER
Toto, I don't think that we're in Kansas anymore
Toto, I don't think we're in DOS any more..
Toto, I don't think we're in DOS anymore. . .
Toto, I don't think we're in DOS anymore...
Toto, I don't think we're in Kansas anymore.
Toto, I've a feeling we're not in Kansas any more.
Toto, don't think we're online anymore%$#^@# NO CARRIER
Toto, don't think were on-line anymo-- %$#^@# NO CARRIER
Toto, don't think were online anymore%$#^@# NO CARRIER
Toto, how come everything seems so slow? Woof, Woof, Windows
Toto, look, no resending errors in Windoze - NOT!
Toto, we're not in Windoze anymorethank goodness!
Totsnotter: A child who is crying and talking simultaneously.
Totsnotter: A child who is crying and talking simultaneously.
Touch a Ferengi on the ear and he'll follow you anywhere!
Touch and be touched. Enjoy and be enjoyed.
Touch her THERE & she buzzes! - Tom
Touch if you must, Pay up if you bust.
Touch it! Are you MAD? I can barely bring myself to LOOK at it.
Touch me and make me magical....
Touch me and you'll see I feel as good as I look.
Touch me, Feel me, Eat me........
Touch my bird. Go ahead! - Tom
Touch my food and you're one dead dog! Garfield to Odie
Touch my gingham! - Tom seductively, as cowgirl
Touch my lips and close my eyes, take me away to paradise
Touch the old nose...*Your* nose, Radar. - Henry
Touch the screen and FEEL my healing power.
Touch the sky with your mind!
Touch-a, touch-a, touch-a, touch me....I wanna feel dirty!
Tough Love is better than co-dependency.
Tough job: Moderating the ANARCHY echo.
Tough neighborhood: Where the kids use barbed wire for dental floss.
Tough times demand tough talk ! - Neil Peart / RUSH
Tough when Barnaby Jones out-actions you - Tom
Tough? My goldfish can whip your dog!
Toughest part of a diet? Shutting up about it.
Toughest years of marriage are those after the wedding!
Toughskins! - Crow
Toupee & Grey Weave. They're cops - Crow
Toupee truck overturns - Police combing area.
Toupee truck overturns...police combing the area.
Touring the riot scene. Gravely assessing the devastation.
Tourist Season - When it's OK to shoot them.
Tourist Season: When it's OK to shoot them.
Tourists do it abroad.
Tourists don't believe I've never *been* to Graceland <sigh>.
Tourists: The only foreigners the French ever drove out.
Tourrettes of the Old West - Frank as old man yells
Tout est au mieux dans le meilleur des mondes possibles. (Voltaire)
Tout s'en va, tout passe, l'eau coule, et le coeur, oublie.
Tov Mallorn - The Googooplex Names of Tom Servo!
Tower case? Nah, it fell off the desk and landed that way!
Tower case? Nah, fell off the desk and landed that way.
Tower: "Say position." Pilot: "Position."
Tower: "Say your position." Pilot: "We're seated." Twr: "Thank you."
Tower: "Say your position." Pilot: "We're seated." Tower: "Thank you."
Tower: Say position. Pilot: Position.
Town criers rule, okez, okez, okez
Town under siege: Waco, Texas. Ross Perot: Wacky Texan.
Toxic waste sample? - Nope, cafeteria coffee.
Toxicologists DO IT to beyond the no-effect level.
Toxicology- a risky profession
Toxins rise-Through melting skies-Life will dieMachines.
Toy soldiers? - Lister
Toyboat, toyboat, toyboat, toyboat, toy-PLANE????
Toyota Too Often Yankes Overprice This Auto
Toyota: Taking Our Yen Out -- Thanks All
Toys are made in heaven, batteries are made in hell.
Toys at your age, LaCroix? Really! - Nick Knight
Toys in the attic.
Tra la la BOOM de ay--I gots more AN-i-me!
Trace this phone call and tell me where I'm at!
Tracer rounds work BOTH ways. 'Murphy
Tracers work both ways.
Tracing ancestors isn't easy, when you haven't got a line to follow!
Tracing the Family Tree isn't easy - It's a Jungle out there!
Tracing the tracks...
Track 0 bad?? Don't worry, there's lots of others...
TrackIt! v1.0 for Telix
Trackball: a mouse that went belly up.
Trackman(men) have bigger balls.
Tractor Police, John Deere Squad! - Mike
Tractor Pulls: For people who don't understand WWF.
Tractor beams are my specialty -- Wesley
Tractor pulls: for people who can't understand wrestling.
Trade School - IBM Clone Computer
Trade Wars -- The Good, The Bad, and The Ferrengi.
Trade me for a chicken - Crow as young kidnapped girl
Trade ya' some MIPs for some MegaFlops!
Traded bowling for sex, the balls are lighter & you don't need shoes.
Traded bowling for sex; balls lighter & don't need shoes
Traded my flammable clothes for inflammable ones. I'm safe now!
Traders do it on the floor
Tradition - Reason to repeat the same mistake!
Tradition is always the last refuge for the incompetent.
Tradition is always the last refuge of the incompetent.
Tradition is no excuse for insensitivity or racism.
Tradition. Sometimes it's all we have. - The Kurgan
Tradition: The art of making the same mistake over and over.
Traditionalists do it the old-fashioned way.
Traffic lights set for 30mph are good at 70 and 140!
Trafficking in worms is an underground industry.
Tragedy, when the mornin' comes and you're all alone - Bee Gees
Tragedy: To marry for love and find out he has no money.
Tragic heroes always moan when the gods take an interest in them.
Trail got to be here somewhere ---D. Boone---
Trail hint: Always drink upstream from the herd.
Trails got to be here somewhere - D.Boone
Trails in the Sand by Peter Dragon
Train of Thought-Now boarding - Last stop; Gutter.
Train of thought derailed / still boarding at the station.
Train of thought derailed, Dozens dead, Film at 11:00
Train of thought derailed... dozens killed... film at 11:00.
Train of thought is still boarding at the station.
Train up a child in the way he should go....
Train veterans to uncork emotions rather than liquor bottles!
Trainees do it as practice.
Training a child is more or less a matter of pot luck.
Training a child is more or less a matter of potty luck.
Training is not hard for a cat; mine trained me very well!
Training pet humans is hard work for an honest cat.
Trains charge those going to rock concerts, said Tom with fanfare.
Trains don't kill people, level crossings do.
Trains, Trains, Trains everywhere, and not a box car in sight.
Traiter son entourage de "Con" n'est pas un outrage mais un Diagnostic
Traitorous dog! I brainwash you and this is how you repay me?!!
Traitors never have a nice day.
Traits that we despise in people, we prize as virtues in cats.
Traits we despise in people, we prize as virtues in cats!
Tramapoline! Trabapoline! Say what now?
Tramp! Harlot! Jezibel! Be gone with you! - TV's Frank
Trampled spirit, turn your sun into a man - Course of Empire
Trampoline acrobats DO IT over a net.
Trampoline acrobats DO IT under the big top.
Tran-Zen-Dental oxymoron: Dentist who wishes patients weren't mouthy.
Trans-Warp Drive a producted of Intel.
Transcendental meditation can emancipate the man...
Transcendental vegetation.
Transcripts of my life are available, ask for details
Transexual: One who carried his junior year abroad a little too far.
Transfer aborted (again)(ha ha ha ha!!)...
Transfer everybody's phone calls to your bosses phone
Transfer your bosses calls to security
Transformers: More than meets the eye!
Transillvania Morgue: You brain em', we'll drain em'
Transistor: (n) a device used to protect fuses.
Transistors blow before a protecting fast acting fuse.
Transmission Terminated . . . . . ..
Transmission from the bridge of ISD Chimera ...
Transmission jammed at the source, sir. -- Uhura
Transparent people never sit in front of you in a theater.
Transplanted from Hawaii.
Transplanted from Wisconsin.
Transport Marie Celeste is now departing. - B5 public announcement
Transport Marie Celeste will be departing in 5 minutes - Babcomm
Transportable: Neither chained to a wall or attached to an alarm.
Transportation to get to the ship in the first episode.
Transported Californian - Hey Dude, where's the beach?
Transporter Chief Gibbs, your beams hanging out!
Transporter Chief Sharlow, beam me a large cheese pizza and a 6-pack!
Transporter Chief very funny, Now beam Councilor Troi's clothes back on
Transporter Chief, Beam Counselor Troy's clothes back on!!
Transporter Chief, beam me a large cheese pizza and a 6-pack!
Transporter Room Three is used - drink!
Transporter chief #AL#, Beam the landing party to the Bridge.
Transporter chief @LN@, beam the away team to the bridge.
Transporter chief @LN@, beam the landing party to the bridge
Transporter chief Bullitt, beam the landing party to the bridge.
Transporter chief Orville, beam the landing party to the bridge.
Transporter chief, beam the landing party to the Bridge.
Transporter room! Duracell! There, that's better.
Transporter room, beam me up immediately!
Transporter room, beam that tagline up immediately!
TransporterChief very funny, Now beam Councilor Troi's clothes back on
Transporters. Don't talk to me about Transporters.
Transporting really is the safest way to to travel.
Transporting really is the safest way to travel -- Geordi
Transporting really is the safest way to travel.
Transsexual: One who carried his junior year abroad a little too far.
Transvestite (n): A man who wants to eat, drink and be Mary.
Transvestite Nazi bikers and those who love `em on the next Oprah!
Transvestite's Motto: Eat, drink, and be Mary.
Transvestite: A Sham Ma'am.
Transvestite: He who likes to eat, drink and be Mary.
Transvestite: A Sham Ma'am.
Transvestite: A guy who likes to eat, drink and be Mary.
Transvestite: A man who wants to eat, drink and be Mary.
Transvestite: He who likes to eat, drink and be Mary.
Transvestite: One who likes to eat, drink and be Mary.
Transvestite: eat, drink, and be Mary!
Transvestites do it abroad.
Transvestites enjoy mixed company....alone!
Transvestites suffer from delusions of gender.
Transwarp drive in 5 4 3 2 1 <clink> <sputter> <clunk>
Transwarp drive in 5 4 3 2 1...<cough> <sputter> <clunk>
Trapezoid (n): A device for catching zoids.
Trapped by exponentially decreasing response.
Trapped, like a trap in a trap.
Trapper: "I see 3 of 'em." Hawkeye: "Hit the one in the middle."
Trash Drive C:? (Y)es (O)k (F)ine by me
Trash Drive C:? (Y)es (O)k (F)ine by me
Trash drive C:? (Y)es (S)ure (F)ine by me
Trash is stuff you throw away. Stuff is trash you keep.
Trash is trash no matter how you arrange the pile
Trash your To Do List; you won't do it anyway.
Trashed my To Do List; I won't DO IT anyway.
Trashy paperbacks come from the trite side of the racks.
Trasvestite: a man who wants to eat, drink and be Mary!
Traue Niemand.
Travel among books is the best travel of all.
Travel broadens the mind. That's why aliens have such big heads.
Travel by motorcycle, said Tom triumphantly.
Travel by motorcycle, said he triumphantly.
Travel important today; IRS men arrive tomorrow.
Travel to Singapore can be a real pain in the a$$.
Travel/Vacations....Getting there is half the fun.
Traveling at the speed of Knight. (GALLOP SPEED NOW!)
Traveling faster than light, but left his sneakers behind.
Traveling this spring? Visit Pern in between.
Traveling through hyperspace ain't like dusting crops, Orville!
Traveling through hyperspace ain't like dusting crops, boy!
Traveling through hyperspace isn't like dusting crops, bo
Traveling through hyperspace isn't like dusting crops, boy.
Traveller: Beyond Lies Midworld.
Travelling this spring? Visit Pern in between
Travis hasn't got the brains God gave a cat.
Tray: A portable mess.
Trazim apotekarku!
Trazim devicu da odmorim desnicu
Trazio sam njenu ruku, a dobio nogu
Treason - its not just an adventure, its a legislative career.
Treasure true friendship; it is priceless.
Treat each day as your last, one day you will be right.
Treat earth as you should have your Mother. It is.
Treat every day as if it was your last......, one day it will be.
Treat every hour like a lunch hour.....
Treat every woman as if you have slept with her...or soon will.
Treat everyone equal & it's called discrimination
Treat everyone you meet like you want to be treated.
Treat her like a lady and she'll always bring you home.
Treat her like a lady, and she'll always bring you home...
Treat her like a thoroughbred and she won't be a nag
Treat him like a flower... grab him by the stalk.
Treat me like the pig that I am
Treat women as adults; in rights *AND* responsibilities.
Treat women like dirt -- use them as mulch in your garden.
Treat you wife like a thoroughbred or you'll end up with a nag.
Treaties are like roses and girls; they last while they last.
Treaties like roses and girls - they last while they last
Treba mi skloniste od buke, treba mi muzika i stisak ruke.
Treba platiti, pa videti.
Treble Damages: Is that when you blow a tweeter?
Treble says to Mad Dog at Canada's Wonderland: "You're weeeeird!"
Tree Hugger's Nightmare: Mt. Graham Red Squirrel Stew ...
Tree falls in forest. Hits Milli Vanilli. Someone else screams
Tree falls in forest. Hits Milli Vanilli. Someone else screams.
Tree huggers unite! Someone has to love you.
Treefallsintheforest,hitsMilliVanilli,someoneelsescreams.
Trees are made of more than wood.
Trees are the #1 cause of forest fires.
Trees are the number one cause of Forest Fires.
Trees cause more pollution than automobiles. -Ronald Reagan
Trees hit cars only in self-defence.
Trees moving back & forth make the wind blow.
Trees moving back and forth are what make the wind blow.
Trees moving back and forth make the wind blow.
Trees never hit automobiles, except in self-defense.
Trees that grow in smoggy cities are needed to make carbon paper.
Trees wave back and forth, creating wind.
Trees without roots fall over.
Treguna mecoites trecorum satis di.
Trek = Star Trek
Trek Algebra 101: (Picard / Kirk) * Spock = Data.
Trek Algrebra 101: (Picard / Kirk) * Spock = Data.
Trek Bumpersticker: Blonde Borgs have the same fun.
Trek Bumpersticker: HONK if you've slept with Riker!
Trek Bumpersticker: Have you hugged a Ferengi today?
Trek Bumpersticker: Our other starship separates into 3 pieces!
Trek Classic -- Who Needs Another Generation?
Trek Classic -- it's the real thing.
Trek Credo #1: Never explain the technology, just dazzle them with SFX
Trek Credo #5: Enemy alien races don't get snappy comeback lines.
Trek Mania World Tour - 1994
Trek Virus: Invades your system where no virus has gone before
Trek Writer's T-Shirt: The other guy wrote Kirk into the script!
Trek Writers T-Shirt: We don't have to explain anything!
Trek episode *we'll* never see: "Three in a Ro."
Trek excuse #1: The Prime Directive clearly forbids it
Trek excuse #1: The Prime Directive clearly forbids it!
Trek is a show for those who don't believe in Kosh.
Trek tags, anyone? >> NO TRIBBLES <<
Trek to my left, SeaQuest to my right. I need a real show.
Trek to the left, SeaQuest to the right. I need a real show.
TrekTag: Picard is the Sysop, Data the System, and Wesley's the top D/L.
TrekTag: Picard's the Sysop, Data's the System, & Wesley's the top D/Lr.
Trekker in pon farr seeks Trekkess for bonding - leave e-mail!
Trekker make better lovers!
Trekkers are conceived from a superior Gene pool.
Trekkers do it on impulse.
Trekkers make it so.
Trekkers of Terra - unite!
Trekkers work out at the "He's Dead Gym"
Trekkers work out at the He's Dead Gym.
Trekkers work out in the 'He's Dead Gym'.
Trekkies DO IT at high warp speed.
Trekkies Do It On Impulse!
Trekkies do it with a warped drive
Trekkies make better lovers!
Trekkies of the world, get a life.
Trekkies with girlfriends - on the next Geraldo.
Trekkies work out at the He's Dead Gym.
Treknical Discussion: Science Friction.
Treknobabble, n: Nonsense words that solve the problem.
Trelane: Do you mean you have members of the fairer sex among your crew?
Trelane: Have I made an error in time? How fallible of me.
Tremble your way to Fitness...
Tremble, thou heathen; the Moderator cometh!
Tremble, thou heathen; the SysOp cometh!
Tremble, thou heathen; the Moderator cometh!
Tremp filok santi asker - oops, what universe were we in?
Trent Reznor IS god...
Trespassers WILL be violated - Sign at Kennedy homes
Trespassers will be experimented on!
Trespassers will be shot, survivors will be shot again!
Trespassers will be shot, survivors will be shot again!
Trespassers will be shot. Survivors shot again.
Trespassers will be shot. Survivors will be SHOT AGAIN!
Trespassers will be shot. Survivors will be prosecuted.
Trespassers will be shot. Survivors will be shot again!!!
Trespassers will be taken home to their mommies...
Trespassers will be violated!
Trespassers will be violated.
Tresspassers wil be SHOT - survivors will be shot AGAIN!
Tresspassers will be shot, Survivers will be shot again.
Trevor, the whisper thin cop - Crow
Trgovina je jedna vrsta umetnosti
Trial Law: Tess Temoni
Triangles Have 3 Sides
Triangulating vectors of interconnectedness of all things: 150 pounds.
TribbIe love Tribbles (with mustard and mayonnaise)
Tribble > * -- Tribble after Borg assimilation > #
Tribble + quadrotriticale = ***********************
Tribble -> * Bald Tribble ->
Tribble -> * Jean-Luc Tribble -> o
Tribble -> * Borg assimilated Tribble -> #
Tribble -> * Tribble having safe sex -> *
Tribble -> * Bald Tribble ->
Tribble 5 minutes and bowl of wheat later: *********
Tribble = Tribble Tags
Tribble Breathing: . Inhale * Exhale . Inhale * Exhale
Tribble Con '93. Guest Tribble: Shatner's Hairpiece.
Tribble Dodge'm cars: |_*_\ |_*_\/_*_| |_*_\
Tribble Family Reunion: ..*****..*****..*****..*****..*****..
Tribble Hood, Prince of Thieves: *>-->
Tribble II, the Adventure continues: *][
Tribble Math: * + Food = ************************
Tribble Olympics, Baseball: *! .
Tribble Olympics, Golf: *L. I
Tribble Olympics, Moguls: /\/\/\/\*//\/\/\/\/\/\
Tribble Olympics, Pole Vaulting: *\|__
Tribble Olympics, Skiing: *\\
Tribble Olympics, Snorkelling: *+
Tribble Olympics: Baseball: *! .
Tribble Olympics: Jousting: *|-------*--
Tribble Tags deleted for safety... They multiply too rapidly.
Tribble Use #16: Fake tumbleweeds
Tribble after Jenny Craig: .
Tribble after gestation inside alien: /\*/\
Tribble after haircut: .
Tribble after male augementation: *-
Tribble after sex: *-~
Tribble after using Windows: ~%#{..~$
Tribble and Bits: * * * * * 10010110
Tribble and mom out for stroll: *8
Tribble archery: *} - |
Tribble bandleader: */
Tribble bicycling: o*o
Tribble boomerang: *>
Tribble bowling: *______________o_____|
Tribble bozo: _*_
Tribble breeding is a hairy experience.
Tribble chain: -*-*-*-
Tribble convention: * * * * *
Tribble discussing quantum mechanics: *?
Tribble disguised as asterisk: *
Tribble droppings: *..
Tribble family portrait: *..* [Only $12.95 at Sears]
Tribble family: *..*
Tribble fetus: @
Tribble filename: *.*
Tribble footnote: *1
Tribble giving up to mugger: \*/
Tribble golfing: *L.
Tribble hockey: *\ . /*
Tribble hunting Tribbles: *)- *
Tribble in heaven: ~*~
Tribble in love with rock: *o
Tribble in midlife crisis: *?
Tribble in quandary: *?
Tribble in vise: >*<
Tribble in whirlpool: @
Tribble leaving bank: *$
Tribble like time fills empty space
Tribble math: * + Grain = ***********
Tribble mathematics: * + * = ****************************
Tribble mathmatics: * + * = *****************************************
Tribble meets Ford at 65Mph ---> ____
Tribble meets snake: ===<*>=<8)
Tribble mother and young: *.....
Tribble of Borg: "Cooo... Purrrrr... Assimilate!"
Tribble on crutches: /*\
Tribble on firing range: [+*+]
Tribble playing baseball: *!
Tribble playing harp: *&
Tribble polevaulting: *\ |--| /*
Tribble praying: *^
Tribble putting on roof: /\*\
Tribble roadkill: ===*===
Tribble sitting in Lotus position: *&
Tribble skiing -*-
Tribble smilie: *)
Tribble snagged by comet: - -- ---===>>>>>>>>>>>>*
Tribble splattered against ceiling: ^
Tribble stuck between elevator doors: |*|
Tribble stuck in zipper: %%%*%%%
Tribble taglines are irrelevant. Prepare to be emasculated.
Tribble tags. NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO
Tribble tipping hat: */^
Tribble toupee: ~
Tribble use #01 - as a device to torture Klingons.
Tribble use #01 - to irritate Klingons.
Tribble use #01 - to torture Klingons with.
Tribble use #04 - as fire starters.
Tribble use #07 - as a palukoo substitute in recipes.
Tribble use #09 - indoor baseball.
Tribble use #1 - Play-toy for tour cat.
Tribble use #1 - Play-toy for your cat
Tribble use #1001 - Use as insolation. (Beats asbestos any day.)
Tribble use #101 - New Masengill Tribbles, with vinegar and water.
Tribble use #12 - TrekActors hairpieces.
Tribble use #14 - hearing protection.
Tribble use #17 - falsies.
Tribble use #1: Cat toy
Tribble use #2 - Keeps the Klingons away
Tribble use #23 - that sticky, pasty film first thing in the morning.
Tribble use #24 - great to clean your car
Tribble use #25 - play-toy for your cat
Tribble use #26 - keeps the Klingons away
Tribble use #27 - keep your ears warm on those cold mornings.
Tribble use #28 - dust mop
Tribble use #28 - use instead of lab rats... you'll never run out.
Tribble use #29 - warm, fuzzy slippers
Tribble use #3 - Keep your ears warm on those cold mornings
Tribble use #32 - with white wine sauce, shallots & mushrooms.
Tribble use #38 - bobbing for Tribbles.
Tribble use #4 - Dust mop
Tribble use #40 - a kinder, gentler Orb.
Tribble use #46 - 500 make a fur coat.
Tribble use #5 - Warm, fuzzy slippers
Tribble use #57 - latest galactic sex toy.
Tribble use #6 - Toilet brush heads
Tribble use #64 - indoor golf.
Tribble use #7 - latest galactic sex toy.
Tribble use #70 - a mirkin.
Tribble use #72 - attic insulation.
Tribble use #78 - fuzzy dice for your rear-view mirror.
Tribble use #84 - as part of a balanced diet.
Tribble use #88 - Keep your cats entertained.
Tribble use #89 - Use instead of silicone for implants!
Tribble use #94 - Tribble Daquari.
Tribble use #97 - entertainment for your cat.
Tribble use: Dust mop
Tribble use: Keep your ears warm on those cold mornings
Tribble use: Keeps the Klingons away
Tribble use: Play-toy for your cat
Tribble use: Toilet brush head.
Tribble use: Warm, fuzzy slippers
Tribble viper: ======@
Tribble vs Godzilla: _
Tribble wearing headphones: [*]
Tribble with HEAVY saber: *\
Tribble with attitude: *'
Tribble with big feet: _*_
Tribble with chainsaw: *-
Tribble with lance: *}--
Tribble with legs showing: ,*,
Tribble with lightsaber: */
Tribble with shields up: <*>
Tribble your pleasure *** Tribble your fun
Tribble, not just your small furry beast anymore ####
Tribble, side view: *
Tribble: <-inhale * <-exhale <-inhale * <-exhale <-inhale * <-exhale
Tribble: <- Inhale * <- Exhale <- Inhale * <- Exhale
Tribble: * Tribble.zip (v1): .. Tribble.zip (v2): .
Tribble: Fuzzy ball, born pregnant, and has voracious appetite!
Tribble: Not just your small furry beast anymore ####
Tribble: When a girl trekkie and a boy trekkie get together?
Tribbles - $5.00 for all you can pile on top of you.
Tribbles : The worlds purest safe sex.
Tribbles Imitating Ants ***********************************
Tribbles and bits: ***** 10010110
Tribbles are born PREGNANT!!! - McCoy
Tribbles are to busy reproducing to have sex.
Tribbles are too busy reproducing to have sex.
Tribbles can make you *itch* like mad and |\\\\\\\> up your life!
Tribbles fencing: */ \*
Tribbles holding hands: *-*
Tribbles in the dark:
Tribbles only wanna' be loved.
Tribbles playing volleyball: * * | * *
Tribbles talking on phone: *}-------------{*
Tribbles who love Klingons , on the next Oprah!
Tribbles who love Klingons, on the next Oprah!
Tribbles, $5.00 for all you can pile on top of you.
Tribbles, Tribbles, rah rah rah!
Tribbles, you can't have just one.
Tribbles: $5.00 for all you can pile on top of you.
Tribbles: The worlds purest safe sex.
Tribbles: $5.00 for all you can pile on top of you.
Tribbles: Not just for makeup
Tribbles: The only truly inexhaustible resource.
Tribbles: The worlds purest safe sex.
Tribbles: We are the Borg. We surrender.
Tribbles: When a girl trekkie and a boy trekkie get together?
Tribbles: squish all you want, we'll make more.
Tribblets: ***
Tribbon: A pre-made bow you use to trim your gift.
Trick photography: focus pocus
Trickle down is what a dog does to a fire hydrant.
Trickle down theory -- when the $$$ go from George to Neil.
Trickster's logic...Be reasonable, Do it my way!
Tricorder. <slap> MEDICAL tricorder! - Holodoc
Tricorder? Medical tricorder!
Tricycle: A tot rod.
Tridy. Media. Baron De Bomb? - Tom on garbled Russian
Tried an Ear Candle on my cat. The bandages come off both of us soon.
Tried drowning my sorrows, little suckers learned to swim!
Tried drowning my sorrows; the little suckers can swim!
Tried telling my wife XMS meant 'Xtra Marital Sex'...
Tried the rest,now try the BEST!
Tried to call Phoenix, I misdialed FIJI
Tried to call Phoenix, I misdialed FIJI.
Tried to hang myself with bungee cord. I kept almost-dying.
Tried to play my shoehorn all I got was footnotes!
Tried to play my shoehorn all I got were footnotes!
Tried to play my shoehorn. All I got was footnotes...
Tried to play my shoehorn... all I got was footnotes!
Tried to play my shoehorn... all I got were footnotes!
Tried to play my shoehorn...All I got was Toe Jam!
Tried to play my shoehorn...all I got was footnotes!
Tried to play my shoehornall I got was footnotes!
Tried to play my shoehornall I got were footnotes!
Tried to play the shoehorn, but all I got were footnotes.
Tried to run UNREAL from Windows NT on a punch card based machine.
Trifles make perfection, and perfection is no trifle. -- Michelangelo
Trigenital neuralgia: Yes, that must hurt
Triglyceride - a monster from Jurassic Park...
Trill Burger: (Try one, you'll feel like a new person!)
Trill Burger: Try one, you'll feel like a new person!
Trill Surcharge on an Office Machine: A Dax Fax Tax.
Trill's play Musical Bodies at parties...
Trill: The musical equivalent of an epileptic seizure.
Trilogy (n). Series of three books, sometimes more.
Trilogy (n): Series of at least three books, usually more.
Trilogy (n): Series of three books, sometimes more.
Trilogy: (n) Series of three (or more) books. cf Adams, Douglas
Trim Those Sideburns Too?: Buzz Cutt
Trim Those Sideburns Too?: Buzz Cutt*
Trim federal government waste - fire Al Gore.
Trim federal government waste -- fire Al Gore.
Trimmed the Christmas tree, gave it a crew-cut.
Trionic Waves: Something you can always piggy back on
Trioxymoron: Amtrak experimental high-speed train.
Trip Trip to a dream dragon, Hide your wings in a ghost tower....
Trip! Noonan! Trip! - Crow as teens straddle ledge
Triple Meter: Only rich people should park by these.
Triple herman! - Tom on wrestling hold
Triple your drive space! Delete OS/2!!
Tripping merrily through BBS land......
Triput osam dva'es'cetr'...
Triskadekaphobiac? Me? Naaawwww, 13 is my LUCKY number!
Triumph: The Risk Involving Useless Machinery Pays Heavily
Trivia #23: Man falls into sewage pit, dies. WHAT were his last words?
Trivia Time: What goes, Uuuuh Uuuuh, I give, I give!!!!
Trivia: Roman diety of the crossroads. Represented with three faces.
Trivial Pursuit: The name of Robert E. Lee's horse? Loser!
Troi Burger: (double decker)
Troi Burger: Double decker!
Troi Scale: I feel you need to be on a diet NOW GET OFF!
Troi adds "a woman's touch" to bridge decor.
Troi and Polaroid, the picture's developing.
Troi as Captain: "Duuuuuhhhhh..." -- Marina Sirtis
Troi gives Betazoid insight to something obvious - drink!
Troi of Borg - "All your dark milk chocolate will be assimilated."
Troi of Borg - "Answer me... how does assimilation make you feel?"
Troi of Borg - All your dark milk chocolate will be assimilated.
Troi of Borg - Answer me... how does assimilation make you feel?
Troi of Borg: "How would you feel about me assimilating you?"
Troi of Borg: ...And how did assimilation make you feel?
Troi of Borg: How does assimilation make you feel??
Troi running the transporter, could be called an Energizer bunny?
Troi senses something really shocking - drink!
Troi to Enterprise. Beam down Lt. @LN@ and a six-pack.
Troi to Riker...I feel something...BIG!
Troi tugs trepidatiously towards tough torso territory.
Troi, I'm your friend, and you tricked me! Yar
Troi, make yourself useful and go clean out the shuttlebay. - Picard.
Troi, please report to my quarters, clothing optional.
Troi: Captain, I sense millions of people staring at my cleavage...
Troi: She's not just window dressing any more...
Troi: "Captain, I sense millions of minds focused on my cleavage"
Troi: "Commander I need to come too..."
Troi: Admiral will you sstop polishing mmmy commbadge?!
Troi: Ensign Elden wwill you sstop polishing mmmy commbadge?!
Troi: Ensign Koo will you stop polishing my combadge?!?!!
Troi: You don't have to speak _that_ close into my combadge
Troi:How was your date with Data? Tasha:Insufficient
Trojan: Storage device for replicating codes
Trojan: Storage device for replicating codes.
Trojan: Storage device for replicating codes...
Troll Appreciation Society, join today!!
Troma presents `Reform School Viking Girls'. - Tom Servo
Trombone players DO IT in 7 positions.
Trombone players DO IT with slide oil.
Trombone players do it in 7 positions.
Trombone players do it in seven positions.
Trombone players have bigger...instruments.
Trombone! Must be 76 of them - Tom on dinosaur roar
Trombone: A slide whistle with delusions of grandeur.
Trombones do it faster.
Trombonists do it in 7 positions.
Trombonists do it in seven basic positions....
Trombonists do it in seven positions.
Trombonists do it with better positions.
Trombonists use more positions.
Troops in Somalia were sacrificed due to bureaucratic incompetency.
Troops, there's no Christmas show this year, said Tom hopelessly.
Tropical Paradise by Kumon Iwannaf*ckya
Tropicana and the LAPD both have OJ in a can.
Trouble always follows Q? I thought R did.
Trouble brings experience, experience brings wisdom.
Trouble with a kitten is... eventually it becomes a cat.
Trouble with being punctual is nobody is there to see it.
Trouble with grammar have I, yes! Yoda.
Trouble with political jokes is they get elected.
Trouble with reality is there's no background music!
Trouble with reality, is that there's no background music
Trouble with uploaded mail packets? Try NUDUPS02.ZIP.
Trouble, trouble, toil and bubble. Hot lasagna, on the double.
Trouble: Life's way of saying be careful, next time Death!
Troubled by dreams of werewolves and Sabbats, I slept.
Troubled by kleptomania? Take something for it.
Troubles are like babies; they only grow by nursing.
Troubles are opportunities to grow. To make us better, not bitter.
Troubleshooting shortcut #1: Shoot the trouble.
TroughtonDOS 2.0: "When I say RUN, RUN!"
Troy to her boyfriend: "I feel something."
Truck Pulls: for people who cannot understand the WWF
Truck Pulls: for people who don't understand WWF
Truck Pulls: for people who don't understand WWF.
Truck carrying toilets overturns...Police have nothing to go on.
Truck pulls: for people that can't understand wrestling
Truck? What truck? -- Indiana Jones
Truckers tell my wife to watch her language....what's wrong with that?
Truckin / got my chips cashed in
True Friends have hearts that beat as one.
True Headline: Searchers Find Big Ugly Child
True Headline: Tuna Biting Off Oregon Coast.
True Heroics must be carefully planned- and strenuously avoided
True Irishmen don't use Shamrocks, they use real rocks.
True Multitasking = 3 PCs and a chair with wheels!
True Multitasking = 3 PCs and a chair with wheels! ___ Bl
True Multitasking: 8 PCs and a swivel chair!
True Religion Acknowledges Chocolate in Everything!
True Sadomaso conversation: "Beat me." "No."
True SysOps are Never satisfied with their systems.
True Trek fans have VCR's and satellite dishes and HDTV and...
True ad: 8 bagels for $1.49. Limit 3.
True charity makes others' wants their own. Robert Daborne
True contiguous memory... The final frontier...
True dignity: Remaining aloof during a prostate exam.
True enlightenment is a radical goal.
True headline: Man sues over mouse head in peanuts.
True headline: Organ expert impressed by ones here.
True heorics: carefully planned and strenuously avoided.
True humility is contentment. H.F. Amiel
True identity is found when one loses oneself. (A.M. Lindbergh>
True irreverance is disrespect for another man's god.
True laziness is a man inside a woman waiting for an earthquake.
True life begins when the kids leave home and he dog dies
True life begins when the kids leave home and the dog dies.
True listening is love in action. <M. Scott Peck>
True love is the greatest thing in the world!. -- Miracle Max
True love is when you spend $50 for an operation on a $5 dog.
True love means sleeping in the wet spot..
True meaning of PS/2. 1/2 a computer. OS/2, Half an Operating system.
True multi-tasking: Eight PCs and a swivel chair!
True multi-tasking: 3 PCs and a chair with wheels.
True multi-tasking: Eight PCs, 7 clones, and long bench!
True multitasking. Three computers and a chair with wheels.
True multitasking: Three PC's and a chair with wheels.
True science teaches, above all, to doubt and be ignorant. * Unamuno
True science teaches, above all, to doubt, and to be ignorant.
True swinging does not require ropes or vines.
True terror: A female Klingon with PMS off her medication.
True terror: A female Klingon with PMS.
True victory gives love and changes the enemy's heart. - Ueshiba
True wisdom is found in Taglines, on T-shirts and on restroom walls.
True wisdom is the ability to admit how little you really know...
True wisdom lies in knowing that you know nothing...
True wisdom: Found in Taglines, on T-shirts and in fortune cookies.
True wisdom: Found in Taglines, on T-shirts and on restroom walls.
TrueCrime Conference: Rule #1: Keep it illegal...
Truely you have a dizzying intellect..
Trujillo, you magnificent b*stard...I READ YOUR POST!
Truly stupid wizards have the life expectancy of a glass hammer.
Truly, There is Often Much Truth in Taglines!
Truman's Law: If you cannot convince them, confuse them.
Truman: "The buck stops here!" Clinton: "The buck? It never got here!"
Truman: "The buck stops here!" Clinton: "The buck? It never got here!"
Truman: The buck stops here. Clinton: The buck never got here.
Trump does it with cash.
Trumpet players DO IT with tighter lips.
Trumpet players blow the best
Trumptricate: Trying to compliment an ugly gift in a thank you note.
Trumpy, no!
Truncate (v.) (1993): See "Bobbitt, Lorena"
Truncate n., to shorten by cutting. See also Bobbitt.
Truncate: The process of shortening a recipe to a specif
Truncate: The process of shortening a tagline to a specif
Truncated (v.) (1993): See "Bobbitt, John."
Truncated: What happened to the peanut at the zoo
Trunkate. (V) Female to Male sex change operation.
Trust - Two cannibals having oral sex.
Trust God, but always tie and watch your camel all night.
Trust Jesus: Don't be told to go jump in the lake...
Trust No One -- The X-Files
Trust No One ... Deny Everything ... No One Is Safe ...
Trust No One. Deny everything.
Trust a government which won't trust me with a firearm?
Trust everyone, but always cut the cards.
Trust in Allah, but tie your camel.
Trust in GOD, *and* tie your camel tight
Trust in God -- But tie your camel tight!
Trust in God _and_ tie your camel tight.
Trust in God but _do_ something.
Trust in God but lock your car.
Trust in God, but backup your hard disk TODAY!!!
Trust in God, but lock your car.
Trust in God, but lock your car. -H. Jackson Brown, Jr.
Trust in God, but row away from the rocks. - Indian proverb.
Trust in God--but tie your camel tight. Persian Proverb.
Trust in the Lord forever -- Isaiah 26:4
Trust in the Lord with all your Heart.
Trust is the most valuable thing you'll ever earn.
Trust me I know what I'm saying
Trust me !! I know what I am doing !!! -=<<KABOOM!>>=-
Trust me - Just type INSTALL!
Trust me -- I'm a Lawyer.
Trust me @FN@ - if I pull you into it, I have reasons.
Trust me I know what I'm doing!
Trust me YOU - if I pull you into it, I have reasons.
Trust me sir. Just run Windows on the Borg's network.
Trust me! Would I lie to you... again?
Trust me! I'll still respect you in the morning.
Trust me, I know what I'm tagging.
Trust me, I work for the government :^).
Trust me, I'm a consultant.
Trust me, I'm a lawyer.
Trust me, I'm a lawyer... <sound of automatic weapons fire>.
Trust me, guys duck. -- Zeus Carver
Trust me, it's all part of the plan. -- The Mice
Trust me, it's more trouble than it's worth - B'Elanna
Trust me, kid - there's nothing to worry about. - Aahz
Trust me, would I lie to you..... TWICE?
Trust me, would I lie to you..... again?
Trust me. I'm a Doctor. I know about these things.
Trust me. Your safety is at stake.
Trust me. <Riggs> That's usually my first mistake. <Murtagh>
Trust me. I know what I'm do{ { tx$@!% % NO CARRIER
Trust me. I work for the government.
Trust me. R. M. Nixon
Trust me. Your safety is at stake.
Trust me... Yes... Will I still be perfect tomorrow? - Paranormia
Trust me......Never judge a book by its movie!!!!
Trust no government that wants to disarm its citizens.
Trust no one. -- Fox Mulder
Trust no one. --X-Files
Trust no one...and especially TV critics!
Trust only those who have as much to lose as you when things go wrong.
Trust only those who would lose as you if things go wrong
Trust the Computer!.....The Computer is your FRIEND!!!
Trust the Corp.
Trust the Moderator, Gregg De.
Trust the PSI corp. The corp is your friend.
Trust the match stick! - Crow
Trust the moderator, Luke.
Trust the script
Trust the stunt man, Luke.
Trust us. We're the government. We're here to help you.
Trust your Dispatcher...Your Dispatcher is your friend.
Trust your neighbors, but brand your cattle.
Trust: Two cannibals having oral sex
Trusting parents can be hazardous to your health - Calvin
Trusting your parents can be hazardous to your health. -Calvin
Trustworthy, Loyal, Helpful, Friendly, Courteous, Kind, Obedient...
Truth = Fact. Belief = Belief. Belief =/= Truth!!
Truth Meister!: A few fries short of a happy meal.
Truth Through Superior Firepower.
Truth angers those whom it does not fully convince.
Truth decay: The erosion of a public figure's credibility.
Truth dies when politics begins.
Truth does not matter; PERCEPTION of truth does.
Truth does not matter; perception of truth does.
Truth doesn't always win friends, but it sure does influence people.
Truth exists for the wise, beauty for the feeling heart.
Truth exists in ethnic reality
Truth exists independently of ideological imperatives.
Truth exists. Only falsehood has to be invented.
Truth exists. Only lies have to be invented. -- Georges Braque
Truth has nothing to fear from examination.
Truth hurts - not the searching after; the running from!
Truth in the hands of a fool is more dangerous than any sword!
Truth is FREE, but the Life that made it so, was Sacrifice.
Truth is a shield that protects those who use it.
Truth is a terrible habit... Don Juan DeMarco
Truth is absolute, lies are relative. - Mike McMullin
Truth is an empty room.
Truth is beautiful, without doubt; but so are lies.
Truth is elastic!
Truth is false and logic lost...
Truth is generally the best vindication against slander - Lincon
Truth is great and it's effectiveness endures. Ptahhotep, 2350 B.C.
Truth is just another misconception.
Truth is more of a stranger than fiction - Mark Twain
Truth is more of a stranger than fiction -- Mark Twain
Truth is not having to remember what you lied about
Truth is not stranger than science fiction.
Truth is one's perception of reality.
Truth is our only weapon. <The Dalai Lama>
Truth is packaged by weight, not volume.
Truth is shorter than fiction.
Truth is shorter than fiction...
Truth is stranger than fiction because fiction has to make sense.
Truth is stranger than fiction, but it will never be as popular.
Truth is stranger than fiction.
Truth is stranger than fiction. Fiction has to make sense.
Truth is stranger than friction.
Truth is the devil's fulcrum for launching his lies
Truth is the last thing folks want to hear.
Truth is the network AKA for reality.sys
Truth is the safest lie. -Anon
Truth is what's left over when you run out of lies.
Truth is, after all, so poorly lit.: Rush
Truth is, and we must find it. - Mike McMullin
Truth isn't based on opinion but on THE Truth......
Truth stranger than fiction? Fiction has to be believable
Truth unto paradox.
Truth will be out this morning. (Which may really mess things up.)
Truth will be shown to those who FOLLOW God's word.
Truth will come sooner out of error than from confusion.
Truth will make you free, but first it will piss you off.
Truth will set you free, but first it will piss you off. Ahhhhh...
Truth will set you free, but it might piss you off first.
Truth will sooner come out of error than from confusion. - F.Bacon
Truth will sooner come out of error than from confusion. -Francis Bacon
Truth, goodness and beauty are but different faces of the same all.
Truth, like reality is a slippery thing.
Truth, like reality is such a slippery thing <Myra I Fox>
Truth, like reality, is a slippery thing.
Truth, like so many things, is not an absolutebut almost.- J Butler
Truth, like surgery, may hurt. But it cures.- Han Suyin
Truth,Mainstream,Conservative,Think,Ourselves,..Party on RUSH!
Truth: I bought it for my aunt. She died.
Truthful: Dumb and illiterate.
Try Manuals out, after all possible keystrokes have failed.
Try "S" - that's for SPEAK WITH...
Try Accoustic, the *REAL* alternative music!
Try Borg Dry. "Beer is irrelevant."
Try Borg Dry. Why is irrelevant.
Try Champagne on a clit..it's GREAT !!!!!
Try Clarion for REAL database Development!!
Try DEL C:\WINDOWS\*.*
Try Dbase 1.0! It's loaded with "Features"!
Try DesqView/X under any kind of DOS.
Try Dragon's Egg Mead.
Try Megumi Bears--the snack that bites YOUR head off!
Try Milk of Amnesia - when you need to forget
Try Modem Bran--the high Cyber Cereal
Try NEW and IMPROVED...TAGLINE...from the makers of Tagline Barbie!!!
Try Preparation H-Bomb. For your Nuclear Piles.
Try Sanity Lite, Half the marbles of normal sanity!
Try To Resist Unnecessary Capitalization.
Try Try again
Try Win'95 and you'll never use DOS again... or the rest of your PC!
Try Windows for a good night's sleep while you wait and wait.
Try Windows for a good night's sleep while you wait..& wait.
Try Windows for a good night's sleep while you waitand wait
Try Windows, it's easier than learning something.
Try Windows..for a good night's sleep while you wait...and wait... Turbo
Try Windowsfor a good night's sleep while you wait...and wait...
Try Your Best, Then Steal The Rest, .....Snipit
Try `stty 0' -- it works much better.
Try a Betazoid wedding dress. Hell, ya can't beat the price!
Try a high-pitched sonic shower. It'll make you feel better! - Dax
Try a high-powered sonic shower -- Dax I did. -- Bashir
Try a new lease on life, and the landlord raises the rent.
Try a seafood diet- you see food, you eat it!
Try and steal@R@this tagline!
Try as they might they cannot steal your dreams -Rush
Try bungee sex to put the bounce back in your love life!
Try changing the layout of this microprocessor, Tom chipped in.
Try cooling coffee by holding it closer to your heart.
Try diplomacy, but if they won't listen, blow them away!OJW
Try everything once except folkdancing and incest.
Try everything once, except incest and folk-dancing
Try everything once.. Try the fun stuff again....
Try everything once... Try the fun stuff twice...
Try genealogy. You can't get fired and you can't quit!
Try hitting it harder this time.
Try it that way and your mail should go through ok.
Try it with your big toe, instead.
Try it, it tastes like Chocolate....
Try it, it tastes like chicken.
Try it, you'll like it! -Mac-
Try it, you'll like it. Trust me.
Try it. It's `bound' to be fun.
Try it. The most it can do is not work..
Try it.... You might Like it ....
Try joining the Neo-Nazi skinheads, you might find love there. NOT!
Try later.
Try me on, I'm very you.
Try new enriched STUFF - Crow
Try not to confuse you with what you do to survive..
Try not to eat anyone without cherishing and praising them first.
Try not to forget your telephone number.
Try not to have a good time ... This is supposed to be educational. -- Schulz
Try not to have a good time, this is supposed to be educational.
Try not to let implementation details sneak into design documents.
Try not to salt thy salt. For it is salted afore.
Try not to unnecessarily or excessively split infinitives
Try not to work so hard. Aren't you supposed to be retired!
Try not. Do. Or do not. There is no try. - Yoda
Try one Mister Vulcan...it may loosen you up.
Try orange juice and Milk of Magnesia and get a Phillips screwdriver.
Try our new dehydrated water! Just add ...uh...er...
Try our new line of supermodel-programmed Genesis bullets!
Try some of the Persian No, I'll just split a diet Tabby.
Try something less risky - like recording Enochian rap
Try switching to RADAR! - Crow as TV signal flickers off
Try that baby talk on me, I'll cold cock ya - Tom to Mike
Try that refreshing new feeling - THINK!
Try the *latest* in PhobosWear. Open midriff optional!
Try the ALL NEW Pfaff 7550! It'll keep you in stitches!!!
Try the Bobbit Diet...lose six inches overnight!
Try the Bobbitt Bar. They cut you off after three drinks.
Try the MILES'O'BEEF! - Tom on deli menu
Try the Moo Shu Pork. It is especially good today.
Try the RELIGION echo...They profess to have all the answers anyways!!
Try the RELIGION echoThey profess to have all the answers anyway!!
Try the grey stuff, it's delicious.
Try the morphine. It's excellent today!
Try the new Bobbit cucumber... it slices itself.
Try the new TARDIS hard drive: Bigger inside than out!
Try this Simm chip, Windows. Bet you can't eat just one.
Try this chicken. It tastes just like rattlesnake.
Try this tagline, free. No salesman will call.
Try this tagline, free. No salesman will call.
Try this. I haven't tested it, but I think it will work.
Try this. I haven't tested it, but I think it will work.
Try to act with a bit of decorum, this is a posh place.
Try to be the best of what you are, even if what you are ain't no good.
Try to be the best of whatever you are, even if what you are is no good.
Try to calm down!-HoloDoc DON'T TELL ME TO CALM DOWN!-Neelix
Try to die strangely so your outline will look cool
Try to display minimum cerebral activity when you think.
Try to divide your time evenly to keep others happy.
Try to establish a life style that does not require your presence
Try to explain Lover's Nuts to today's youth.
Try to explain a chocolate soda to today's youth.
Try to explain a flint and steel to today's youth.
Try to explain a telegram to today's youth.
Try to explain a vacuum tube to today's youth.
Try to fix the mistake...never the blame.
Try to get all of your posthumous medals in advance.
Try to get back on topic, Tom said moderately.
Try to get back on topic, he said moderately.
Try to get back on topic, she said moderately.
Try to get our brother Tommy out of the Badlands - Joel
Try to get rid of junk mail, but income tax forms arrive.
Try to have getaway money - but don't be fanatic about it.
Try to imagine Lorena Bobbitt getting a another date.
Try to imagine Mrs. Bobbitt getting a another date.
Try to look unimportant - they may be low on ammo.
Try to look unimportant because the bad guys may be low on ammo.
Try to look unimportant, the bad guys may be low on ammo.
Try to look unimportant, the bad guys may be low on ammo. 'Murphy
Try to look unimportant, the enemy may be low on ammo.
Try to look unimportant, they may be low on ammo
Try to look unimportant, they may be low on ammo.
Try to never run out of altitude, airspeed, and luck all at the same time!
Try to please everybody, and nobody will like you!
Try to reason about love and you will lose your reason.
Try to remain objective: you are a thinking substance.
Try to remember when life was so tender........
Try to run, but my feet have been nailed to the floor..
Try to take our firearms and we will take your life.
Try to think positive today, you will feel better for it!
Try to value useful qualities in one who loves you.
Try vodka and Geritol and have a Tired Bloody Mary.
Try! Baby try to trust in my love again. I will be there.
Try? Do or do not. There is no try. -- Master Yoda
Tryin' out that new Polish utility: Doski
Tryin'to spice up our sagging relationship -Frank to Dr.F
Trying To Establish Voice Contact - Please Yell Into The Keyboard
Trying out for the javelin retrieval team.
Trying their best is natural to a Scout.
Trying to add and subtract with this.
Trying to establish voice contact ... please yell into keyboard.
Trying to establish voice contact--please yell into keybo
Trying to establish voice contact--please yell into keyboard.
Trying to find my wife's good side; still circling
Trying to program in MS-DOS is like trying to play tennis in a closet.
Trying to program in MS-DOS is like trying to shave with a chain-saw.
Trying to reason with hurricane season
Trying to recover from another wild weekend.
Trying to save my soul tonight, Oh, it's nobody's fault but mine"
Trying to save the Canadian Taxpayers a buck!
Trying to squash a rumor is like trying to un-ring a bell.
Trying to teach a pig to sing wastes your time and annoys the pig.
Trying to teach a pig to sing, 1.annoys the pig 2.Wastes your time.
Trying to think of a good tagline
Trying to think of a good tagline...
Trying too hard to impress people can make one seem amazingly foolish.
TryingToChageTheModeCrackTheCodeImagesConflictingIntoDataOverload
Tsalmoth maintains though none knows how.
Tsk, tsk Lucas Tanner - Tom to David Hartman
Tsk, tsk Mr. Forsythe - Crow
Tsk, tsk Nelson - TV's Frank to Mike
Tsunami: something liquid this way comes.
Tu est restee trop longtemps au soleil aujourd'hui
Tu me rende malade!
Tuba or not tuba?
Tuba players DO IT with big horns.
Tuba players do it with big horns.
Tuba players do it with big instruments.
Tubas are a bit too much.
Tubas do it deeper.
Tubby or not tubby, fat is the question!
Tubby or not tubby, fat is the question.
Tubby, or not tubby? Now THAT'S a question!
Tube radios SMELL NICE.
Tube-powered? Must be a Macintosh.
Tubed the Apple River with Sally Jesse Rapheal? - Tom
Tubular Zylophones by Mike Oldfield
Tuck under thumb and hold firmly.
Tuene? Atque cuius exercitus?
Tuesday after lunch is the cosmic time of the week.
Tuesday is Human Sacrifice Day at the Sizzler - Tom Servo
Tuesday's grey and Wednesday too
Tuesday, Wednesday heart attack
Tug of War: Paul Hard
Tulough speaks the truth, Doctor. --Kamelion, "Caves of Androzani."
Tum Serpico - The Innumerable Names Of Tom Servo!
Tum de tum da-da ala ba boom! Ha! You're singing!
Tumblebat: Apparel stuck at the top of a clothes dryer.
Tumbleweed: Colorado Tribble.
Tumbleweeds are oversexed.
Tumor - more than one
Tumor............. An extra pair.
Tumor: More than one.
Tumor: More than one...
Tumor: A request for an extra pair.
Tumor: More than one.
Tumour -- an extra pair
Tuna doesn't taste the same without the dolphin.
Tuna doesn't taste the same without the mercury.
Tunar - Sonar-like device in cat food that causes cats to appear.
Tunar, Sonar device in cat food , causing cats to appear.
Tunar: Sonar-like device in cat food that causes cats to appear.
Tunar: Sonarlike device in can that causes cats to appear.
Tunar: sonar-like device in cat food that attracts cats.
Tune in again tomorrow, same Bat time, same Bat channel!
Tune in next week when Gypsy, Crow, and Tom Servo visit Deep Space 9!
Tune in next week when young Jean-Luc says the letter: Q!
Tune in, turn on, & drop out
Tune in, turn on, and be friends with EX-Mayor Barry.
Tune in, turn up, rock out..
Tune that ADF to the John Boy & Billy big show..
Tunes in the distance...
Tuning in shortwave with a TV antenna.
Tunnel vision, no compromise.
Turbo Pascal for WINDOWS? Borland's betrayed me!
Turbo Pascal for WINDOWS? Borland's betrayed me.
Turbo Pascal my true speech pattern
Turbo Profanity: The universal programming language!
Turbo Tax raids the Quicken directory.
Turbo taglines rule!
Turbo-Tax took money out of my Quicken directory.
Turbolift button for 10-Forward? "Space Bar" of course!
Turbolifts have a really low maximum weight limit.
Turgon Is The Master Of Level 12
Turkeys aren't those funny grey keys you know
Turkeys can't fly unless they are on Airforce One!
Turkeys can't fly unless they're on Air Force One !
Turkeys would rather walk *through* an electric fan than around it.
Turkish Minerals: Asa Miner
Turlough speaks the truth, Doctor. --Kamelion, "Caves of Androzani."
Turn Me On Dead Man.
Turn Your 486 Into A Gameboy : Type BINKLEY.BAT At The C:\< Dos Prompt
Turn a 486 into an XT--Install Windows 3.1
Turn a 486 into an XT: Just add Windows!
Turn around and walk the razor's edge..-RUSH The Pass
Turn around chicky baby.
Turn back the clock and you're history.
Turn down the treble, Tom intoned.
Turn down your air guitar.
Turn down your lights -- where applicable
Turn in a gun, get a free Tagline.
Turn in a stolen Tagline, get a free gun.
Turn it off and watch him sweat.
Turn it off! Turn it off!!! - Dr. F viewing movie
Turn it up!!, Louder! Now I can't hear you!
Turn left here, hon. I should have know he needs a map.
Turn off THAT CAPS LOCK
Turn off computer: SHUT-DOWN. Turn on computer: SHUT-UP?
Turn off your mind, relax and float down stream. - J. Lennon
Turn off your mind, relax and float downstream.
Turn off your mind, surrender to the Void.
Turn on computer: SHUT-UP?
Turn on some unrelated electrical equipment - Crow
Turn on the Radio. O.K., I love you, Radio.
Turn on your flood lights - Crow sings on lighted freezer
Turn on your love lava. Turn on your lava light.
Turn on, Tune in, and Reformat.
Turn on, tune up, rock out.. -- Billy Gibbons
Turn out the lights, the competition's over...
Turn over a new leaf...re-boot your brain.
Turn right here. No! NO! The OTHER right!
Turn right, boy, and you're gonna eat concrete! - AJ Foyt.
Turn the dial left 22, right...- Crow
Turn the key off...your mouth is still running!
Turn the record player down, said Tom disquietingly.
Turn the sucker over, and whack it!
Turn them into tripods? Whatever for???
Turn you into a self-pitying sissy pants - TV's Frank
Turn your 286 into a VGA pop-up toaster with Windoze!
Turn your 386 into an XT, use Windows!
Turn your 386 or 486 into a Gameboy! .. type WIN at C:\>
Turn your 386sx in to an XT: Just add Windows 3.
Turn your 486 into a GAMEBOY: type WIN at the DOS prompt
Turn your 486 into a Gameboy! .. type WIN at C:\<
Turn your 486 into a Gameboy, type WIN at the C<
Turn your 486 into a Gameboy, type WIN at the C:\>-*- SF-Quick/BW 1.00r
Turn your 486 into a Gameboy: Type WIN at C:\>
Turn your 486 into a Gameboy: Type WIN at C:\<
Turn your 486 into a Gamegear: Type WIN at C:\>
Turn your 486 into a gameboy, type OS2 at the C:\ prompt.
Turn your 486 into a gameboy, type WIN at the C:\ prompt.
Turn your 486 into a gameboy, type WIN at the C:\<
Turn your 486 into an XT - just add Windows!
Turn your 486 into an XT, run Windoze!
Turn your 486 into an XT--just add Windows!
Turn your 486/50 into an XT - Run Windows 3.0.
Turn your 486/66 into a Gameboy.. Just type WIN.COM...
Turn your PC into a DC-10: add OS/2 and then crash!
Turn your PC into a Gameboy, type WIN at the C:<
Turn your Pentium into a ZX81 - just add windoZZZzzzzz!
Turn your V.32bis into a 300 baud modem--Use Kermit!
Turn your afterburner off! You're melting my radome..
Turn your computer off Luke, use the force.
Turn your crank to FRANK! - Dr. Forrester
Turn your enemies into friends by doing something nice!
Turn your head and koff. No Sir!..Turn your head and Koff!
Turn your stumbling blocks into stepping stones.
Turn-a off tha bubble machine!--Freberg
Turnabout's fair play 8)
Turned in my guns, all I got was these crummy leg-irons.
Turned my robots into self-absorbed little poseurs - Mike
Turned over a new leaf, but underneath were the same old habits!OJW
Turning 30 isn't traumatic. It's when a 17 year old calls you "sir."
Turning a simple meal into a bizzare ritual
Turning floppies into hard drives.
Turning me into a pinata - Dr. Forrester
Turning my crank to FRANK? - Mike
Turning out Tarzan for my jungle Jane.
Turning the other cheek is vastly overrated.
Turnitoffita: The noise a film makes to tell you its over.
Turns out Clinton *DOES* want to take away our guns.
Turns out that Liza Minnelli impersonator was really Liza Minnelli!
Turns out the bread truck guy was Jesus - Tom
Turns out, Frank here's a little puss! - Dr. Forrester
Turtle Racing: Eubie Quick
Turtle Racing: Eubie Quick
Tussman's Law: Nothing's as inevitable as a mistake whose time has come
Tussman's Law: Nothing is as inevitable as a mistake whose time has come.
Tut tut! young man! that's the oldest excuse on papyrus.
Tuvok of Borg: "You will be assimilated logically and efficiently."
Tuvok: It would take several hours to explain everything in this room
Tuvok: I hate FORDS!
Tuzno ali istinito...
Tv repairmen DO IT with a vertical hold.
Tvoj ludi sin je raskanto masinu !
Tvrda stolica je stvar ukusa...
Twas Brillig and the Slithy Toves...
Twas a brave man who first ate an oyster...or an egg.
Tweedledum and Tweedledee agreed to have a battle.
Tweety of Borg: I taht I taw a Picardycat.
Tweety of Borg: Poor Puddy-tat! He got assimiwated!
Tweety of Borg: You wiww be assimewated!
Tweety of Borg: I taht I taw a Picardycat.
Tweety of Borg: Poor Puddy-tat! He got assimiwated!
Tweety of Borg: You wiww be assimewated!
Twelve Death Knights?! I close the door.
Twelve Pansy Men - Mike on jury
Twelve lines should be enough, now BEND OVER
Twelve months ago I couldn't spell OS/2
Twenty Dollars for one card? That sounds reasonable. - Collector
Twenty Percent of Zero is Better than Nothing. -- Walt Kelly
Twenty Percent of Zero is Better than Nothing. -- Walt Kelly
Twenty Yards to the Out-House, by Willy Make-it
Twenty degrees and a hockey game's on.
Twenty five thousand gropos are hardly inconspicuous - Garibaldi
Twenty five thousand!?!?! - Sheridan
Twenty minutes into the future . . .
Twenty years from now I'll look back on this and laaaaugh.
Twenty-eight percent of the rain forest is now furniture. -Herman
Twenty-four hour banking: I just don't have time for it.
Twenty-four hours, 24 beers
Twice and twice shall he be marked - Dragon Prophecy
Twice five syllables / Plus seven can't say much but / That's Haiku for you.
Twice the strength of those other leading national brands.
Twice the sugar, twice the caffine -- Jolt.
Twice to live, and twice to die - Dragon Prophecy
Twiggy bra: --<><>--
Twin Geeks: Richard Heppell Killed Laura Palmer...
Twin birth: infant replay...
Twin powered weasels - Crow
Twin seater plane crashes into cemetery, so far 967 bodies recovered
Twinkies do not have a half-life, they just keep going and going.
Twinkies have a half-life, but Ding Dongs are eternal
Twinkies have a half-life, but Velveeta is eternal
Twinkies have a half-life, but Velveeta is eternal.
Twinkies have a shelf-live .. Velveeta goes on forever!
Twinkle twinkle little star, are you the Celestial Temple from afar...
Twinkle, Twinkle Little Star, Wonder what you really are.
Twinkle, twinkle little Earth. How I wonder what you're worth.
Twinkletips: Shiny fingernails from buttered popcorn at the movies.
Twinklies have a half-life, but velveeta is eternal.
Twist & Creme, internal security force - Tom on cop cars
Twisted Sister asks US to keep the noise down.
Twisted Sister of Borg - Yes, your gonna take it! (Assimilation)
Twisted mind? Join the Twisted Minds Association!
Twisted mind? No, just bent in a few strategic places.
Twisted mind? No, just bent in several strategic places.
Twisted mind? No...just bent in several strategic places.
Twisted mind? No, just bent in a few strategic places.
Twisted mind? No, just bent in several strategic places
Twisted: n. What happens to writers that get anywhere near Voyager.
Twit filter not found; Load file BASEBALL.BAT? [Y/y/y]
Twit of the Year 1994. Congratulations!
Twit tagline list eliminates unwanted taglines.
Twit: Person who thinks FRICCATIVE is an obscene gesture.
Twitch! Twitch! - Tom
Twitting is futile. I will just post under an assumed name!
Two "C" Words: Custer and Conservative.
Two & three & four & jab & pop - Tom on fight scene
Two Amiga's ?? You have Bookends, very nice.
Two Betazoids walk into a bar. One says I'll have the same.
Two Betazoids walk into a bar. The other says, "I'll have the same."
Two Blondes in a Volkswagen: Farfromthinkin'
Two CC's should do it.
Two Curly's fighting for supremacy - Dr. F
Two Geminis in bed: Does that make a Foursome???
Two Great Tennesseans: Charlie and Jack Daniels
Two Kinds Of People I Can't Stand: You, And Everyone Else.
Two Little Girls by Rolf Harris
Two Lost Clusters Found In Writer's Brain.....
Two Minds But with a Single memory! Max Headroom
Two ROMs don't make a write
Two Soul Hunters. Did someone book a convention without telling me?
Two Thousand Pounds!: Juan Ton
Two Thousand Pounds!: Juan Ton
Two Types of People: Those who finish what they start and
Two Wrongs Don't Make A Right, But Three Lefts Do.
Two and one is three, carry one is four.
Two beers away from a beautiful day.
Two beers times 37 men = 49 cases.
Two big thumbs way up...well, way up WHAT?-Michael Medved
Two birds in the bush flock together.
Two bits shy of a word.
Two blondes in a VW. Now thats Farfromthinkin!
Two blondes in a Volkswagon: Farfromthinkin
Two blonds in a Volkswagen: "FARFROMTHINKEN"
Two blonds in a Volkswagen: farfromthinkin.
Two blonds in a Volkswagon: Farfromthinkin.
Two blonds in a Volkswagon: farfromthinkin.
Two can Live as Cheaply as One for Half as Long. -- Howard Kandel
Two can live as cheaply as one for half as long.
Two can live as cheaply as one what?
Two can live as cheaply as one, for half as long.
Two can live as cheaply as one, for half as long.
Two cars in every pot and a chicken in every garage.
Two cats are a circus, three a coup, six a revolution
Two chapters short of a novel.
Two cheerleaders ended up married, they met by chants.
Two coin collectors gathered for old dime's sake.
Two corpuscles making love in vein:
Two criteria for success are to rise early and to have a good tan.
Two dead and one wounded = 2.5 dead bodies?
Two dead and one wounded or 2.5 dead bodies. <G>
Two definitions of first-degree murder--depending on your sex.
Two definitions of self-defense: one for men, one for women.
Two degrees off square.
Two depraved elements in the universe: Feminists & Lawyers.
Two depraved elements in the universe: Feminizm & Lawyers.
Two dings I hate, See dis? Suckas dat can't count
Two dominant male-women fight for supremacy - Mike
Two down, and twenty-nine to go!
Two dumbs; know too much, know too little!!
Two elephants fell off a cliff. Boom Boom.
Two founding peoples is a political invention!
Two full screens with no taglines is NOT good.
Two game wardens, seven hunters, and a cow.
Two great American narcotics: Alchohol and Christianity.
Two great Tennesseans: Charlie and Jack Daniels.
Two great ingredients: liberty and immigrants!
Two great ingredients: liberty and emigrants!
Two great ingredients: liberty and immigrants!
Two great talkers will not travel far together.
Two guys walk into a bar *clang* *clang* "OOF!" "OW!"
Two guys walk into a bar . . . the third guy ducks.
Two guys walk into a bar. Why didn't the second one duck?
Two guys walk into a bar... *clang* *clang* "OOF!" "OW!" -SLR
Two guys walk into a bar...*clang* *clang* "OOF!" "OW!"
Two hands working do more good than a thousand clasped in prayer.
Two hands working do more than a thousand clasped in prayer
Two heads are better than one.
Two heads are better than one. John Heywood (1497-1580)
Two heads are better than one...unless you're schizophrenic.
Two heads are more numerous than one.
Two horse power - Crow as car is towed by horses
Two important numbers: 9600, 69
Two inches taller than spherical.
Two is company, three is a crowd.
Two is company, three is an orgy! Check out the Fantasy Conference!
Two is company, three is an orgy.
Two is company. Three is poor birth control!
Two is company; three is FANTASTIC!
Two kind of people in this world - winners\losers.
Two kinds of trouble in this world - living\dying.
Two ladies went for a tramp in the woods, but he got away.
Two little porkers went to congress: Gingrich and Gramm (OK, big)
Two lives left. I think I'll save one for next Christmas.
Two lost cluster's found in the writer's brain!
Two maggots were fighting in dead Ernest.
Two may keep counsel, if two be away. Heywood (1497-1580)
Two men looked through prison bars, one saw mud the other saw stars.
Two men stood alone on a pier - Mike
Two men walked into a bar, dunno why the second one didn't duck
Two minds with a single memory. -- Max Headroom
Two minutes in the punalty box for gross punning.
Two monologues do not make a dialogue. -- DeNever
Two most common elements found in the universe: Hydrogen & Stupidity.
Two most common elements hydrogen, stupidity
Two most common elements in the universe: Hydrogen & Stupidity.
Two most common elements in the universe: Hydrogen and Stupidity.
Two most common elements in the universe: Hydrogen & Stupidity
Two most common elements in the universe: Hydrogen & Stupidity.
Two most common elements in the universe: Hydrogen and Stupidity.
Two most common elements: Hydrogen & Stupidity
Two most common elements: Hydrogen and Stupidity
Two most common elements: hydrogen and stupidity.
Two most common elements: hydrogen, stupidity
Two most common things in the universe: Male and Female.
Two most uncommon elements in the world: Peace & Love.
Two of perfect virtue: one dead, the other yet unborn.
Two of the ripest tomatoes in town - Crow on geeky girls
Two peanuts went to New York. One was assaulted.
Two people can screw in a lightbulb... but in a REALLY big lightbulb.
Two people choke on one person's vomit - Tom on CPR scene
Two percent of zero is almost nothing.
Two pints make one cavort!
Two rights don't make a wrong, but three will get you back on the freeway.
Two rights don't make a wrong, they make an airplane.
Two rules for success: 1. Don't tell everything you know
Two rules for success: 1. Don't tell everything you know.
Two rules: don't sweat small stuff, everything's small stuff
Two rungs don't make a right, but ten Rungs make a ladder!
Two saucers short of a tea-service.
Two scoops of raisins, my ASS! - Joel
Two seals fell off a cliff. Arf Arf
Two sheep short of a sweater.
Two signs in a gas station window: Help wanted, Self service. - s.w.
Two silkworms were having a race, but it ended in a tie.
Two skeletons making love on a tin roof.
Two socks short of a pair.
Two soviet ships collide, one dies.
Two steps back - spin - one steps forward - grin - Do the Clinton!
Two suits short of a full deck (a half-wit).
Two sure things in life: 1)There is a God. 2)You're not Him.
Two synonimous "H" words, Homosexual and Hate.
Two tacos short of a combination plate.
Two tails are better than one.
Two telepath walk in a bar, one says: "I'll have the same"
Two terms only for congresscritters; one in office - one in jail.
Two things I don't like: people who can't count.
Two things I hate. People that can't count.
Two things I hate: People that can't count.
Two things I hate: People who can't count.
Two things are infinite; the universe & human stupidity. - Einstein
Two things are universal: hydrogen and stupidity.
Two things happen as we age; you become forgetful, and... and...
Two things happen as we grow old; We forget stuff, and... and... uh...
Two things in life that we're never prepared for: TWINS!
Two things you never report to the government: cash payments and UFOs
Two thirds of PROMOTION is MOTION.
Two tin cans and a string, that's all you need
Two tours and I never saw ONE 18 year old soldier.
Two tours in 'Nam and I never saw ONE 18 year old soldier
Two trains + one diamond = A "Gem" of a cornfield meet!
Two trains on a 500 mile dual main will meet where one track is out.
Two types of people: bagpipers and innocent bystanders!
Two undeniable truths: 1) God exists 2) You're not Him.
Two undeniable truths: 1) God exists and 2) You're not Him.
Two voices are there: one is Jed, one is Al; each is a drunken voice.
Two ways to drive a Hummer: Get rich or join the army.
Two wet tribbles having sex: :
Two words kid: Foster Home - Tom
Two words of advice: EN JOY -Dr. Forrester to Mike & Bots
Two words.Militant Halflings.
Two words: transporter liposuction
Two writes don't make a novel!
Two writes don't make a novel.
Two wrongs are only the beginning.
Two wrongs do not make a right, it takes three or more.
Two wrongs do not make a right: it usually takes 3 or 4.
Two wrongs do not make a right: it usually takes three or
Two wrongs do not make a right: it usually takes three or more.
Two wrongs don't make a right, but they come DAMN close!
Two wrongs don't make a right, but they damn sure make things even.
Two wrongs don't make a right, but they make a GREAT excuse
Two wrongs don't make a right, but they make a good excuse - Szasz
Two wrongs don't make a right, but they make a good excuse.
Two wrongs don't make a right, but three lefts do!
Two wrongs don't make a right, but three lefts do.
Two wrongs don't make a right, but three lefts will.
Two wrongs don't make a right, but three quick lefts will
Two wrongs don't make a right, but three rights make a left
Two wrongs don't make a right, but three rights make a left.
Two wrongs don't make a right, but two Wrights make an airplane ;)
Two wrongs don't make a right, it always takes three or more.
Two wrongs don't make a right, it usually takes three or four
Two wrongs don't make a right, it usually takes three or more.
Two wrongs don't make a right, it usually takes three+
Two wrongs don't make a right--three lefts do.
Two wrongs don't make a right. A left and a U-turn does!
Two wrongs don't make a right. Neither do two Clintons.
Two wrongs don't make a right. Try three.
Two wrongs don't make a right. It usually takes three or four.
Two wrongs don't make a right. Try three.
Two wrongs... are only the beginning.
Two zips & we're nekkid! - Crow on couple in jumpsuits
Two's a crowd, and three's an adult movei!
Two's company and three's the result.
Two's company, three's the result!
Two's company, three's the result.
Two's company...A schizophrenic is a crowd.
Two, four, six, eight; being Gay is as good as Straight!
Two, ten, eleven. Eyes, fingers, toes. - Gomez Addams
Two-face and Riddler. Special two card subset of the Clinton set.
Two-handed sword: (n) A useful tool for alignment problems.
Twoscore and seven years ago, our forefathers brought forth ENIAC.
Txs = Thanks
TyHoIuS aIrSe Ag SeUtBtLiInMgI NvAeLr yT AsGlLeIeNpEy
Tyler's thinking about my breasts again, Captain! - Deanna Troi
Type "/G" to access the SysOp menu!
Type "ATDT 999" for more help.
Type +++ ATH0 to continue...
Type +++ ATH0 to start engine..
Type /G to access the SysOp menu!
Type ATDT 0 for more help.
Type Kwon Do: Asian art of defensive posting.
Type faster! We only have space for 57 characters!
Type hard. You are making 1,932,247 copies.
Type me more, it makes my disk hard!
Type softly and use a fast modem.
Type softly, but carry a big tagline.
Type unto others as you would have them type unto you.
Type your tagline below:
Typed on my Ultra Megger Wallet Whammer
Typed on my Ultra Megger Wallet Whammer.
Typed with all the speed of a striking slug!
Types of sneezes: Chocolate: Herrr-shey!
Typesetters DO IT between periods
Typesetters DO IT with perfect composure
Typesetters do it between periods
Typesetters do it between periods.
Typesetters do it with em's and en's.
Typhoid Mary not found .'.@).$.E.' NO CARRIER
Typical BASIC programmer: POKE:POKE:NUDGE:NUDGE
Typical Bill Gates reprimand: "That code is ORIGINAL!"
Typical Bynar Ping-Pong Score: 10101 to 10011
Typical Canadian: "Who's Rush Limbaugh?"
Typical Government - $500,000,000 for a plane you can't see.
Typical Government - 500 Million bucks for a plane you can't see.
Typical humans, you can always count on them to mess things up.
Typical of lawyers...take a tagline...and give nothing in return.
Typical old lags, the lot of 'em.
Typical road trip with a headliner - Crow
Typing all of your message in capitals is SHOUTING!
Typing class would be a lot easier if I had 6 fingers on each hand.
Typists DO IT without wrinkling the sheets.
Typists do it with their fingertips.
Typists do it without wrinking the sheets.
Typo through the tulips with me.
Typographers DO IT with tight kerning.
Typographers do it with tight kerning.
Typographers rule, OQ
Typographers rule, OQ.
Typoo-poo...A rash of typos.
Typos are always good for a luagh.
Typos? Blame my cat.
Typos? Blame my cat.
Tyranasaurus Rex: 20 ton roadrunner from hell. -Rick Adair
Tyrannical moderators are jokes. Don't be a joke.
Tyrannosaurus Dex on the Island of Babes With Low Self-Esteem...
Tyrannosaurus Rex was a dinosaur loser, and triceratopped his own choke.
Tyrannosaurus Sex!: Ted Kennedy in a purple Barney suit.
Tyranny: a criminal organization masquerading as a government.
Tyranosaurus in mirror is closer than it appears.
Tyrant Lizard Weds TimeLordLyricist. Filk at eleven. Flames at twelve.
Tyrant of the Potatoes: Dick Tater
Tyrant: an IRC Bot.
Tyrants do it to their whole country.
Tyrants like an unarmed populous.
Tyre Shop sign - We Skid You Not.
Tyre shop sign "We skid you not"
Tyrell Corporation: More Human than Human.
t --- na und?!? ES MACHT SPASS!!! }8-))))
t h i s t a g l i n e m a d e b y L H A R C
t is better to die on your feet than live on your knees.
t:\earlgray.hot
tHE cAPS-lOCK kEY dOESN'T ever ACT UP!!!!
tHE fIRST sTEP iS tO tAKE oFF tHE cAPS lOCK.
taH pagh taHbe' (Hamlet vang wej 'ay'vang loS)
taH pagh taHbe' - Thought Master William epetai-Shakespea
taH pagh taHbe' - Thought Master William epetai-Shakespeare
taH pagh taHbe'-- Hamlet Act III, scene i (To be, or not to be)
tact: Remembering a woman's birthday, but forgetting her age.
tact: The unsaid part of what you're thinking.
tag line deleted, it was a crap one you've all seen before.
tagline 1 I really miss Bluewave!
tagline is Cloak Captioned for the Romulan Impaired.
tagline is Delyria affected This by.
tagline. This is a moebius tagline. This is a mo ...
taglines !?!?! We don't need no stinking taglines !!!!..
taglines I've stolen, never meaning to send...
taglines are great!! especially HARD ones!
taglines reflect a bias. I also have my Rush Limbaugh taglines in here as
taglines you might like and hope to see your posts again sometime! =)
taglines, "Road Kill Cafe" taglines and "Greetings from" taglines that
taglines. RPG/Medieval pretty much = D&D in my book.
tagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtag
take in the extent of my sin
take me between, and leave me there.
take the skin and peel it back now doesn't that make you feel better?
take your weapon...strike me down with all of your hatred...
taking cyberspace by Force!
talking `bout my t-t-t-tagline g-g-g-generation!
tap tap tap Is this thing on?
tar Rodgau/Germany +49-6106-79819 (2:2465/311)
tasteful words. You might have to eat them.
te sam noci spavalo pod sankom da se ne bi osecalo strancom.
technik .. who knows ?
tedious blah, blah blah..
tell when the Sysop's out of town.)) `Nuff to drive him & me crazy!
tendency to grab those types of tags. :) Hope you can use some of the
termitory: Final resting place of termites.
terra incognita. [Lat.]
terrible pain in all the diodes down my left hand side...
tesko vrijeme za matore prijatelju moj
test test test and retest
th!$ is Y8uL taGL!nE on dLugf.
th-th-th-th-That's all, folks!
than with his mouth to kiss her naked arse
thank you for turning a simple transaction into a bizzare ritual
thanks a lot. this fixed up everything......
that ever took place. If you enjoy these (and they aren't too abusive
that name no longer has any meaning to me
that part of me isn't here anymore
that was "Interrogation in d".
that which does not kill us, serves to make us strong...
that you would like since you like the Kung Fu shows -- it is
that, easy! My Net/Web/etc. board was hacked in to, and the said hacker
the Borg! Quick--look useless! Act like President Clinton.
the CANDU reactor runs on 64Kb of memory!
the Enterprise is of Paramount importance
the Fights and a rugby Game broke out.
the FlashROM was about $25 extra, and I wasn't
the Gorge: Just say no to 5.0
the Highway of Life is always under construction . . .
the Minbari Triluminary device is an artifact not created by Minbari
the PC - and Mathematics As Well. ... Pentiums melt in your
the Panda. (It's currently published by Antarctic Press). It's also a
the Russian epic "Cinderella"...
the above does not necesarily reflect common sense.
the answer my friend, is blowing out the end...
the average cucumber is at least six inches long...
the book was now a nest and the poems were eggs
the case has been tried -- by the jury inside.
the computer room no one can hear you SCREAM!
the daisies.. 'Elp! 'Elp! I'm being repressed!
the dyslexic Borg wants to laminate my WHAT??!?!??
the exact point I made several weeks ago ...
the first fall hurts. The others harden.
the game isn't made with these bugs (i don't think....) purposly.
the god of lies? - Vash They meant it affectionately. - Q
the haemoglobin protein breaks down and - SPUNG! - you're dead.
the loneliness of sweet conceit
the me that you know he don't come around much
the me that you know used to have feelings
the message is up there--whatcha reading this thing for?
the mighty Jabba asks why he must pay $50,000
the most toys {on credit} at the end wins
the needle tears a hole the old familiar sting
the new African-American UNIX interface: Malcolm X-Windows...
the new, inexperienced new kid on the block...
the night was dark as pitch or coal,
the only people we hate more than romans are the Judean Peoples Front
the problem with cats? one word: HEAT!!!!
the raping of the innocent you know the ruiner ruins everything he see
the relational distance between bodies before bad juju happens. -zf-
the rich control the government, the media, the law - Queensryche ...
the senatre republican leader is speaking, tom aid dolefully
the ship is no longer tilting, tom said listlessly
the stars will all go out, and you and I will simply fly away.
the sun is shining and all lifts are working ... pity about the snow
the telecom hummed, went SPUNG! and stuck out a tab...
the things love can drive a man to...
the ultimate law of the universe,Murphy's Law,it's not even a good idea
the voyages of the Starship Charmaine.Its mission to ask questions..
the walls are made of flesh
the way I get my adrenalin...I get it from performing... - Dione
the widow that you're the deceasd's gay lover.
the world in ONE MONTH!"
the worst thing about censorship is ħħħħħħħħ
the wsOMR, a new telemicroscope for viewing cyberspace.
theater critic: One who stones the first cast.
them back where they came from.
then *my* HD is all but dead! <*gloom*>
then God said, "I know where you sleep."
then quite sudenly, I realised life was hillarious!
then used ATZ.
then we'll see you in hell
there are countless formulas for pressing flowers
there are three things that come next, uh four...
there is a QWK remedy for the BlueWave disease.
there is no proof without truth.
there theyR,every color of the rainbow..black,white,brown
there's a deeper wave than this....
there's no sun up in the sky ... Stormy wea-ther ... :)
theres feline flesh all over the road, tom said categorically
theres nothing like a view from the cheap seats
they don't really Like warm beer - they got Lucas fridge
they heard the Voice of HaShem El*him walking in the garden Gen.3
they'll brutally ravish you and every woman in the castle! -Edmund
they're cousins, identical cousins...
thez wud bi ey funne tagliin ef Ai coold spel.
thiS iS YoUL modEM 8U dLUgs
thick George. He's got a brain the size of a weasel's wedding tackle..
thinks he's worth.
thinks in lower case and types accordingly
thinks, or doesn't <g<.
this ain't a real TagLine . . but it looks pretty close, `eh?...
this dog-eat-dog world is sure enough gettin' old!
this form ist what Odo accepted by HIMSELF! :-)
this is a test of the emergency tagline syst&*(&^@# NO CARRIER
this is only a hobby...only a hobby...only a hobby...only a ho....
this is something that just can't be understood.
this is your last chance Jabba...free us or die!...
this isn't meant to last this is for right now
this mean I am getting another message to my sysop :->
this message was written by pouring warm tea on a ouija board.
this page deliberately left blank
this page intentionally left blank
this tag wastes your time and mine...
this tagline is busy...Due to teenagers....
this tagline is encr *&^TNMG&YG*^&y978mjy,&*Y(NM7y80
this tagline may contain an encrypted satanic message
this tagline's made for stealin', an' that's just what you'll do ...
thistaglineproducedbypkzip
those of us who do.
though in general I approve of people being naked
though it all looks different now, I know its still the same.
though it all looks different now, i know its still the same -- NIN
though it all looks diffrent now I know it's stil all the same
thought and reality in fifty five characters.
three days without Trek, life becomes meaningless.
throw in a jar a of Grey Poupon and you got a deal.
throw in a jar a of mayonnaise and you got a deal.
throw in a jar of mayonnaise and you got a deal. - John DeChancie
thump thump thump Is this thing on..?
thunk
tick tick tick tick tick <Go Ahead, Steal Me> tick tick tick tick...
time: The subtle thief of youth.
tin cans and a string....
tisina odzvanja kroz noc
tlhIngan Hol Dajatlh'a' ("Do you speak Klingon?")
tlhIngan Hol Dajatlh'a? (Translation: Do you speak Klingon?)
tlhIngan Hol yejHaD muvta'wI' jIH
to actually work as intended...
to be Frank, you'd have to change your name...
to criticize the competent.
to do is change the names - the slings and arrows remain.
to err is human, to forgive is unusuale.
to exit Windows. Try the door.
to feel the heat of your heart so soft on my chest
to get your New World Order, just send SASE and freedom to the U.N.
to make your dreams come true, start by looking out your window.
to order your New World Order, just send SASE and freedom to the U.N.
to say NOTHING about Sun Ra & his Solar Astro-Infinity Arkestra!
to sorta get to a place a bunch of people were just yesterday...
to sto bih bio nebo zna, voljela me nije ni jedna
to the mating pits, as I am vivaporous.
to the south there lies the tales untold... (Electric Light Orchestra)
to the sysop for no reason sometimesFor your approval
to write online, or not to write online... That is the Question!
to you by the letters O, S, and the number 2.
to_C || !to_C
today.Confucius say: Man who has woman on ground has piece on earth!
todays weather:DARKfollowed by widely scattered light, IN THE MORNING!
together Are you suggesting that coconuts are migratory?
toliko zena koje sanjare
toliko zena koje traze tvoju pomoc
too wiks aygo, aye cudt spll geeneollojist and now i r wun!
torpedos missed the Death Star's
toucan: Two-seater outhouse.
tough guy: One who has his tatooing done by a stone mason.
tough neighborhood: Where kids use barbed wire for dental floss.
transvestite: A man who wants to eat, drink and be Mary.
trapped inside a rool of disillusion
trazim ritam u koraku, usporavam ti hod
tread so light so not to touch the grass...
trebaju mi nocas neke drage zene.
tried.
trouble with a kitten's that -eventually it becomes a cat
truth will finally and powerfully prevail." - Tom Paine
try adding some spaces! Three to be exact!
try to forget this/try to erase it from the blackboard
try to kill it away but i remember everything
try to laugh about it now but it isn't funny how everything works out
trying to open a bbs on an 80 Meg harddrive, and I pointed
turn a blond upside down & U get a brunette w/bad breath?
turn your 486 into a Gameboy, type WIN at C:\>
turned into an 8088! ... Pentium processor finally
tvoje ruke u neskladu izmedju zbilje i sna
twiddle my thumbs jst for a bit, sick of all the same old sht
twit *.* typed the moderator, smiling.
two beers, or not two beers... --Shakesbeer
two soviet ships collide, one dies
Neil Enns,
ennsnr@brandonU.ca